KR101690067B1 - Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof - Google Patents

Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof Download PDF

Info

Publication number
KR101690067B1
KR101690067B1 KR1020140156817A KR20140156817A KR101690067B1 KR 101690067 B1 KR101690067 B1 KR 101690067B1 KR 1020140156817 A KR1020140156817 A KR 1020140156817A KR 20140156817 A KR20140156817 A KR 20140156817A KR 101690067 B1 KR101690067 B1 KR 101690067B1
Authority
KR
South Korea
Prior art keywords
snp
cabbage
polynucleotide
dna
seq
Prior art date
Application number
KR1020140156817A
Other languages
Korean (ko)
Other versions
KR20160056514A (en
Inventor
김혜란
이정여
박인규
양경봉
이미예
임수환
최재필
김정은
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020140156817A priority Critical patent/KR101690067B1/en
Publication of KR20160056514A publication Critical patent/KR20160056514A/en
Application granted granted Critical
Publication of KR101690067B1 publication Critical patent/KR101690067B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 SNP(single nucleotide polymorphism) 위치 염기를 포함하는 서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드로부터 선택되는 하나 이상의 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 포함하는, 양배추의 F1 순도검정용 SNP 조성물 및 상기 SNP 폴리뉴클레오티드 증폭용 프라이머 세트에 관한 것으로, 본 발명의 SNP를 이용하면 양배추 F1의 순도를 전체 유전체 수준에서 검정할 수 있어 보다 정확하고 효율적인 결과를 얻어낼 수 있다.The present invention relates to a SNP for F1 purity determination of cabbage comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12, including a single nucleotide polymorphism (SNP) locus, or a complementary polynucleotide thereof Composition and a primer set for amplifying the SNP polynucleotide, the SNP of the present invention can be used to test the purity of cabbage F1 at the entire genome level, thereby obtaining more accurate and efficient results.

Description

양배추의 F1 순도검정을 위한 단일염기다형성 마커 세트 및 이의 용도{Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof}{Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof,

본 발명은 양배추의 F1 순도검정을 위한 단일염기다형성 마커 세트 및 이의 용도에 관한 것으로, 더욱 상세하게는 SNP(single nucleotide polymorphism) 위치 염기를 포함하는 서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드로부터 선택되는 하나 이상의 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 포함하는 양배추의 F1 순도검정용 SNP 조성물, 상기 SNP 또는 이의 cDNA를 포함하는 양배추의 F1 순도검정용 마이크로어레이, 양배추 시료에서 게놈 DNA를 분리하고 상기 SNP 위치 염기인 다형성 부위의 유전자형을 결정하는 단계를 포함하는 양배추의 F1 순도검정 방법, 상기 SNP 폴리뉴클레오티드 증폭용 프라이머 세트 및 상기 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, 양배추의 F1 순도검정을 위한 키트에 관한 것이다.The present invention relates to a single base polymorphism marker set for F1 purity assay of cabbage and its use, and more particularly to a polynucleotide comprising a polynucleotide consisting of a nucleotide sequence of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) A SNP composition for F1 purity assay of cabbage comprising at least one polynucleotide selected from the group consisting of polynucleotides or complementary polynucleotides thereof, a microarray for F1 purity assay of cabbage comprising the SNP or cDNA thereof, genomic DNA from a cabbage sample, Determining the genotype of a polymorphic site that is a SNP locus, a F1 purity assay method of cabbage, a primer set for amplifying the SNP polynucleotide, and a F1 purity of cabbage, including the primer set and a reagent for performing an amplification reaction To a kit for assay.

양배추류는 약 76백만톤의 생산량, 150억 달러의 경제적 가치(2010년 기준)를 가진 채소류 작물로서 세계 최대 재배 최소 작물군에 속한다. 양배추류는 양배추, 케일, 브로콜리, 콜라비, 콜리플라워(꽃양배추) 등과 같이 형태학적으로 다양한 아종을 가지고 있어 형태학 연구의 모델 작물이기도 하다. 특히, 영양학적 관점에서, 양배추류는 단백질, 카로테노이드 뿐만 아니라 항암 효과가 있는 글루코시놀레이트를 다량 함유하고 있다. 이러한 양배추류의 경제적 부가가치를 더 높이기 위하여, 육종가(breeder)는 높은 생산량, 병충 및 환경 스트레스에 저항성을 가진, 또는 유용물질을 많이 함유한 양배추류를 만들기 위해 끊임없이 노력해 왔다.Cabbage is a vegetable crop with an output of about 76 million tons and an economic value of $ 15 billion (2010). It is among the world's largest cultivated crops. Cabbage is a model crop of morphological research with morphologically diverse subspecies such as cabbage, kale, broccoli, cola bean, cauliflower (cauliflower). In particular, from a nutritional point of view, cabbage contains a large amount of protein, carotenoid as well as glucosinolate with anticancer effect. To further increase the economic value of these cabbages, breeders have been endeavoring to produce cabbages that are resistant to high yields, pest and environmental stresses, or contain many useful substances.

일반적으로 우수한 양친의 교배를 통해 만들어지는 F1은 잡종강세 현상으로 인해 양친과 비교하여 생산량, 저항성 정도, 균질성 등에서 높은 퀄리티를 가지고 있고, F1 식물체로부터 얻어지는 종자를 재사용할 수 없기 때문에 종묘회사에서는 F1 종자 개발을 선호하며 이는 전세계의 종자 개발 방향이기도 하다. F1은 개발된 후에 상품화를 위한 대량 채종을 한다. 이때, 양친의 순도(purity), 채종시 다른 꽃가루의 오염, 또는 양친의 자가합성으로 인한 오염 등이 이루어질 수 있어, 최종 대량 채종 후에는 F1의 순도 검정을 시행한다. F1 순도 검정 시 일정 수의 F1을 재배하여 표현형의 균일성(uniformity)을 보거나 분자마커를 사용한다. 표현형에 의존한 판별방법은 많은 시간 및 노동이 필요할 뿐만 아니라 재현성이 떨어지는 단점이 있었다. 또한 형태학적 판별은 명확한 유전적 특성(genetic attribute)을 반영하지 못하며, 조기판별이 불가능하다. 일부 분자마커를 사용하여 순도검정을 하지만, 이때 분자마커는 F1의 순도 검정을 위한 마커가 아니라, 단순하게 양친의 차이를 보이는 마커를 무작위하게 선발하여 순도검정을 수행하기 때문에 시간적 경제적인 손실이 크고, 또한 특정 유전자위만을 대상으로 순도검정이 수행되는 것이기에 전체 유전체 수준에서의 검정이 불가능하다.Generally, F1 produced through superior parent crossing has a high quality in terms of yield, resistance and homogeneity compared with the parent due to hybrid stress, and seeds obtained from F1 plants can not be reused. Therefore, It is also the direction of seed development around the world. F1 is developed and mass-produced for commercialization. At this time, the purity of the parent, the pollution of other pollen during the seeding, or the contamination due to the self-synthesis of the parent may occur, and the purity test of F1 is carried out after the final mass. In the F1 purity test, grow a certain number of F1 to see the uniformity of the phenotype or use a molecular marker. The discrimination method based on phenotype not only requires a lot of time and labor, but also has a disadvantage of poor reproducibility. Morphological discrimination does not reflect a clear genetic attribute, and early identification is impossible. Although some molecular markers are used to perform purity assays, the molecular markers are not a marker for purity testing of F1, but merely randomly select markers showing differences in parental status to perform purity assays, resulting in high time and economic losses , And because purity assays are performed on specific gene wisdoms, it is impossible to perform a test at the whole genome level.

본 발명에서는 양배추 F1의 순도검정에 광범위하게 사용할 수 있는 마커를 개발코자 하였다.In the present invention, a marker which can be widely used for assaying the purity of cabbage F1 was developed.

한편, 한국등록특허 제0652501호에는 '금싸라기 계통 참외의 에프1 종자 순도검정방법'이 개시되어 있고, 한국등록특허 제1014238호에는 '수박 F1 종자 순도 검정 방법'이 개시되어 있으나, 본 발명의 양배추의 F1 순도검정을 위한 단일염기다형성 마커 세트 및 이의 용도에 대해서는 기재된 바가 없다.Korean Patent No. 0652501 discloses a method for assaying the purity of F-1 seeds of the melon family, and Korean Patent No. 1014238 discloses a method for assaying the watermelon F1 seed purity. However, There is no description of a single base polymorphism marker set and its use for the F1 purity assay.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 23 계통의 양배추류의 염기서열들을 사용하여 전체 유전체 수준의 단일염기다형성(SNP) 마커를 발굴하고, 상기 23 계통에서 다형성이 많이 나타나는 구간을 분석하여, 이 구간에서 23 계통 중 6 계통 이상에서 다형성을 보이는 SNP 분자 마커로 필터링을 수행하였다. 그 후, 염색체별로 SNP를 선별하고 각각의 프라이머 세트를 제작한 뒤, 유전형분석을 실시하여, 양친은 동형접합적(homozygous)이고 F1은 이형접합적(heterozygous)으로 확인되는 SNP를 염색체별로 선발하여 최종 12개의 F1 순도 검정용 마커 세트를 개발함으로써, 본 발명을 완성하였다.SUMMARY OF THE INVENTION The present invention has been made in view of the above-described needs, and the present inventors have discovered that a nucleotide sequence of 23 lines of cabbage can be used to identify a single nucleotide polymorphism (SNP) marker of a total genome level, The analysis was performed with SNP molecular markers showing polymorphism in more than 6 out of 23 lines in this section. Then, SNPs were selected for each chromosome, and each primer set was prepared. Genomic analysis was performed to select SNPs homozygous for both parents and F1 identified as heterozygous for each chromosome The present invention has been accomplished by developing a final set of 12 markers for F1 purity assay.

상기 과제를 해결하기 위해, 본 발명은 SNP(single nucleotide polymorphism) 위치 염기를 포함하는 서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드로부터 선택되는 하나 이상의 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 포함하는, 양배추의 F1 순도검정용 SNP 조성물을 제공한다.In order to solve the above-mentioned problems, the present invention provides a polynucleotide comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) position base or a complementary polynucleotide thereof. SNP composition for F1 purity assay of cabbage.

또한, 본 발명은 상기 SNP 또는 이의 cDNA를 포함하는 양배추의 F1 순도검정용 마이크로어레이를 제공한다.The present invention also provides a microarray for F1 purity determination of cabbage comprising the SNP or cDNA thereof.

또한, 본 발명은 양배추 시료에서 게놈 DNA를 분리하여 각 SNP 위치 염기인 다형성 부위의 유전자형을 결정하는 단계를 포함하는 양배추의 F1 순도검정 방법을 제공한다.In addition, the present invention provides a F1 purity assay method of cabbage comprising a step of isolating genomic DNA from a cabbage sample and determining a genotype of a polymorphic site as a base of each SNP.

또한, 본 발명은 상기 서열번호 1 내지 12의 염기서열로 이루어진 SNP 폴리뉴클레오티드 증폭용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for amplifying a SNP polynucleotide comprising the nucleotide sequences of SEQ ID NOS: 1-12.

또한, 본 발명은 상기 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, 양배추의 F1 순도검정을 위한 키트를 제공한다.The present invention also provides a kit for F1 purity assay of cabbage comprising the primer set and a reagent for carrying out an amplification reaction.

본 발명에 따른 단일염기다형성(SNP) 마커 세트는 양배추의 F1 순도검정은 물론, 양친 특히 모본의 자가합성으로 인한 모본 원종의 오염을 선별해낼 수 있으며, F1의 순도를 전체 유전체 수준에서 검정할 수 있어 보다 정확하고 효율적인 결과를 얻어낼 수 있으므로, 산업적으로 유용하게 이용될 수 있을 것이다.The single nucleotide polymorphism (SNP) marker set according to the present invention is capable of screening contamination of the parent species due to self synthesis of the parent, especially the parent, as well as the F1 purity of cabbage, and the purity of F1 can be assayed at the entire genome level Therefore, it is possible to obtain more accurate and efficient results, so that it can be industrially useful.

도 1은 본 발명의 SNP 및 InDel 마커 분석 과정의 모식도이다.
도 2는 F1 품종을 개발한 양친 원종과 개발된 F1을 1 내지 3 개체씩 26개 세트를 본 발명에서 개발된 F1 순도 검정마커 세트를 이용하여 유전형 분석을 수행한 결과이다.1 is a schematic diagram of the SNP and InDel marker analysis process of the present invention.
FIG. 2 is a result of performing genotyping analysis using a set of F1 purity marker markers developed in the present invention, with 26 sets of 1 to 3 individuals, each of which developed a F1 breed and developed F1.

본 발명의 목적을 달성하기 위하여, 본 발명은 SNP(single nucleotide polymorphism) 위치 염기를 포함하는 서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드로부터 선택되는 하나 이상의 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 포함하는, 양배추의 F1 순도검정용 SNP 조성물을 제공한다.In order to accomplish the object of the present invention, the present invention includes at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) base or its complementary polynucleotide ≪ RTI ID = 0.0 > F1 < / RTI > purity assay for cabbage.

상기 서열번호 1 내지 12는 상기 각각의 SNP 부위의 염기서열을 포함하는 폴리뉴클레오티드이다. 상기 서열번호 1 내지 12는 다형성 부위를 포함하는 다형성 서열이다. 다형성 서열(polymorphic sequence)이란 폴리뉴클레오티드 서열 중에 SNP를 나타내는 다형성 부위(polymorphic site)를 포함하는 서열을 말한다. 상기 폴리뉴클레오티드 서열은 DNA 또는 RNA가 될 수 있다.SEQ ID NOS: 1 to 12 are polynucleotides comprising the nucleotide sequence of each SNP site. SEQ ID NOS: 1 to 12 are polymorphic sequences comprising polymorphic sites. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a SNP in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

본 발명의 일 구현 예에 따른 SNP 조성물에 있어서, 상기 SNP 위치 염기는 서열번호 1 부터 서열번호 12 까지 모두 61번째로, 다형성 염기 정보는 표 3의 SNP 염기서열 정보에 [/]로 표시하였다.In the SNP composition according to an embodiment of the present invention, the SNP position base is 61st from SEQ ID NO: 1 to SEQ ID NO: 12, and the polymorphic base information is indicated by [/] in the SNP nucleotide sequence information of Table 3.

본 발명에 따른 양배추의 F1 순도검정용 SNP를 구성하는 각 단일 SNP의 폴리뉴클레오티드는 바람직하게는 10개 이상의 연속 염기이며, 더욱 바람직하게는 15개 이상의 연속 염기이며, 더더욱 바람직하게는 20개 이상의 연속 염기이며, 가장 바람직하게는 서열번호 1 내지 12의 각 서열이다.The polynucleotide of each single SNP constituting the SNP for F1 purity assay of cabbage according to the present invention is preferably at least 10 continuous bases, more preferably at least 15 continuous bases, even more preferably at least 20 consecutive bases Base, most preferably each sequence of SEQ ID NOS: 1-12.

본 발명은 또한, 상기 SNP의 폴리뉴클레오티드, 이에 의해 코딩되는 폴리펩티드 또는 이의 cDNA를 포함하는 양배추의 F1 순도검정용 마이크로어레이를 제공한다. 바람직하게는, 상기 폴리뉴클레오티드는 아미노-실란, 폴리-L-라이신 또는 알데히드의 활성기가 코팅된 기판에 고정될 수 있으나, 이에 제한되지는 않는다. 바람직하게는, 상기 기판은 실리콘 웨이퍼, 유리, 석영, 금속 또는 플라스틱일 수 있으나, 이에 제한되지는 않는다. 상기 폴리뉴클레오티드를 기판에 고정화시키는 방법으로는 피에조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting) 법, 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용할 수 있다.The present invention also provides a microarray for F1 purity determination of cabbage comprising a polynucleotide of the SNP, a polypeptide encoded thereby, or cDNA thereof. Preferably, the polynucleotide may be immobilized on a substrate coated with an activator of amino-silane, poly-L-lysine or aldehyde, but is not limited thereto. Preferably, the substrate may be a silicon wafer, glass, quartz, metal or plastic, but is not limited thereto. As a method for immobilizing the polynucleotide on a substrate, a micropipetting method using a piezo electric method, a method using a pin-type spotter can be used.

본 발명에 따른 마이크로어레이는 본 발명에 따른 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드, 그에 의해 코딩되는 폴리펩티드 또는 그의 cDNA를 이용하여 본 분야의 당업자에게 알려져 있는 통상적인 방법에 의해 제조될 수 있다.The microarray according to the present invention can be produced by a conventional method known to those skilled in the art using a polynucleotide according to the present invention or a complementary polynucleotide thereof, a polypeptide encoded thereby, or cDNA thereof.

본 발명은 또한,The present invention also relates to

양배추 시료에서 게놈 DNA를 분리하는 단계; 및Isolating the genomic DNA from the cabbage sample; And

본 발명의 서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드의 각 SNP(single nucleotide polymorphism) 위치 염기인 다형성 부위의 유전자형을 결정하는 단계를 포함하는 양배추의 F1 순도검정 방법을 제공한다.There is provided a F1 purity assay method of cabbage comprising the step of determining a genotype of a polymorphic site which is a base of each SNP (single nucleotide polymorphism) of a polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12 of the present invention.

본 발명의 방법에 있어서, 양배추 시료로부터 게놈 DNA를 분리하는 방법은 당업계에 알려진 통상적인 방법을 통하여 이루어질 수 있다. 예를 들면, 조직 또는 세포로부터 DNA를 직접적으로 정제하거나 PCR과 같은 증폭 방법을 사용하여 특정한 영역을 특이적으로 증폭하고 이를 분리함으로써 이루어질 수 있다. 본 발명에 있어서, DNA란 DNA 뿐만 아니라 mRNA로부터 합성되는 cDNA도 포함한다. 피검체로부터 핵산을 얻는 단계는 예를 들면, PCR 증폭법, 리가제 연쇄 반응(LCR), 전사증폭(transcription amplification), 자가유지 서열복제 및 핵산에 근거한 서열 증폭 (NASBA)이 사용될 수 있으나, 이에 제한되지는 않는다.In the method of the present invention, a method of isolating genomic DNA from a cabbage sample can be performed by a conventional method known in the art. For example, DNA can be directly purified from tissues or cells or amplified by specific amplification of specific regions using amplification methods such as PCR and separation thereof. In the present invention, DNA includes not only DNA but also cDNA synthesized from mRNA. For example, PCR amplification, LCR, transcription amplification, self-sustained sequence replication and nucleic acid-based sequence amplification (NASBA) can be used to obtain the nucleic acid from the subject, But is not limited to.

분리된 DNA의 염기서열의 결정은 당업계에 알려진 다양한 방법에 의하여 이루어질 수 있다. 예를 들면, 디데옥시법에 의한 직접적인 핵산의 뉴클레오티드 서열의 결정을 통하여 이루어지거나, SNP 부위의 서열을 포함하는 프로브 또는 그에 상보적인 프로브를 상기 DNA와 혼성화시키고 그로부터 얻어지는 혼성화 정도를 측정함으로써 다형성 부위의 뉴클레오티드 서열을 결정하는 방법 등이 이용될 수 있으나, 이에 제한되지는 않는다. 상기 혼성화의 정도는 예를 들면, 검출가능한 표지를 표적 DNA에 표지하여, 혼성화된 표적 DNA 만을 특이적으로 검출함으로써 이루어질 수 있으며, 그외 전기적 신호 검출방법 등이 사용될 수 있으나, 이에 제한되지는 않는다. 본 발명에 따른 양배추의 F1 순도 검정 방법은 바람직하게는, 상기 양배추 시료로부터 분리한 핵산 시료를 본 발명에 따른 SNP를 포함하는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 또는 이와 혼성화하는 폴리뉴클레오티드와 혼성화시킨 후 혼성화 결과를 검출하는 단계를 포함할 수 있다.Determination of the base sequence of the isolated DNA can be performed by various methods known in the art. For example, a probe comprising a sequence at the SNP site or a complementary probe thereof is hybridized with the DNA, and the degree of hybridization obtained is determined through determination of the nucleotide sequence of the direct nucleic acid by the dideoxy method, A method for determining the nucleotide sequence, and the like can be used, but the present invention is not limited thereto. The degree of hybridization can be determined, for example, by marking a detectable label on the target DNA and specifically detecting only the hybridized target DNA, and other electrical signal detection methods can be used, but the present invention is not limited thereto. The F1 purity assay method of cabbage according to the present invention is preferably a method in which a nucleic acid sample isolated from the cabbage sample is hybridized with a polynucleotide comprising the SNP according to the present invention or a complementary polynucleotide thereof or a polynucleotide hybridizing therewith And detecting the result of post-hybridization.

또한, 본 발명은 본 발명의 서열번호 1 내지 12의 염기서열로 이루어진 SNP(single nucleotide polymorphism) 폴리뉴클레오티드 증폭용 프라이머 세트를 제공한다.The present invention also provides a primer set for amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 12 of the present invention.

본 발명의 프라이머 세트는 서열번호 13 내지 60의 총 12개 세트의 올리고뉴클레오티드 프라이머 세트로 이루어진 군으로부터 선택되는 하나 이상의 프라이머 세트를 포함하며, 상기 각 프라이머 세트는 ASP1, ASP2, LSP 및 STA의 4개의 프라이머가 하나의 세트를 이루며, 예를 들면, 순서대로 서열번호 13부터 16까지는 서열번호 1의 SNP 폴리뉴클레오티드를 증폭하기 위한 프라이머 세트이며, 서열번호 17부터 20까지는 서열번호 2의 SNP 폴리뉴클레오티드를 증폭하기 위한 프라이머 세트이며, 서열번호 53부터 56까지는 서열번호 11의 SNP 폴리뉴클레오티드를 증폭하기 위한 프라이머 세트이며, 서열번호 57부터 60까지는 서열번호 12의 SNP 폴리뉴클레오티드를 증폭하기 위한 프라이머 세트이다. 본 발명의 STA(SNPtype assay specific target amplification primer)와 LSP(SNPtype assay locus specific primer)는 목표 염기서열(표 3) 증폭을 위해 사용되는 프라이머 세트이며, LSP와 ASP(SNPtype assay allele specific primer)는 SNP 위치 염기를 확인하기 위해 사용되는 프라이머 세트이다. ASP 프라이머의 3' 말단 최종 염기가 SNP 위치 염기를 나타내는데, 본 발명의 ASP1은 TO1000 참조서열에 대한 프라이머이며, ASP2는 타 품종의 유전체 서열에 대한 프라이머이다(표 4).The primer set of the present invention comprises at least one set of primers selected from the group consisting of a total of 12 sets of oligonucleotide primers of SEQ ID NOS: 13 to 60, each set of ASP1, ASP2, LSP and STA SEQ ID NOS: 13 to 16 are sets of primers for amplifying the SNP polynucleotides of SEQ ID NO: 1, SEQ ID NOs: 17 to 20 are amplified by the amplification of the SNP polynucleotides of SEQ ID NO: 2, SEQ ID NOs: 53 to 56 are primer sets for amplifying the SNP polynucleotide of SEQ ID NO: 11, and SEQ ID NOs: 57 to 60 are primer sets for amplifying the SNP polynucleotide of SEQ ID NO: 12. The SNP type assay specific target amplification primer (STA) and the LSP (SNPtype assay locus specific primer) of the present invention are primer sets used for amplification of target sequence (Table 3). LSP and ASP (SNPtype assay allele specific primer) Location A primer set used to identify bases. ASP 3 of the ASP primer The final base represents the SNP locus, ASP1 of the present invention is the primer for the TO1000 reference sequence and ASP2 is the primer for the genomic sequence of the other varieties (Table 4).

본 발명에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity) 뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

본 발명은 또한, 본 발명의 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, 양배추의 F1 순도검정을 위한 키트를 제공한다. 본 발명의 키트에서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨, 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.The present invention also provides a kit for F1 purity assay of cabbage comprising a primer set of the present invention and a reagent for carrying out an amplification reaction. In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

또한, 본 발명은In addition,

양배추 시료에서 게놈 DNA를 분리하는 단계;Isolating the genomic DNA from the cabbage sample;

상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 본 발명의 서열번호 1 내지 12의 염기서열로 이루어진 SNP(single nucleotide polymorphism) 폴리뉴클레오티드를 증폭하는 단계; 및Amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 12 of the present invention by using the separated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set of the present invention ; And

상기 증폭 산물을 검출하는 단계를 포함하는, 양배추의 F1 순도검정 방법을 제공한다.And detecting the amplification product. ≪ Desc / Clms Page number 2 >

본 발명의 방법에 있어서, 양배추 시료로부터 게놈 DNA를 분리하는 방법은 당업계에 알려진 통상적인 방법을 통하여 이루어질 수 있으며, 그 방법은 전술한 바와 같다. 상기 분리된 양배추 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 하나 이상의 올리고뉴클레오티드 프라이머 세트를 프라이머로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.In the method of the present invention, the method of isolating the genomic DNA from the cabbage sample can be performed by a conventional method known in the art, and the method is as described above. The target sequence may be amplified by performing amplification reaction using the separated cabbage genomic DNA as a template and using one or more sets of oligonucleotide primers according to one embodiment of the present invention as primers. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

본 발명의 방법에 있어서, 상기 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 일 구현 예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 Cy-5 또는 Cy-3이다. 표적 서열의 증폭시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트는 상기에 기재된 바와 같다.In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The set of one or more oligonucleotide primers used to amplify the target sequence is as described above.

본 발명의 방법에 있어서, 양배추의 F1 순도검정을 위한 방법은 상기 증폭 산물을 검출하는 단계를 포함하며, 상기 증폭 산물의 검출은 시퀀싱, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체 섬광 계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
In the method of the present invention, a method for F1 purity assay of cabbage comprises the step of detecting the amplification product, wherein the detection of the amplification product is performed by sequencing, DNA chip, gel electrophoresis, radioactivity measurement, But is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

재료 및 방법Materials and methods

실험재료Experimental material

국내외에서 수집한 23 계통의 양배추류의 계통명 및 출처는 하기 표 1과 같다.The names and sources of the 23 cabbages collected at home and abroad are shown in Table 1 below.

시료 번호Sample number 계통명System name 제공기업/출처Provided company / source K0001K0001 #107-HO-154# 107-HO-154 아시아종묘Asian seedlings K0002K0002 #5-KK-146# 5-KK-146 아시아종묘Asian seedlings K0003K0003 #105-RK-P6-1# 105-RK-P6-1 아시아종묘Asian seedlings K0004K0004 #106-HY-164# 106-HY-164 아시아종묘Asian seedlings K0005K0005 #108-EB-858-7# 108-EB-858-7 아시아종묘Asian seedlings K0006K0006 #10-JK-JK-2# 10-JK-JK-2 아시아종묘Asian seedlings K0007K0007 #14-KR,518# 14-KR, 518 아시아종묘Asian seedlings K0008K0008 #15-OK,517# 15-OK, 517 아시아종묘Asian seedlings K0009K0009 #17-JK,JK-2# 17-JK, JK-2 아시아종묘Asian seedlings K0010K0010 #103-MT-621# 103-MT-621 아시아종묘Asian seedlings K0011K0011 LN-748-4LN-748-4 누넴 종묘Nunem seedlings K0012K0012 100587100587 삼성종묘Samsung seedling K0013K0013 FA-747-1FA-747-1 누넴 종묘Nunem seedlings K0014K0014 #701, CT-12 female# 701, CT-12 female 아시아종묘Asian seedlings K0015K0015 107140107140 삼성종묘Samsung seedling K0016K0016 #7, HRIGRU009386# 7, HRIGRU009386 HRI, 영국HRI, United Kingdom K0017K0017 102119102119 삼성종묘Samsung seedling K0018K0018 #111-DS-2437-51# 111-DS-2437-51 아시아종묘Asian seedlings K0019K0019 #112-QT-DWB-25# 112-QT-DWB-25 아시아종묘Asian seedlings K0020K0020 #116-PH-347-51# 116-PH-347-51 아시아종묘Asian seedlings K0021K0021 Badger Inbred 16Badger Inbred 16 HRI, 영국HRI, United Kingdom K0022K0022 HRIGRU007826HRIGRU007826 HRI, 영국HRI, United Kingdom K0023K0023 HRIGRU009617HRIGRU009617 HRI, 영국HRI, United Kingdom

SNPSNP 마커Marker 선별 및 유전형분석 Screening and genotyping

국내외에서 수집한 23 계통의 양배추류를 기반으로 10X 이상의 NGS 리드를 생산하였다. 생산된 리드는 퀄리티(quality)가 낮은 서열을 제거한 후 446Mb의 양배추류 참조서열(TO1000)에 BWA(Burrows-Wheeler Alignment tool)를 이용해 맵핑하였다. 맵핑된 리드들은 SNP 콜링(calling)의 정확도를 높이기 위해 게놈 분석 툴인 GATK(http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit)를 이용하여 이중 마스킹(duplicate masking), 국소적 재정렬(local realignment) 과정을 수행한 후 UnifiedGenotyper를 이용해 SNP(Single Nucleotide Polymorphism)와 InDel(Insertion-Deletion)을 예측하였다. 23계통에서 만들어진 SNP/InDel을 염색체의 좌(loci)를 기반으로 병합한 후 SNP/InDel 매트릭스(matrix)를 생성한 후, 각 SNP 위치좌(locus)를 대상으로 인접 60bp에서 SNP 또는 InDel이 나타나는지 유무를 조사하였다. 그 결과 인접 60bp에서 SNP 또는 InDel이 없는 부분을 SNP 마커 개발의 타겟으로 선정하고 Primer3(http://bioinfo.ut.ee/primer3-0.4.0/primer3/input.htm)를 이용하여 특유의 SNP를 검출할 수 있는 프라이머를 생산하였다. 그 후 mesohexaploid 지놈의 특성을 고려하여, 생산된 프라이머를 TO1000 영역에 다시 맵핑하여 프라이머가 단일 위치좌만 증폭하는지를 평가한 후 단일 염기좌 맵핑 영역만 이용하여 HVR(hyper-variable region)을 발굴하였고, 이로부터 2-5Mb 단위로 96개의 SNP 마커를 선정하였다. 각 SNP를 유전형분석(genotyping) 할 수 있는 프라이머 세트를 제작하여, 양친과 이로부터 개발된 F1을 한 세트로하여 총 26 세트의 유전자형을 분석하였다. 각 SNP의 유전형 분석 방법은 Fluidigm 플랫폼을 이용하였다. 이 유전형분석 결과 중, 총 7세트 이상에서 양친이 동형접합(homozygous)하고 F1에서 이형접합(heterogygous)하게 분석되는 SNP를 각 염색체별로 1-2개 선발하여 최종 12개 SNP 좌(loci)와 이를 유전형분석 할 수 있는 프라이머 세트(Fluidigm 플랫폼)를 양배추류의 F1 순도검정 마커 세트로 개발하였다.
Based on the 23 lines of cabbages collected at home and abroad, we have produced NGS leads of 10X or more. The produced leads were mapped using a Burrows-Wheeler Alignment tool (BWA) to a 446 Mb cabbage reference sequence (TO1000) after removing low quality sequences. Mapped leads can be duplicated masking using the genomic analysis tool GATK (http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit) to increase the accuracy of SNP calling, After performing the local realignment process, we used UnifiedGenotyper to predict SNP (Single Nucleotide Polymorphism) and InDel (Insertion-Deletion). The SNP / InDel matrix was generated by merging the SNP / InDel of 23 lines based on the loci of the chromosomes. Then, SNP / InDel matrix was generated, and SNPs or InDels appeared at 60 bp adjacent to the locus of each SNP Respectively. As a result, SNP markers were selected as targets for SNP markers in the vicinity of 60 bp, and Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/input.htm) Was produced. Then, considering the characteristics of the mesohexaploid genome, the generated primer was mapped again to the TO1000 region to evaluate whether the primer only amplified in a single position, and then a hyper-variable region (HVR) was extracted using only a single base left mapping region. From this, 96 SNP markers were selected in 2-5 Mb units. A set of primers capable of genotyping each SNP was constructed, and a total of 26 sets of genotypes were analyzed using a set of F1s developed from parents and their parents. Genotype analysis of each SNP was performed using the Fluidigm platform. Among these genotyping results, SNPs that are homozygous and heterogygous in F1 are selected from 1-2 sets of each chromosome, and 12 SNP loci and A primer set (Fluidigm platform) capable of genotyping was developed as a cabbage F1 purity black marker set.

실시예 1. SNP 통계치Example 1. SNP statistics

양배추류의 23 계통의 고품질의 리드(high quality read)를 맵핑한 결과 82%이상이 TO1000 참조서열에 맵핑되었다. 맵핑된 리드를 기반으로 분석한 SNP 결과는 표 2와 같으며, 평균 4,216,350개의 SNP와 437,484개의 InDel이 예측 되었다. 예측된 SNP/InDel을 기반으로 염색체 위치를 기반으로 SNP/InDel 매트릭스를 만든 결과, 총 21,587,643개의 좌(loci)에서 SNP 또는 InDel 변이가 나타나는 것을 알 수 있었다. 인접 60bp 서열에서 서열 변이가 없는 SNP를 조사하여 프라이머를 만든 결과, 121,909개의 SNP 마커 후보군이 만들어졌고, 그 중 101,639개의 SNP 마커가 단일 위치 증폭이 될 것으로 예측되었다.Mapping of high quality read of 23 lines of cabbage has resulted in more than 82% mapping to the TO1000 reference sequence. Based on the mapped leads, the SNP results are shown in Table 2, with an average of 4,216,350 SNPs and 437,484 InDels predicted. Based on the predicted SNP / InDel, SNP / InDel matrix was constructed based on the chromosomal location. As a result, SNP or InDel mutations were found in a total of 21,587,643 loci. As a result of priming with SNP without sequence mutation in the adjacent 60 bp sequence, 121,909 SNP marker candidates were generated, and 101,639 SNP markers were predicted to be single position amplification.

Figure 112014108713526-pat00001
Figure 112014108713526-pat00001

실시예 2. SNP 마커 선정Example 2. Selection of SNP markers

양배추류 게놈에서 서열 변이가 많이 일어나는 영역을 선정하기 위하여 각 계통의 SNP 정보를 기반으로 100K 범위에 나타나는 SNP의 빈도수(frequency)를 이용하여 two-sided hypergeometric test를 수행하였다. 그 결과, 각 계통에서 유의확률(p-value)이 0.001이하인 영역을 HVR(hyper-variable region)으로 정하고, 23계통 중 HVR이 7계통 이상에서 나타나는 영역을 cHVR(common HVR region)으로 정의하였다. 그래서, cHVR 영역의 SNP 마커를 파싱(parsing)한 후 23계통의 양배추류에서 4계통 이상에서 SNP 다형성을 보이는 SNP 마커만을 2-5Mb 간격으로 선정하였다. 그 후 Fluidigm으로 96개의 SNP 마커의 유전형분석을 확인하여 12개의 순도 검정을 위한 SNP 마커 세트를 만들었다(표 3).Two-sided hypergeometric tests were performed using the frequency of SNPs in the 100K range based on the SNP information of each lineage to select regions where the sequence variation occurs frequently in the cabbage genome. As a result, a region with a significance (p-value) of 0.001 or less was defined as a hypervariable region (HVR) in each system, and a region in which the HVR was present in seven or more systems was defined as cHVR (common HVR region). Thus, after parsing the SNP markers in the cHVR region, only SNP markers showing SNP polymorphism in more than 4 lines in 23 lines of cabbage were selected at intervals of 2-5Mb. The genotype analysis of 96 SNP markers was then confirmed by Fluidigm to create a set of SNP markers for 12 purity assays (Table 3).

F1 순도 검정을 위한 12개의 SNP 염기서열 정보12 SNP nucleotide sequences for F1 purity assay SNP 이름SNP name 서열정보(5'→3') (서열번호)Sequence information (5 '- > 3') (SEQ ID NO: S1S1 ATTTTTTTTTATGTTTGGTTGTTTAAAGATCTTTATGCAAACCCTCGAGGCTCAAAAAAT[G/T]TCCTCTCTTTAGTTAGGATGATTGAAACTTACCTCCTCTATGGCTATTGCAACCTAATTC (1)ATTTTTTTTTATGTTTGGTTGTTTAAAGATCTTTATGCAAACCTCGAGGCTCAAAAAAT [G / T] TCCTCTCTTTAGTTAGGATGATTGAAACTTACCTCCTCTATGGCTATTGCAACCTAATTC (1) S2S2 TGTTGCTGTAGATGATCTTTCTGTGTGCTGCTTATGTCAAGATAGGAATTTTAAGGTGGT[T/C]GAAAGATGATCTTACCATGTGCAGTGTTGTTTTGTTTTCAATAGGTCAGAGCATTATGCG (2)TGTTGCTGTAGATGATCTTTCTGTGTGCTGCTTATGTCAAGATAGGAATTTTAAGGTGGT [T / C] GAAAGATGATCTTACCATGTGCAGTGTTGTTTTGTTTTCAATAGGTCAGAGCATTATGCG (2) S3S3 AGGAGGAGAGATGCATTAAGATCGACTGGTGGACGACTAATGTATTTGTAATTGTGAGAA[G/C]TATAACGGATGGCTTATACGCTTTGAACATCGTGCTTCAGGTGTGTTACCTTTTGCTTTC (3)AGGAGGAGAGAGATGCATTAAGATCGACTGGTGGACGACTAATGTATTTGTAATTGTGAGAA [G / C] TATAACGGATGGCTTATACGCTTTGAACATCGTGCTTCAGGTGTGTTACCTTTTGCTTTC (3) S4S4 AGCAGAGAAACATGTCCTAAGCTCCTTGATTTGATTCCTCAAGAAAGAAAATGGTACCAT[G/A]ATGAAGAGAAGAACAACTCAGATCAAGAAAAGAAACTTGAGCTAAGGCTTGCACCACCCG (4)AGCAGAGAAACATGTCCTAAGCTCCTTGATTTGATTCCTCAAGAAAGAAAATGGTACCAT [G / A] ATGAAGAGAAGAACAACTCAGATCAAGAAAAAAACTTGAGCTAAGGCTTGCACCACCCG (4) S5S5 ATTACAACCAGATTGCTCAGGTTTGTGTTGTACACTCATCTCCAAGTTGTATCAAAGGTC[G/T]CTAATACAGAACTTCCGTTTGCCAGCCTAATCTGATTGTTAACGTTGCTTCTCTAAATTT (5)ATTACAACCAGATTGCTCAGGTTTGTGTTGTACACTCATCTCCAAGTTGTATCAAAGGTC [G / T] CTAATACAGAACTTCCGTTTGCCAGCCTAATCTGATTGTTAACGTTGCTTCTCTAAATTT (5) S6S6 ATTAATTAGGAGGGATTCGTATGGAAGGTATGTCCAGATTTATTCCAGAACAGTACATTC[T/C]GATTTTTCAGTTTAGCTTCTACTTATTTTGGCAGCTTTATGCAAAACCAATAACGTAATT (6)ATTAATTAGGAGGGATTCGTATGGAAGGTATGTCCAGATTTATTCCAGAACAGTACATTC [T / C] GATTTTTCAGTTTAGCTTCTACTTATTTTGGCAGCTTTATGCAAAACCAATAACGTAATT (6) S7S7 TATTTTATTCAGATTAGAACAAAACTTTATATTCGTATCCAAAAATGGCGAAGAAGATAA[T/C]ATTTTCCATCATTTTTGTCGTTGACCCGATTCTTCACACATGGTTGAACATCTTCTGTAT (7)TATTTTATTCAGATTAGAACAAAACTTTATATTCGTATCCAAAAATGGCGAAGAAGATAA [T / C] ATTTTCCATCATTTTTGTCGTTGACCCGATTCTTCACACATGGTTGAACATCTTCTGTAT (7) S8S8 TCAACGGAAAAAGGAAGATTTAAAATAATTAAAACCGAAAAAGATACGAGGAGGAAGAGC[A/T]GAGTTTTAGTTCATTAGTGGTGGGGACTTACGGAGTAATAAGGTGCGGCGGCGACGACAC (8)TCAACGGAAAAAGGAAGATTTAAAATAATTAAAACCGAAAAAGATACGAGGAGGAAGAGC [A / T] GAGTTTTAGTTCATTAGTGGTGGGGACTTACGGAGTAATAAGGTGCGGCGGCGACGACAC (8) S9S9 TAACTTTAATCCAGACCAAAATGAATATTCGTCTCTATCCAATCCGTGCTCGCCGTTCTT[T/G]TCACGCGCCAAGATAATTACCGCCGACACGCAGTTTACTTCGTTATAGCTACGCCGGCAC (9)TAACTTTAATCCAGACCAAAATGAATATTCGTCTCTATCCAATCCGTGCTCGCCGTTCTT [T / G] TCACGCGCCAAGATAATTACCGCCGACACGCAGTTTACTTCGTTATAGCTACGCCGGCAC (9) S10S10 ATCCTTGCGTCCTCATCTTTGCTGGAAGTTACAAACCGACGGCACGGGTAGGTAAGGTGG[A/G]CAGGCTCCCACGAGATGCTAGTAATCCATTTCTTGTGGCCTCTAAGGGGGCTGCCATCTA (10)ATCCTTGCGTCCTCATCTTTGCTGGAAGTTACAAACCGACGGCACGGGTAGGTAAGGTGG [A / G] CAGGCTCCCACGAGATGCTAGTAATCCATTTCTTGTGGCCTCTAAGGGGGCTGCCATCTA (10) S11S11 CTGTTCAAACGGGAAACACCTAATGGTCGCACCAGTTTCCTCCTTTACCCTTTGCTCATC[T/A]GAGTCACTGGCTGACCATGGACCTCTTGCCCATTTCCCTGAAGAAATCGCAGCTTTGAGC (11)CTGTTCAAACGGGAAACACCTAATGGTCGCACCAGTTTCCTCCTTTACCCTTTGCTCATC [T / A] GAGTCACTGGCTGACCATGGACCTCTTGCCCATTTCCCTGAAGAAATCGCAGCTTTGAGC (11) S12S12 AAATTATTTTGCATGTTAGAGACAATCCAAAATGCAAATCCTCTCCGTATTGGCTAAGTT[T/C]ATCATCTAATGCACCCGTTTAGTTATTTTATACCAATCAGTGTCAAGTTTGGTGTAAAAA (12)AAATTATTTTGCATGTTAGAGACAATCCAAAATGCAAATCCTCTCCGTATTGGCTAAGTT [T / C] ATCATCTAATGCACCCGTTTAGTTATTTTATACCAATCAGTGTCAAGTTTGGTGTAAAAA (12)

*[TO1000 서열/타 품종 서열]
* [TO1000 sequence / other sequence]

SNP 확인을 위한 프라이머 서열 정보Primer sequence information for SNP confirmation 증폭대상Amplification target ASP1 (서열번호)ASP1 (SEQ ID NO) ASP2 (서열번호)ASP2 (SEQ ID NO) LSP (서열번호)LSP (SEQ ID NO) STA (서열번호)STA (SEQ ID NO) S1S1 AGTTTCAATCATCCTAACTAAAGAGAGGAC (13)AGTTTCAATCATCCTAACTAAAGAGAGGAC (13) AAGTTTCAATCATCCTAACTAAAGAGAGGAA (14)AAGTTTCAATCATCCTAACTAAAGAGAGGAA (14) GCAAACCCTCGAGGCTCAAA (15)GCAAACCCTCGAGGCTCAAA (15) AGCCATAGAGGAGGTAAGTTTCAAT (16)AGCCATAGAGGAGGTAAGTTTCAAT (16) S2S2 ACTGCACATGGTAAGATCATCTTTCA (17)ACTGCACATGGTAAGATCATCTTTCA (17) CTGCACATGGTAAGATCATCTTTCG (18)CTGCACATGGTAAGATCATCTTTCG (18) TGTGTGCTGCTTATGTCAAGATAGGA (19)TGTGTGCTGCTTATGTCAAGATAGGA (19) ACCTATTGAAAACAAAACAACACTGC (20)ACCTATTGAAAACAAAACAACACTGC (20) S3S3 CAAAGCGTATAAGCCATCCGTTATAC (21)CAAAGCGTATAAGCCATCCGTTATAC (21) TCAAAGCGTATAAGCCATCCGTTATAG (22)TCAAAGCGTATAAGCCATCCGTTATAG (22) GATCGACTGGTGGACGACTAATGT (23)GATCGACTGGTGGACGACTAATGT (23) ACCTGAAGCACGATGTTCAAAG (24)ACCTGAAGCACGATGTTCAAAG (24) S4S4 GATTCCTCAAGAAAGAAAATGGTACCATG (25)GATTCCTCAAGAAAGAAAATGGTACCATG (25) TGATTCCTCAAGAAAGAAAATGGTACCATA (26)TGATTCCTCAAGAAAGAAAATGGTACCATA (26) TCTTTTCTTGATCTGAGTTGTTCTTCTCTTCA (27)TCTTTTCTTGATCTGAGTTGTTCTTCTCTTCA (27) CCTAAGCTCCTTGATTTGATTCCTC (28)CCTAAGCTCCTTGATTTGATTCCTC (28) S5S5 TCATCTCCAAGTTGTATCAAAGGTCG (29)TCATCTCCAAGTTGTATCAAAGGTCG (29) TCATCTCCAAGTTGTATCAAAGGTCT (30)TCATCTCCAAGTTGTATCAAAGGTCT (30) GGCTGGCAAACGGAAGTTCT (31)GGCTGGCAAACGGAAGTTCT (31) TCAGGTTTGTGTTGTACACTCATC (32)TCAGGTTTGTGTTGTACACTCATC (32) S6S6 TCCAGATTTATTCCAGAACAGTACATTCT (33)TCCAGATTTATTCCAGAACAGTACATTCT (33) CCAGATTTATTCCAGAACAGTACATTCC (34)CCAGATTTATTCCAGAACAGTACATTCC (34) GCTGCCAAAATAAGTAGAAGCTAAACTGAA (35)GCTGCCAAAATAAGTAGAAGCTAAACTGAA (35) TCGTATGGAAGGTATGTCCAGATT (36)TCGTATGGAAGGTATGTCCAGATT (36) S7S7 GGGTCAACGACAAAAATGATGGAAAATA (37)GGGTCAACGACAAAAATGATGGAAAATA (37) GGTCAACGACAAAAATGATGGAAAATG (38)GGTCAACGACAAAAATGATGGAAAATG (38) CTTTATATTCGTATCCAAAAATGGCGAAGAAGA (39)CTTTATATTCGTATCCAAAAATGGCGAAGAAGA (39) CATGTGTGAAGAATCGGGTCAA (40)CATGTGTGAAGAATCGGGTCAA (40) S8S8 CCCCACCACTAATGAACTAAAACTCT (41)CCCCACCACTAATGAACTAAAACTCT (41) CCCCACCACTAATGAACTAAAACTCA (42)CCCCACCACTAATGAACTAAAACTCA (42) AAAACCGAAAAAGATACGAGGAGGAAGA (43)AAAACCGAAAAAGATACGAGGAGGAAGA (43) CCTTATTACTCCGTAAGTCCCCA (44)CCTTATTACTCCGTAAGTCCCCA (44) S9S9 GGTAATTATCTTGGCGCGTGAA (45)GGTAATTATCTTGGCGCGTGAA (45) GGTAATTATCTTGGCGCGTGAC (46)GGTAATTATCTTGGCGCGTGAC (46) CAATCCGTGCTCGCCGT (47)CAATCCGTGCTCGCCGT (47) CTGCGTGTCGGCGGT (48)CTGCGTGTCGGCGGT (48) S10S10 CATCTCGTGGGAGCCTGT (49)CATCTCGTGGGAGCCTGT (49) ATCTCGTGGGAGCCTGC (50)ATCTCGTGGGAGCCTGC (50) AACCGACGGCACGGGTA (51)AACCGACGGCACGGGTA (51) GAGGCCACAAGAAATGGATTACTAG (52)GAGGCCACAAGAAATGGATTACTAG (52) S11S11 CCTCCTTTACCCTTTGCTCATCT (53)CCTCCTTTACCCTTTGCTCATCT (53) CCTCCTTTACCCTTTGCTCATCA (54)CCTCCTTTACCCTTTGCTCATCA (54) AGAGGTCCATGGTCAGCCAG (55)AGAGGTCCATGGTCAGCCAG (55) CTAATGGTCGCACCAGTTTCC (56)CTAATGGTCGCACCAGTTTCC (56) S12S12 AATCCTCTCCGTATTGGCTAAGTTT (57)AATCCTCTCCGTATTGGCTAAGTTT (57) AATCCTCTCCGTATTGGCTAAGTTC (58)AATCCTCTCCGTATTGGCTAAGTTC (58) CACTGATTGGTATAAAATAACTAAACGGGTGC (59)CACTGATTGGTATAAAATAACTAAACGGGTGC (59) AGAGACAATCCAAAATGCAAATCCT (60)AGAGACAATCCAAAATGCAAATCCT (60)

실시예 3. 개발된 마커 세트를 이용한 F1 품종 및 양친(원종)의 유전형 분석Example 3. Genetic analysis of F1 breed and parent species using the developed marker set

양친(원종)과 이로부터 개발된 F1 품종을 한 세트로 하여 총 26세트를 사용하여 본 발명에서 개발된 마커의 12개 유전자위(locus)에 대한 유전자형을 분석하였다. 그결과, 26세트의 모본·부본에서 12개 마커 유전자위 모두가 동형접합(homozygous)하게 검출되었다. 이는 개발된 마커의 유전자위가 품종개발에 쓰이는 고정종(원종 또는 양친)에서 전반적으로 고정이 잘되는 위치여서 F1에서 순도검정에 유용한 위치임을 의미한다. 또한 26세트의 유전형 분석 결과, 1-12개의 마커가 각 세트의 양친간에 다형성(polymorphic)하여(도 2, 파란색), F1 순도검정에 사용할 수 있음을 알 수 있었다. F1을 2개체 이상씩 사용한 세트 중 3, 5 및 9 세트는 F1 개체간의 유전자형이 다른 결과를 얻었고, 이는 원종인 양친의 고정 정도가 부족하거나, 채종시 꽃가루의 오염 등의 이유에 의한 것으로 해석되며, 이와 같이 F1 개체간의 다른 유전자형을 검출해서 순도검정을 할 수 있을 것이다.The genotypes of the 12 loci of the markers developed in the present invention were analyzed by using 26 sets of the parent species and the F1 varieties developed therefrom. As a result, all twelve marker genes were homozygously detected in 26 sets of copies. This implies that the genetic stigma of the developed marker is a stable location in fixed species (native species or parent species) used for breed development and is a useful location for purity testing in F1. In addition, as a result of 26 sets of genotype analysis, it was found that 1-12 markers were polymorphic between the parents of each set (FIG. 2, blue) and could be used for F1 purity assay. Among the sets using more than two F1s, 3, 5, and 9 sets were different in the genotypes of the F1 individuals, and this was interpreted as a result of insufficient fixation of the parents of the parent species and contamination of the pollen during the cultivation , And thus other genotypes between F1 individuals will be detected and purity can be verified.

본 발명의 마커 세트를 사용할 경우 개발된 F1의 순도 검정을 위해 수백개 이상의 무작위한 마커를 조사하는 대신 12개의 마커만 조사하기 때문에 경제적, 시간적인 효율을 창출할 수 있으며, 각 염색체별 마커를 세트화 하였기에 전체 유전체 수준으로 유전형 분석을 할 수 있어 한 유전자위(locus)에 편향된 정확하지 않은 순도검정 결과를 얻는 문제점을 보완할 수가 있다. 본 발명에서 개발된 F1 순도 검정 마커세트는 F1 순도 검정은 물론, 양친 특히 모본의 자가합성으로 인한 모본 원종의 오염을 선별해 낼 수 있으며, F1의 순도를 전체 유전체 수준에서 검정할 수 있어 보다 정확하고 효율적인 결과를 얻을 수 있고, 양배추 뿐만 아니라 보다 광범위하게 양배추류(Brassica oleracea)에 적용될 수 있는 장점이 있다.When using the marker set of the present invention, it is possible to produce economical and temporal efficiency by examining only 12 markers instead of examining hundreds of random markers for the purity test of the developed F1. It is also possible to set markers for each chromosome , Which allows genotype analysis to be performed at the level of the entire genome, thereby solving the problem of obtaining inaccurate purity results of a biased locus. The set of F1 purity marker markers developed in the present invention can select the contamination of the parent species due to the self-synthesis of the parent, especially the parent, as well as the F1 purity test. The purity of F1 can be assayed at the entire genome level, And it is possible to obtain efficient results, and not only cabbage but also broader cabbage ( Brassica oleracea ) can be applied.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof <130> PN14310 <160> 60 <170> KopatentIn 2.0 <210> 1 <211> 121 <212> DNA <213> Brassica oleracea <400> 1 attttttttt atgtttggtt gtttaaagat ctttatgcaa accctcgagg ctcaaaaaat 60 ttcctctctt tagttaggat gattgaaact tacctcctct atggctattg caacctaatt 120 c 121 <210> 2 <211> 121 <212> DNA <213> Brassica oleracea <400> 2 tgttgctgta gatgatcttt ctgtgtgctg cttatgtcaa gataggaatt ttaaggtggt 60 cgaaagatga tcttaccatg tgcagtgttg ttttgttttc aataggtcag agcattatgc 120 g 121 <210> 3 <211> 121 <212> DNA <213> Brassica oleracea <400> 3 aggaggagag atgcattaag atcgactggt ggacgactaa tgtatttgta attgtgagaa 60 ctataacgga tggcttatac gctttgaaca tcgtgcttca ggtgtgttac cttttgcttt 120 c 121 <210> 4 <211> 121 <212> DNA <213> Brassica oleracea <400> 4 agcagagaaa catgtcctaa gctccttgat ttgattcctc aagaaagaaa atggtaccat 60 aatgaagaga agaacaactc agatcaagaa aagaaacttg agctaaggct tgcaccaccc 120 g 121 <210> 5 <211> 121 <212> DNA <213> Brassica oleracea <400> 5 attacaacca gattgctcag gtttgtgttg tacactcatc tccaagttgt atcaaaggtc 60 tctaatacag aacttccgtt tgccagccta atctgattgt taacgttgct tctctaaatt 120 t 121 <210> 6 <211> 121 <212> DNA <213> Brassica oleracea <400> 6 attaattagg agggattcgt atggaaggta tgtccagatt tattccagaa cagtacattc 60 cgatttttca gtttagcttc tacttatttt ggcagcttta tgcaaaacca ataacgtaat 120 t 121 <210> 7 <211> 121 <212> DNA <213> Brassica oleracea <400> 7 tattttattc agattagaac aaaactttat attcgtatcc aaaaatggcg aagaagataa 60 cattttccat catttttgtc gttgacccga ttcttcacac atggttgaac atcttctgta 120 t 121 <210> 8 <211> 121 <212> DNA <213> Brassica oleracea <400> 8 tcaacggaaa aaggaagatt taaaataatt aaaaccgaaa aagatacgag gaggaagagc 60 tgagttttag ttcattagtg gtggggactt acggagtaat aaggtgcggc ggcgacgaca 120 c 121 <210> 9 <211> 121 <212> DNA <213> Brassica oleracea <400> 9 taactttaat ccagaccaaa atgaatattc gtctctatcc aatccgtgct cgccgttctt 60 gtcacgcgcc aagataatta ccgccgacac gcagtttact tcgttatagc tacgccggca 120 c 121 <210> 10 <211> 121 <212> DNA <213> Brassica oleracea <400> 10 atccttgcgt cctcatcttt gctggaagtt acaaaccgac ggcacgggta ggtaaggtgg 60 gcaggctccc acgagatgct agtaatccat ttcttgtggc ctctaagggg gctgccatct 120 a 121 <210> 11 <211> 121 <212> DNA <213> Brassica oleracea <400> 11 ctgttcaaac gggaaacacc taatggtcgc accagtttcc tcctttaccc tttgctcatc 60 agagtcactg gctgaccatg gacctcttgc ccatttccct gaagaaatcg cagctttgag 120 c 121 <210> 12 <211> 121 <212> DNA <213> Brassica oleracea <400> 12 aaattatttt gcatgttaga gacaatccaa aatgcaaatc ctctccgtat tggctaagtt 60 catcatctaa tgcacccgtt tagttatttt ataccaatca gtgtcaagtt tggtgtaaaa 120 a 121 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agtttcaatc atcctaacta aagagaggac 30 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aagtttcaat catcctaact aaagagagga a 31 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gcaaaccctc gaggctcaaa 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 agccatagag gaggtaagtt tcaat 25 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 actgcacatg gtaagatcat ctttca 26 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ctgcacatgg taagatcatc tttcg 25 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tgtgtgctgc ttatgtcaag atagga 26 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 acctattgaa aacaaaacaa cactgc 26 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 caaagcgtat aagccatccg ttatac 26 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcaaagcgta taagccatcc gttatag 27 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gatcgactgg tggacgacta atgt 24 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 acctgaagca cgatgttcaa ag 22 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gattcctcaa gaaagaaaat ggtaccatg 29 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tgattcctca agaaagaaaa tggtaccata 30 <210> 27 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 tcttttcttg atctgagttg ttcttctctt ca 32 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cctaagctcc ttgatttgat tcctc 25 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tcatctccaa gttgtatcaa aggtcg 26 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 tcatctccaa gttgtatcaa aggtct 26 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ggctggcaaa cggaagttct 20 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tcaggtttgt gttgtacact catc 24 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 tccagattta ttccagaaca gtacattct 29 <210> 34 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ccagatttat tccagaacag tacattcc 28 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gctgccaaaa taagtagaag ctaaactgaa 30 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tcgtatggaa ggtatgtcca gatt 24 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 gggtcaacga caaaaatgat ggaaaata 28 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 ggtcaacgac aaaaatgatg gaaaatg 27 <210> 39 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ctttatattc gtatccaaaa atggcgaaga aga 33 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 catgtgtgaa gaatcgggtc aa 22 <210> 41 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ccccaccact aatgaactaa aactct 26 <210> 42 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 ccccaccact aatgaactaa aactca 26 <210> 43 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 aaaaccgaaa aagatacgag gaggaaga 28 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ccttattact ccgtaagtcc cca 23 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 ggtaattatc ttggcgcgtg aa 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 ggtaattatc ttggcgcgtg ac 22 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 caatccgtgc tcgccgt 17 <210> 48 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 ctgcgtgtcg gcggt 15 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 catctcgtgg gagcctgt 18 <210> 50 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 atctcgtggg agcctgc 17 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 aaccgacggc acgggta 17 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 gaggccacaa gaaatggatt actag 25 <210> 53 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 cctcctttac cctttgctca tct 23 <210> 54 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 cctcctttac cctttgctca tca 23 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 agaggtccat ggtcagccag 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 ctaatggtcg caccagtttc c 21 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 aatcctctcc gtattggcta agttt 25 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 aatcctctcc gtattggcta agttc 25 <210> 59 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 cactgattgg tataaaataa ctaaacgggt gc 32 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 agagacaatc caaaatgcaa atcct 25 <110> Korea Research Institute of Bioscience and Biotechnology <120> Single nucleotide polymorphism marker set for F1 hybrid purity          checking in Cabbage and uses thereof <130> PN14310 <160> 60 <170> Kopatentin 2.0 <210> 1 <211> 121 <212> DNA <213> Brassica oleracea <400> 1 attttttttt atgtttggtt gtttaaagat ctttatgcaa accctcgagg ctcaaaaaat 60 ttcctctctt tagttaggat gattgaaact tacctcctct atggctattg caacctaatt 120 c 121 <210> 2 <211> 121 <212> DNA <213> Brassica oleracea <400> 2 tgttgctgta gatgatcttt ctgtgtgctg cttatgtcaa gataggaatt ttaaggtggt 60 cgaaagatga tcttaccatg tgcagtgttg ttttgttttc aataggtcag agcattatgc 120 g 121 <210> 3 <211> 121 <212> DNA <213> Brassica oleracea <400> 3 aggaggagag atgcattaag atcgactggt ggacgactaa tgtatttgta attgtgagaa 60 ctataacgga tggcttatac gctttgaaca tcgtgcttca ggtgtgttac cttttgcttt 120 c 121 <210> 4 <211> 121 <212> DNA <213> Brassica oleracea <400> 4 agcagagaaa catgtcctaa gctccttgat ttgattcctc aagaaagaaa atggtaccat 60 aatgaagaga agaacaactc agatcaagaa aagaaacttg agctaaggct tgcaccaccc 120 g 121 <210> 5 <211> 121 <212> DNA <213> Brassica oleracea <400> 5 attacaacca gattgctcag gtttgtgttg tacactcatc tccaagttgt atcaaaggtc 60 tctaatacag aacttccgtt tgccagccta atctgattgt taacgttgct tctctaaatt 120 t 121 <210> 6 <211> 121 <212> DNA <213> Brassica oleracea <400> 6 attaattagg agggattcgt atggaaggta tgtccagatt tattccagaa cagtacattc 60 cgatttttca gtttagcttc tacttatttt ggcagcttta tgcaaaacca ataacgtaat 120 t 121 <210> 7 <211> 121 <212> DNA <213> Brassica oleracea <400> 7 tattttattc agattagaac aaaactttat attcgtatcc aaaaatggcg aagaagataa 60 cattttccat catttttgtc gttgacccga ttcttcacac atggttgaac atcttctgta 120 t 121 <210> 8 <211> 121 <212> DNA <213> Brassica oleracea <400> 8 tcaacggaaa aaggaagatt taaaataatt aaaaccgaaa aagatacgag gaggaagagc 60 tgagttttag ttcattagtg gtggggactt acggagtaat aaggtgcggc ggcgacgaca 120 c 121 <210> 9 <211> 121 <212> DNA <213> Brassica oleracea <400> 9 taactttaat ccagaccaaa atgaatattc gtctctatcc aatccgtgct cgccgttctt 60 gtcacgcgcc aagataatta ccgccgacac gcagtttact tcgttatagc tacgccggca 120 c 121 <210> 10 <211> 121 <212> DNA <213> Brassica oleracea <400> 10 atccttgcgt cctcatcttt gctggaagtt acaaaccgac ggcacgggta ggtaaggtgg 60 gcaggctccc acgagatgct agtaatccat ttcttgtggc ctctaagggg gctgccatct 120 a 121 <210> 11 <211> 121 <212> DNA <213> Brassica oleracea <400> 11 ctgttcaaac gggaaacacc taatggtcgc accagtttcc tcctttaccc tttgctcatc 60 agagtcactg gctgaccatg gacctcttgc ccatttccct gaagaaatcg cagctttgag 120 c 121 <210> 12 <211> 121 <212> DNA <213> Brassica oleracea <400> 12 aaattatttt gcatgttaga gacaatccaa aatgcaaatc ctctccgtat tggctaagtt 60 catcatctaa tgcacccgtt tagttatttt ataccaatca gtgtcaagtt tggtgtaaaa 120 a 121 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agtttcaatc atcctaacta aagagaggac 30 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aagtttcaat catcctaact aaagagagga a 31 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gcaaaccctc gaggctcaaa 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 agccatagag gaggtaagtt tcaat 25 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 actgcacatg gtaagatcat ctttca 26 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ctgcacatgg taagatcatc tttcg 25 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tgtgtgctgc ttatgtcaag atagga 26 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 acctattgaa aacaaaacaa cactgc 26 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 caaagcgtat aagccatccg ttatac 26 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcaaagcgta taagccatcc gttatag 27 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gatcgactgg tggacgacta atgt 24 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 acctgaagca cgatgttcaa ag 22 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gattcctcaa gaaagaaaat ggtaccatg 29 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tgattcctca agaaagaaaa tggtaccata 30 <210> 27 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 tcttttcttg atctgagttg ttcttctctt ca 32 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cctaagctcc ttgatttgat tcctc 25 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tcatctccaa gttgtatcaa aggtcg 26 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 tcatctccaa gttgtatcaa aggtct 26 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ggctggcaaa cggaagttct 20 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tcaggtttgt gttgtacact catc 24 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 tccagattta ttccagaaca gtacattct 29 <210> 34 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ccagatttat tccagaacag tacattcc 28 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gctgccaaaa taagtagaag ctaaactgaa 30 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tcgtatggaa ggtatgtcca gatt 24 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 gggtcaacga caaaaatgat ggaaaata 28 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 ggtcaacgac aaaaatgatg gaaaatg 27 <210> 39 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ctttatattc gtatccaaaa atggcgaaga aga 33 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 catgtgtgaa gaatcgggtc aa 22 <210> 41 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ccccaccact aatgaactaa aactct 26 <210> 42 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 ccccaccact aatgaactaa aactca 26 <210> 43 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 aaaaccgaaa aagatacgag gaggaaga 28 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ccttattact ccgtaagtcc cca 23 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 ggtaattatc ttggcgcgtg aa 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 ggtaattatc ttggcgcgtg ac 22 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 caatccgtgc tcgccgt 17 <210> 48 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 ctgcgtgtcg gcggt 15 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 catctcgtgg gagcctgt 18 <210> 50 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 atctcgtggg agcctgc 17 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 aaccgacggc acgggta 17 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 gaggccacaa gaaatggatt actag 25 <210> 53 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 cctcctttac cctttgctca tct 23 <210> 54 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 cctcctttac cctttgctca tca 23 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 agaggtccat ggtcagccag 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 ctaatggtcg caccagtttc c 21 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 aatcctctcc gtattggcta agttt 25 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 aatcctctcc gtattggcta agttc 25 <210> 59 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 cactgattgg tataaaataa ctaaacgggt gc 32 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 agagacaatc caaaatgcaa atcct 25

Claims (10)

서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드에 있어서, 각 SNP(single nucleotide polymorphism) 위치(서열번호 1 부터 서열번호 12까지 각 61번째) 염기를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 포함하는, 양배추의 F1 순도검정용 SNP 조성물.A polynucleotide consisting of a nucleotide sequence of SEQ ID NOS: 1 to 12, wherein the polynucleotide is a polynucleotide consisting of 10 or more consecutive bases including a single nucleotide polymorphism (SNP) position (each 61st position from SEQ ID NO: 1 to SEQ ID NO: 12) Or a complementary polynucleotide thereof, for the F1 purity determination of cabbage. 제1항에 기재된 SNP(single nucleotide polymorphism)의 폴리뉴클레오티드 또는 이의 cDNA를 포함하는 양배추의 F1 순도검정용 마이크로어레이.A microarray for F1 purity assay of cabbage comprising polynucleotide of SNP (single nucleotide polymorphism) according to claim 1 or cDNA thereof. 제2항에 있어서, 상기 폴리뉴클레오티드는 아미노-실란, 폴리-L-라이신 또는 알데히드의 활성기가 코팅된 기판에 고정되는 것을 특징으로 하는 양배추의 F1 순도검정용 마이크로어레이.3. The microarray for F1 purity determination of cabbage according to claim 2, wherein the polynucleotide is immobilized on a substrate coated with an activator of amino-silane, poly-L-lysine or aldehyde. 양배추 시료에서 게놈 DNA를 분리하는 단계; 및
제1항에 기재된 서열번호 1 내지 12의 염기서열로 이루어진 폴리뉴클레오티드의 각 SNP(single nucleotide polymorphism) 위치 염기인 다형성 부위의 유전자형을 결정하는 단계를 포함하는 양배추의 F1 순도검정 방법.Isolating the genomic DNA from the cabbage sample; And
A method for determining purity of F1 of a cabbage comprising determining the genotype of a polymorphic site which is a single nucleotide polymorphism (SNP) locus of a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to 12 according to claim 1. 제1항에 기재된 서열번호 1 내지 12의 염기서열로 이루어진 SNP(single nucleotide polymorphism) 폴리뉴클레오티드 증폭용 프라이머 세트.A primer set for amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 12 according to claim 1. 제5항에 있어서, 서열번호 13 내지 60의 12개 세트의 올리고뉴클레오티드 프라이머 세트로서, 상기 각 프라이머 세트는 서열번호 13부터 시작하여 순서대로 인접한 서열번호의 네 개의 올리고뉴클레오티드가 하나의 프라이머 세트를 이루는 것을 특징으로 하는 프라이머 세트.A set of 12 oligonucleotide primers of SEQ ID NOS: 13 to 60, wherein each of the primer sets comprises, in sequence, four oligonucleotides of adjacent SEQ ID NO: Lt; / RTI &gt; 제5항 또는 제6항의 올리고뉴클레오티드 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, 양배추의 F1 순도검정을 위한 키트.A kit for F1 purity assay of cabbage, comprising the oligonucleotide primer set of claim 5 or 6 and a reagent for carrying out an amplification reaction. 제7항에 있어서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs 및 버퍼를 포함하는 것을 특징으로 하는 키트.8. The kit according to claim 7, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. 양배추 시료에서 게놈 DNA를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 제5항 또는 제6항의 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 제1항에 기재된 서열번호 1 내지 12의 염기서열로 이루어진 SNP(single nucleotide polymorphism) 폴리뉴클레오티드를 증폭하는 단계; 및
상기 증폭 산물을 검출하는 단계를 포함하는, 양배추의 F1 순도검정 방법.Isolating the genomic DNA from the cabbage sample;
The isolated genomic DNA is used as a template and an amplification reaction is performed using the oligonucleotide primer set of claim 5 or 6 to obtain a single nucleotide polymorphism (SNP) comprising the nucleotide sequence of SEQ ID NOS: Amplifying the polynucleotide; And
And detecting the amplification product. 제9항에 있어서, 상기 증폭 산물의 검출은 시퀀싱, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행되는 것을 특징으로 하는 양배추의 F1 순도검정 방법.10. The method according to claim 9, wherein the detection of the amplification product is performed by sequencing, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.
KR1020140156817A 2014-11-12 2014-11-12 Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof KR101690067B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140156817A KR101690067B1 (en) 2014-11-12 2014-11-12 Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140156817A KR101690067B1 (en) 2014-11-12 2014-11-12 Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof

Publications (2)

Publication Number Publication Date
KR20160056514A KR20160056514A (en) 2016-05-20
KR101690067B1 true KR101690067B1 (en) 2016-12-27

Family

ID=56103675

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140156817A KR101690067B1 (en) 2014-11-12 2014-11-12 Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof

Country Status (1)

Country Link
KR (1) KR101690067B1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102087024B1 (en) * 2018-10-05 2020-03-10 충남대학교 산학협력단 Single nucleotide polymorphism marker set for line purity checking and early fixed line selecting in Brassica rapa and uses thereof
KR102606300B1 (en) * 2020-10-28 2023-11-24 서울대학교산학협력단 DNA marker for discriminating genotype of Brassica rapa, Brassica oleracea and their interspecific hybrid and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120185960A1 (en) 2009-09-22 2012-07-19 Syngenta Participations Ag Novel brassica plants resistant to disease

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120185960A1 (en) 2009-09-22 2012-07-19 Syngenta Participations Ag Novel brassica plants resistant to disease

Also Published As

Publication number Publication date
KR20160056514A (en) 2016-05-20

Similar Documents

Publication Publication Date Title
CN106282394B (en) Method for high-throughput detection of southern rust resistance genotyping of corn and kit thereof
CN107794304B (en) Genotyping detection kit for yak individual identification and paternity test
CN107619870B (en) Molecular marker capable of indicating and identifying length of sheep wool and specific primer pair and application thereof
Li et al. Selection of 29 highly informative InDel markers for human identification and paternity analysis in Chinese Han population by the SNPlex genotyping system
KR101769874B1 (en) Primer set for discriminating Allium cepa intra- or inter-species and uses thereof
KR101690067B1 (en) Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof
KR101961653B1 (en) SNP molecular marker for selecting cultivars of sweet potatoes and uses thereof
KR101669032B1 (en) Single nucleotide polymorphism marker set for line purity checking and early fixed line selecting in Cabbage and uses thereof
CA3185019A1 (en) Methods and compositions for pathogen detection in plants
CN112592981A (en) Primer group, kit and method for DNA archive construction
CN111676270A (en) Method for screening polymorphic SNP molecular marker, polymorphic SNP molecular marker and primer pair
KR102332688B1 (en) Molecular marker based on nuclear genome sequence for discriminating Panax ginseng &#39;SeonHyang&#39; cultivar and uses thereof
KR102299258B1 (en) Primer set for determining Prunus sp. and uses thereof
KR102224472B1 (en) Molecular marker for predicting fruit shape of pear and use thereof
KR102268059B1 (en) Composition, kit for predicting weight control according to exercise, and method using the same
KR20180055075A (en) Single nucleotide polymorphism marker for selecting bacterial wilt-resistant or sensitive pepper cultivar and uses thereof
CN108315396B (en) Novel method for simply and conveniently detecting SNP
Martin Molecular identification of Phytophthora
KR101945953B1 (en) Molecular marker for discriminating Phytophthora capsici resistant pepper cultivar and uses thereof
KR101985659B1 (en) Method for identification of Baekwoo breed using single nucleotide polymorphism markers
KR101357497B1 (en) EST-SSR primer derived from Ophiopogon japonicus and use thereof
CN105838821B (en) Method for detecting recessive lethal mutation of bovine APAF1 gene
KR101464247B1 (en) Single nucleotide polymorphism marker for selecting fusarium wilt-resistant or sensitive cabbage cultivar and uses thereof
KR102144673B1 (en) KASP primer set based on SNP for discriminating Korean melon cultivar and F1 hybrid purity checking and uses thereof
KR102309663B1 (en) Fluidigm based SNP chip for genotype-identifying and classifying Panax ginseng cultivar or resource and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20191101

Year of fee payment: 4