KR101669032B1 - Single nucleotide polymorphism marker set for line purity checking and early fixed line selecting in Cabbage and uses thereof - Google Patents

Abstract

The present invention relates to a systematic purity assay of cabbage, comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 comprising a single nucleotide polymorphism (SNP) locus or a complementary polynucleotide thereof, The present invention relates to a SNP composition for fixed-line selection and a primer set for amplifying the SNP polynucleotide. The SNP of the present invention can be used to test the purity of the cabbage system and the early fixing system at a whole genome level, Can be obtained.

Description

[0001] The present invention relates to a single nucleotide polymorphism marker set for lineage purity testing of cabbage and for selection of an early immobilization system,

The present invention relates to a single nucleotide polymorphism marker set for cabbage system purity assay and early immobilization system selection, and more particularly to a single nucleotide polymorphism marker set having a nucleotide sequence of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) And a complementary polynucleotide thereof, and a systematic purity of the cabbage and early fixation of the cabbage including the SNP composition or the cDNA thereof. Isolating genomic DNA from a cabbage sample and determining a genotype of a polymorphic site that is a base for the SNP, a method for selecting a systematic purity and an early fixed system for cabbage, a method for selecting a primer set for amplifying the SNP polynucleotide And the primer three And a reagent for carrying out an amplification reaction. The present invention also relates to a kit for selecting a systematic purity of cabbage and an early fixed system selection.

Cabbage is a vegetable crop with an output of about 76 million tons and an economic value of $ 15 billion (2010). It is among the world's largest cultivated crops. Cabbage is a model crop of morphological research with morphologically diverse subspecies such as cabbage, kale, broccoli, cola bean, cauliflower (cauliflower). In particular, from a nutritional point of view, cabbage contains a large amount of protein, carotenoid as well as glucosinolate with anticancer effect. To further increase the economic value of these cabbages, breeders have been endeavoring to produce cabbages that are resistant to high yields, pest and environmental stresses, or contain many useful substances.

In order to develop new varieties of cabbage, it is important to develop an excellent lineage. The parent line of the F1 breed is called the progeny, and the purity of these progeny leads to the purity of the developed F1 breed, which is directly related to the quality of the F1 breed. In order to nurture the genera, introduction of good traits through crossing and permanent self-fixation, the fixation process usually takes 8-10 years, and breeders depend on the phenotype of cabbage to determine whether they are fixed . There is a disadvantage in that the method of determining whether or not a phenotype depends on phenotype is not only time consuming and labor-consuming but also low in reproducibility. Morphological discrimination also does not reflect genetic attributes.

In order to overcome these disadvantages, the present invention has developed a molecular marker marker for cabbage in order to determine the purity and fixation degree of the system and early selection of the fixed system.

Korean Patent No. 0652501 discloses a method for assaying the purity of F-1 seeds of the melon family, and Korean Patent No. 1014238 discloses a method for assaying the watermelon F1 seed purity. However, There is no description of a single base polymorphism marker set and its use for the systematic purity assay and early immobilization system selection.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and the present inventors have found that SNP markers of a total genome level can be identified using sequences of 23 lines of cabbage species, and the polymorphism- , And SNP molecular markers that showed polymorphism in more than 6 out of 23 lines in this section. Then, SNPs were selected for each chromosome centered on loci that were not immobilized, and primer sets were prepared. Genetic analysis was performed by randomly selecting individuals in six strains in which the primers were not completely fixed, The present invention has been accomplished by selecting 24 chromosomes of SNPs with a total of 24 marker sets.

In order to solve the above problems, the present invention provides a polynucleotide comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 comprising a single nucleotide polymorphism (SNP) position base or a complementary polynucleotide thereof. A systematic purity of cabbage, and an SNP composition for selecting an early immobilization system.

In addition, the present invention provides a microarray for systematic purity verification and early establishment of cabbage comprising the SNP or cDNA thereof.

Also, the present invention provides a method for selecting a genotype of a polymorphic site, which is a base for each SNP, by isolating genomic DNA from a cabbage sample.

In addition, the present invention provides a primer set for amplifying a SNP polynucleotide comprising the nucleotide sequences of SEQ ID NOS: 1 to 24.

The present invention also provides a kit for the systematic purity determination of cabbage and the early fixing system selection, which comprises the primer set and the reagent for carrying out the amplification reaction.

The single nucleotide polymorphism (SNP) marker set according to the present invention can test the systematic purity of cabbage and early fixed line selection at the entire genome level, thereby obtaining more accurate and efficient results, and thus can be industrially useful There will be.

FIG. 1 is a schematic diagram showing the construction of a SNP marker set for a fixed system of the present invention.
FIG. 2 shows results of genotype analysis using the marker set of the present invention for six lines of cabbage lines.
FIG. 3 shows the results of genotyping analysis using the marker set of the present invention for 30 individuals from the micro-organism-derived strain (9949).
4 shows the result of genotype analysis using the marker set of the present invention for 27 individuals from the micro-organism-derived strain (9951).

In order to accomplish the object of the present invention, the present invention includes at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 comprising a single nucleotide polymorphism (SNP) base or its complementary polynucleotide A systematic purity of cabbage, and an SNP composition for selecting an early immobilization system.

SEQ ID NOS: 1 to 24 are polynucleotides comprising the nucleotide sequence of each SNP site. SEQ ID NOS: 1 to 24 are polymorphic sequences comprising polymorphic sites. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a SNP in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

In the SNP composition according to an embodiment of the present invention, the SNP position base is 61st from SEQ ID NO: 1 to SEQ ID NO: 24, and the polymorphic base information is indicated by [/] in the SNP nucleotide sequence information of Table 3.

The polynucleotide of each single SNP constituting the SNP for systematic purity determination of the cabbage according to the present invention and the SNP for early immobilization system is preferably at least 10 consecutive bases, more preferably at least 15 consecutive bases, Is at least 20 contiguous bases, most preferably each sequence of SEQ ID NOS: 1-24.

The present invention also provides a microarray for systematic purity verification and early establishment of cabbage comprising a polynucleotide of the SNP, a polypeptide encoded thereby, or a cDNA thereof. Preferably, the polynucleotide may be immobilized on a substrate coated with an activator of amino-silane, poly-L-lysine or aldehyde, but is not limited thereto. Preferably, the substrate may be a silicon wafer, glass, quartz, metal or plastic, but is not limited thereto. As a method for immobilizing the polynucleotide on a substrate, a micropipetting method using a piezo electric method, a method using a pin-type spotter can be used.

The microarray according to the present invention can be produced by a conventional method known to those skilled in the art using a polynucleotide according to the present invention or a complementary polynucleotide thereof, a polypeptide encoded thereby, or cDNA thereof.

The present invention also relates to

Isolating the genomic DNA from the cabbage sample; And

Determining the genotype of a polymorphic site which is a base of each SNP (single nucleotide polymorphism) of a polynucleotide consisting of the nucleotide sequence of SEQ ID NOS: 1 to 24 of the present invention, and a method of selecting a systematic purity of the cabbage and selecting an early- do.

In the method of the present invention, a method of isolating genomic DNA from a cabbage sample can be performed by a conventional method known in the art. For example, DNA can be directly purified from tissues or cells or amplified by specific amplification of specific regions using amplification methods such as PCR and separation thereof. In the present invention, DNA includes not only DNA but also cDNA synthesized from mRNA. For example, PCR amplification, LCR, transcription amplification, self-sustained sequence replication and nucleic acid-based sequence amplification (NASBA) can be used to obtain the nucleic acid from the subject, But is not limited to.

Determination of the base sequence of the isolated DNA can be performed by various methods known in the art. For example, a probe comprising a sequence at the SNP site or a complementary probe thereof is hybridized with the DNA, and the degree of hybridization obtained is determined through determination of the nucleotide sequence of the direct nucleic acid by the dideoxy method, A method for determining the nucleotide sequence, and the like can be used, but the present invention is not limited thereto. The degree of hybridization can be determined, for example, by marking a detectable label on the target DNA and specifically detecting only the hybridized target DNA, and other electrical signal detection methods can be used, but the present invention is not limited thereto. The systematic purity verification and early establishment system selection method of cabbage according to the present invention is preferably a method wherein the nucleic acid sample separated from the cabbage sample is used as a polynucleotide comprising a SNP according to the present invention or a complementary polynucleotide thereof or And then detecting hybridization results after hybridization with the polynucleotide.

In addition, the present invention provides a primer set for amplifying SNP (polynucleotide polynomial) SNP consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 of the present invention.

The primer set of the present invention comprises at least one set of primers selected from the group consisting of a total of 24 sets of oligonucleotide primers of SEQ ID NOS: 25 to 120, each set of ASP1, ASP2, LSP and STA SEQ ID Nos. 25 to 28 are primer sets for amplifying the SNP polynucleotides of SEQ ID No. 1, and SNP polynucleotides of SEQ ID Nos. 2 to 29 are amplified for the amplification of the SNP polynucleotides of SEQ ID Nos. SEQ ID NOS: 113 to 116 are primer sets for amplifying the SNP polynucleotides of SEQ ID NO: 23, and SEQ ID NOs: 117 to 120 are primer sets for amplifying the SNP polynucleotide of SEQ ID NO: 24. The SNP type assay specific target amplification primer (STA) and the LSP (SNPtype assay locus specific primer) of the present invention are primer sets used for amplification of target sequence (Table 3). LSP and ASP (SNPtype assay allele specific primer) Location A primer set used to identify bases. ASP 3 of the ASP primer The final base represents the SNP locus, ASP1 of the present invention is the primer for the TO1000 reference sequence and ASP2 is the primer for the genomic sequence of the other varieties (Table 4).

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

The present invention also provides kits for systematic purity verification of cabbage and early fixation system selection, including a primer set of the present invention and a reagent for carrying out an amplification reaction. In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In addition,

Isolating the genomic DNA from the cabbage sample;

Amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 24 of the present invention by using the separated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set of the present invention ; And

And a step of detecting the amplification product, and a method of selecting a systematic purity of cabbage and a method of selecting an early fixed system.

In the method of the present invention, the method of isolating the genomic DNA from the cabbage sample can be performed by a conventional method known in the art, and the method is as described above. The target sequence may be amplified by performing amplification reaction using the separated cabbage genomic DNA as a template and using one or more sets of oligonucleotide primers according to one embodiment of the present invention as primers. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The set of one or more oligonucleotide primers used to amplify the target sequence is as described above.

In the method of the present invention, the method for the systematic purity determination of cabbage and the selection of an early immobilization system comprises the step of detecting the amplification product, wherein the detection of the amplification product is performed by sequencing, DNA chip, gel electrophoresis, But not limited to, fluorescence measurement or phosphorescence measurement. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

Experimental material

The names and sources of the 23 cabbages collected at home and abroad are shown in Table 1 below.

Sample number System name Provided company / source K0001 # 107-HO-154 Asian seedlings K0002 # 5-KK-146 Asian seedlings K0003 # 105-RK-P6-1 Asian seedlings K0004 # 106-HY-164 Asian seedlings K0005 # 108-EB-858-7 Asian seedlings K0006 # 10-JK-JK-2 Asian seedlings K0007 # 14-KR, 518 Asian seedlings K0008 # 15-OK, 517 Asian seedlings K0009 # 17-JK, JK-2 Asian seedlings K0010 # 103-MT-621 Asian seedlings K0011 LN-748-4 Nunem seedlings K0012 100587 Samsung seedling K0013 FA-747-1 Nunem seedlings K0014 # 701, CT-12 female Asian seedlings K0015 107140 Samsung seedling K0016 # 7, HRIGRU009386 HRI, United Kingdom K0017 102119 Samsung seedling K0018 # 111-DS-2437-51 Asian seedlings K0019 # 112-QT-DWB-25 Asian seedlings K0020 # 116-PH-347-51 Asian seedlings K0021 Badger Inbred 16 HRI, United Kingdom K0022 HRIGRU007826 HRI, United Kingdom K0023 HRIGRU009617 HRI, United Kingdom

SNP Marker  Screening and genotyping

Based on the 23 lines of cabbages collected at home and abroad, we have produced NGS leads of 10X or more. The produced leads were mapped using a Burrows-Wheeler Alignment tool (BWA) to a 446 Mb cabbage reference sequence (TO1000) after removing low-quality sequences. Mapped leads can be duplicated masking using the genomic analysis tool GATK (http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit) to increase the accuracy of SNP calling, After performing the local realignment process, we used UnifiedGenotyper to predict SNP (Single Nucleotide Polymorphism) and InDel (Insertion-Deletion). The SNP / InDel matrix was generated by merging the SNP / InDel of 23 lines based on the loci of the chromosomes. Then, SNP / InDel matrix was generated, and SNPs or InDels appeared at 60 bp adjacent to the locus of each SNP Respectively. As a result, SNP markers were selected as targets for SNP markers in the vicinity of 60 bp, and Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/input.htm) Was produced. Then, considering the characteristics of the mesohexaploid genome, the generated primer was mapped again to the TO1000 region to evaluate whether the primer only amplified in a single position, and then a hyper-variable region (HVR) was extracted using only a single base left mapping region. From this, 96 SNP markers were selected in 2-5 Mb units.

A primer set for genotyping each SNP was constructed and genotyped by random selection of 30 individuals in six strains that were not fully immobilized. Genotype analysis of each SNP was performed using the Fluidigm platform. A total of 24 SNP markers were selected for each of the chromosomes, and SNPs were selected as markers that can be used to test the systematic fixation and phylogeny of cabbage. The SNP gene on the chromosome of the cabbage was developed over the gene for the systematic and systematic purity assays.

Example 1. SNP statistics

Mapping of high quality read of 23 lines of cabbage has resulted in more than 82% mapping to the TO1000 reference sequence. Based on the mapped leads, the SNP results are shown in Table 2, with an average of 4,216,350 SNPs and 437,484 InDels predicted. Based on the predicted SNP / InDel, SNP / InDel matrix was constructed based on the chromosomal location. As a result, SNP or InDel mutations were found in a total of 21,587,643 loci. As a result of priming with SNP without sequence mutation in the adjacent 60 bp sequence, 121,909 SNP marker candidates were generated, and 101,639 SNP markers were predicted to be single position amplification.

Example  2. SNP Marker  selection

Two-sided hypergeometric tests were performed using the frequencies of SNPs in the 100K range based on the SNP information of each strain in order to select regions where the sequence variation occurs frequently in the cabbage genome. As a result, a region with a significance (p-value) of 0.001 or less was defined as a hypervariable region (HVR) in each line, and a region in which the HVRs in 7 lines or more among 23 lines were defined as cHVR (common HVR region). Therefore, only SNP markers showing SNP polymorphism in more than 4 lines in 23 cabbages were selected at intervals of 2-5Mb after parsing SNP markers in cHVR region. Fluidigm was then used to identify 96 genotypes of SNP markers to create a set of SNP markers for 24 fixed assays (Table 3).

Sequence information of 24 SNPs for the fixed system assay SNP name Sequence information (5 '- > 3') (SEQ ID NO: H1 TTTCTCTCATTCCTCTCCTCAACCTATCAACACTCGTCCATTTCTGTTCCTCAGCATACA [C / T] ATTCGAGAGCAAAACCTGATATCCTGAAAAGTTCTTCCCTTTATCCACTTTAGCTAACTT (1) H2 AGTATACCGGTGTTGCTAATTTGTATTTTAAGATGCTCTTTCTTCAAACCTATACAAACA [C / T] AGTTCCGTTTTTTATTGATAGAAAATTGTAAGCGGTGGCCTAAAGTTTTGTTAGTAGATT (2) H3 TGGTTGATTGCATGAGCGACTTCGGCTATTAGTAATAACCACCGCAACTTTATTCTCCTC [G / A] TCAGCGAAGCAAATATCAGCATGCAAGCCAAACATAATACCTCTGAGTCGATTCATCATC (3) H4 AGGAGGAGAGAGATGCATTAAGATCGACTGGTGGACGACTAATGTATTTGTAATTGTGAGAA [G / C] TATAACGGATGGCTTATACGCTTTGAACATCGTGCTTCAGGTGTGTTACCTTTTGCTTTC (4) H5 GAAAGCCCTTCTCCGTGGACTCACGACGCAGCTCTTGAAGCACGGGAGAATCAAGACGAC [C / T] CGAGCTAGAGCAAGTGCGATGAGGAAGTTTGTGGATAAGATGATTACTCTCGCTAAAGAT (5) H6 ATCCTTGCGTCCTCATCTTTGCTGGAAGTTACAAACCGACGGCACGGGTAGGTAAGGTGG [A / G] CAGGCTCCCACGAGATGCTAGTAATCCATTTCTTGTGGCCTCTAAGGGGGCTGCCATCTA (6) H7 AGATTGTTGCTGCAGTTCACACCTATCCAGTTACACGGCGTCTCGTCAATGCCGTTCCAG [C / T] TGTGCAGACGGTTGAATGAATCTTGAAATCCTCTGTTCTTCAGCTCCAATAGAAACTGAC (7) H8 AGCTGGTGTCCAGGCTGATCCTCTTGGAGATCTAAATACCGAAACAGAGAGAAAACTTGG [A / C] GAGCTAGTTCGGGAAAAGTATGACACCGAGTTCTACATCCTGCATCGCTATCCTTCGGCT (8) H9 ACAATCAGTCTGAAAGTAATGTCTATGTGGTTGGCCTTTTACATATGATTTCCAGTAGTA [G / C] TCAGCTTCCTCAGAGGTTCTGTCAATATAACTGCAAAGCAAGGAAATAGTTAATTTATTT (9) H10 ATAACCACACTCATCTCGTGTGTTTCTTTCTTTTGAGAATGCGCCTCCCACAACATCTCG [A / G] TCCTTTGAGAATGTCATTACATGTTCCGTGATCTTGACTTATTTTTGCTACAGACCTTGT (10) H11 GATAACGGTGACATGAGCTGATTGTGTTTTGTTGGATACTAAATCGCCGAGGCTAAGAGA [T / C] TGGAGATTATTGACTTGGTGAATTTCCAGAGCCTCATTGATAATTACACTGACTTATCAT (11) H12 AACATAAGTGGAAACAGAGATTAGCACAACAGAACCGTTCAAATACAAGATAATGAATCA [A / G] CTAAGTTAATGCAAAACAAAAGATTCATGTCACAAAGAAACCAATCAAATATCAGCTAAG (12) H13 AGCTTTGCAATCAAGTTATCCCTACTCTTACCTGTAATCACGGCACCAGTTACGCGAGCA [C / T] AAACGGCTCGTATCAGCCCACTTGGATAAGATACAGTCTTTGTTAAATTTAGATGATGAG (13) H14 TACATGCAACCGCAGACGAGAAAGAGTTACAAGTCTGAACCTCGGAGGATTCAAACTGGC [A / C] GGTGTGATCTCTCCCTCCATTGGTAATCTCTCCTTTCTCATATCACTTAATCTTGGAGAC (14) H15 AGATTCAACAAGAAGAAACTCTCCAGGAGACGATGTAAGGCTCTCACATCAAGACAGCTT [T / C] TTATGATGCTCTATAAGATTTGAATGTTTGTCTTTTCAATGTAAGGTGGCTCTTTGAGGG (15) H16 CAGTTCACTGGCTGCGTGATATATGGAATGTAAAAACAATCCCCAAGTTGAAAGACTTCT [A / T] TGGAGAGTAATAAAAGGAGCTATACCGGTCAGCTCAAACTTGGAAAGGAGAGGGCTCCCG (16) H17 ACGTACGGGCTCAGACAAATTGTCACGTGTTGCAATATAGGAGGTTCAAAATATAGATGC [T / C] GAGTCAGGTCCATGCAACAATGTTTCCTCAAATTCTGTAGCATTATCAGCTCTTAGTTTT (17) H18 TAGGTTGGAGAAGGAGTCTGGCTTTTTCTTCAACATGAGGTACTTTGAAGACTGTATAAC [C / A] GCTGGTGAATGGGACGATGTGGAGAAGTACCTTTCTGGATTCACTAAAGCTGATGACAAT (18) H19 AGATCTCAGTATCGGATTCGATGCTTTTGTTTCTGCTGTTCAACTATATAAAAGCTTGTG [T / G] AGGGTGTTCTAAGTTTCAAGACTCTTGCATAATCGTTCTTGAGCCATACTAATCAATTTC (19) H20 TTAAAAACTATATATTTATTATCATTGTTAGCTTGATGAAACCACAAATTAAAGAAATAC [C / A] TATCAGCTGGTCTCGATGTTAACTTAAATGTTAAAGCCACACTAATCCCATAGGTTGTAG (20) H21 AATTATAATGTATATGGCCAATACAAGAAGGAGGAACTAAAACTTGAAACATCTACTT [A / G] TTCGTCGAAAATATGACGTGATAAGGTATCTGCTCCATATTTCTTTCACGATTGACCGAG (21) H22 TCTGCGGAGTTCAATACACAGATCAACATACGCACATAGAAGAAAATGTAGTGATTAAAG [A / G] GGAAGACGTATCAAATAAAGACCTGGATCTGGATTTTTATCAGGATGGTATTGAATGGAC (22) H23 TCAACGGAAAAAGGAAGATTTAAAATAATTAAAACCGAAAAAGATACGAGGAGGAAGAGC [A / T] GAGTTTTAGTTCATTAGTGGTGGGGACTTACGGAGTAATAAGGTGCGGCGGCGACGACAC (23) H24 GGTATGTTGCCTTTGGCAGTGGTGAATTCTGTATTTTAGATGTCGAGTAGCTCGGGAAGT [C / T] TCTCAGGACGCAGTAGCTCGGCTTGTAGTTCCACAAGTGATTGCCAAAACAACTCCTTTG (24)

* [TO1000 sequence / other sequence]

Primer sequence information for SNP confirmation Amplification target ASP1 (SEQ ID NO) ASP2 (SEQ ID NO) LSP (SEQ ID NO) STA (SEQ ID NO) H1 CCATTTCTGTTCCTCAGCATACAC (25) TCCATTTCTGTTCCTCAGCATACAT (26) TTTCAGGATATCAGGTTTTGCTCTCGA (27) TCAACCTATCAACACTCGTCCA (28) H2 ATGCTCTTTCTTCAAACCTATACAAACAC (29) GATGCTCTTTCTTCAAACCTATACAAACAT (30) GGCCACCGCTTACAATTTTCTATCA (31) TGTTGCTAATTTGTATTTTAAGATGCTCTTT (32) H3 CACCGCAACTTTATTCTCCTCG (33) CCACCGCAACTTTATTCTCCTCA (34) TTGGCTTGCATGCTGATATTTGCT (35) CGACTTCGGCTATTAGTAATAACCA (36) H4 CAAAGCGTATAAGCCATCCGTTATAC (37) TCAAAGCGTATAAGCCATCCGTTATAG (38) GATCGACTGGTGGACGACTAATGT (39) ACCTGAAGCACGATGTTCAAAG (40) H5 CGCACTTGCTCTAGCTCGG (41) CGCACTTGCTCTAGCTCGA (42) ACGACGCAGCTCTTGAAGCA (43) TTATCCACAAACTTCCTCATCGC (44) H6 CATCTCGTGGGAGCCTGT (45) ATCTCGTGGGAGCCTGC (46) AACCGACGGCACGGGTA (47) GAGGCCACAAGAAATGGATTACTAG (48) H7 GATTCATTCAACCGTCTGCACAG (49) GATTCATTCAACCGTCTGCACAA (50) AGTTACACGGCGTCTCGTCA (51) GCTGAAGAACAGAGGATTTCAAGA (52) H8 ACCGAAACAGAGAGAAAACTTGGA (53) CCGAAACAGAGAGAAAACTTGGC (54) AACTCGGTGTCATACTTTTCCCGA (55) CTGATCCTCTTGGAGATCTAAATACC (56) H9 CAGAACCTCTGAGGAAGCTGAC (57) CAGAACCTCTGAGGAAGCTGAG (58) GTGGTTGGCCTTTTACATATGATTTCCA (59) TCCTTGCTTTGCAGTTATATTGACA (60) H10 GGAACATGTAATGACATTCTCAAAGGAT (61) GGAACATGTAATGACATTCTCAAAGGAC (62) CTTTTGAGAATGCGCCTCCCA (63) CAAAAATAAGTCAAGATCACGGAACAT (64) H11 CTAAATCGCCGAGGCTAAGAGAT (65) AAATCGCCGAGGCTAAGAGAC (66) AGGCTCTGGAAATTCACCAAGTCA (67) AGCTGATTGTGTTTTGTTGGATACT (68) H12 CAGAACCGTTCAAATACAAGATAATGAATCAA (69) AGAACCGTTCAAATACAAGATAATGAATCAG (70) CTTTGTGACATGAATCTTTTGTTTTGCATTAACT (71) GATTAGCACAACAGAACCGTTCA (72) H13 GGCTGATACGAGCCGTTTG (73) GGGCTGATACGAGCCGTTTA (74) ACCTGTAATCACGGCACCAGT (75) CAAAGACTGTATCTTATCCAAGTGGG (76) H14 TCGGAGGATTCAAACTGGCA (77) TCGGAGGATTCAAACTGGCC (78) ATTACCAATGGAGGGAGAGATCACAC (79) CGAGAAAGAGTTACAAGTCTGAACC (80) H15 GGCTCTCACATCAAGACAGCTTT (81) GCTCTCACATCAAGACAGCTTC (82) CCACCTTACATTGAAAAGACAAACATTCAAAT (83) TCCAGGAGACGATGTAAGGC (84) H16 ACAATCCCCAAGTTGAAAGACTTCTA (85) CAATCCCCAAGTTGAAAGACTTCTT (86) GAGCTGACCGGTATAGCTCCTT (87) CTGCGTGATATATGGAATGTAAAAACAAT (88) H17 TGTTGCATGGACCTGACTCA (89) TGTTGCATGGACCTGACTCG (90) TCACGTGTTGCAATATAGGAGGTTCA (91) TGCTACAGAATTTGAGGAAACATTGT (92) H18 TCGTCCCATTCACCAGCG (93) CATCGTCCCATTCACCAGCT (94) GTCTGGCTTTTTCTTCAACATGAGGT (95) TCCAGAAAGGTACTTCTCCACAT (96) H19 CAAGAGTCTTGAAACTTAGAACACCCTA (97) AGAGTCTTGAAACTTAGAACACCCTC (98) CGATGCTTTTGTTTCTGCTGTTCAAC (99) GCTCAAGAACGATTATGCAAGAGT (100) H20 AAGTTAACATCGAGACCAGCTGATAG (101) TTTAAGTTAACATCGAGACCAGCTGATAT (102) TCATTGTTAGCTTGATGAAACCACAAATTAAAGAA (103) GGATTAGTGTGGCTTTAACATTTAAGTT (104) H21 ACCTTATCACGTCATATTTTCGACGAAT (105) CCTTATCACGTCATATTTTCGACGAAC (106) GCCAATACAAGAAGGAGGAACTGAAAA (107) GGAGCAGATACCTTATCACGTCA (108) H22 CCAGGTCTTTATTTGATACGTCTTCCT (109) CCAGGTCTTTATTTGATACGTCTTCCC (110) CAACATACGCACATAGAAGAAAATGTAGTGATT (111) TCCTGATAAAAATCCAGATCCAGGT (112) H23 CCCCACCACTAATGAACTAAAACTCT (113) CCCCACCACTAATGAACTAAAACTCA (114) AAAACCGAAAAAGATACGAGGAGGAAGA (115) CCTTATTACTCCGTAAGTCCCCA (116) H24 GTCGAGTAGCTCGGGAAGTC (117) GTCGAGTAGCTCGGGAAGTT (118) ACAAGCCGAGCTACTGCGT (119) GGCAGTGGTGAATTCTGTATTTTAGA (120)

Example  3. Fixed test results

Based on the 24 marker sets for the stationary test, the genotypic analysis was carried out by selecting 29 cabbage lines from each of the 6 lines of cabbage lines, respectively, in order to test whether they could be fixed or not. The 9913 and 9914 strains are the strains that determine that the breeder is fixed because the breeder no longer segregates the phenotype, and the remaining 4 strains are the strains that do not yet become phenotypic. In genotype analysis, loci (yellow markings) were present in 9913 and 9914 strains (FIGS. 2A and B), but there were 9 markers showing different genotypes among 24 markers, Two individuals were detected. On the other hand, in the remaining 4 lines, more than half of the 24 markers showed different genotypes for each individual, indicating that the degree of fixation was very poor (FIG. 2C-F). In addition, it was found that the fixation defined by the breeder under the criterion that the phenotype separation did not occur was different from the complete fixation of the actual genotype. In addition, the genotypes of 27-30 individuals from two microbial cultures, which were supposed to be completely immobilized without variation among individuals, were confirmed using the developed marker set, 3 and 4).

The above results show that, when the marker set of the present invention is used for the proliferation of the progeny for fixing the strains which are not fixed and for the F1 breed development, the purity of the progeny can be perfectly increased and the time for fixation can be shortened .

<110> Korea Research Institute of Bioscience and Biotechnology <120> Single nucleotide polymorphism marker set for line purity          checking and early fixed line selecting in Cabbage and uses          the <130> PN14311 <160> 120 <170> Kopatentin 2.0 <210> 1 <211> 121 <212> DNA <213> Brassica oleracea <400> 1 tttctctcat tcctctcctc aacctatcaa cactcgtcca tttctgttcc tcagcataca 60 tattcgagag caaaacctga tatcctgaaa agttcttccc tttatccact ttagctaact 120 t 121 <210> 2 <211> 121 <212> DNA <213> Brassica oleracea <400> 2 agtataccgg tgttgctaat ttgtatttta agatgctctt tcttcaaacc tatacaaaca 60 tagttccgtt ttttattgat agaaaattgt aagcggtggc ctaaagtttt gttagtagat 120 t 121 <210> 3 <211> 121 <212> DNA <213> Brassica oleracea <400> 3 tggttgattg catgagcgac ttcggctatt agtaataacc accgcaactt tattctcctc 60 atcagcgaag caaatatcag catgcaagcc aaacataata cctctgagtc gattcatcat 120 c 121 <210> 4 <211> 121 <212> DNA <213> Brassica oleracea <400> 4 aggaggagag atgcattaag atcgactggt ggacgactaa tgtatttgta attgtgagaa 60 ctataacgga tggcttatac gctttgaaca tcgtgcttca ggtgtgttac cttttgcttt 120 c 121 <210> 5 <211> 121 <212> DNA <213> Brassica oleracea <400> 5 gaaagccctt ctccgtggac tcacgacgca gctcttgaag cacgggagaa tcaagacgac 60 tcgagctaga gcaagtgcga tgaggaagtt tgtggataag atgattactc tcgctaaaga 120 t 121 <210> 6 <211> 121 <212> DNA <213> Brassica oleracea <400> 6 atccttgcgt cctcatcttt gctggaagtt acaaaccgac ggcacgggta ggtaaggtgg 60 gcaggctccc acgagatgct agtaatccat ttcttgtggc ctctaagggg gctgccatct 120 a 121 <210> 7 <211> 121 <212> DNA <213> Brassica oleracea <400> 7 agattgttgc tgcagttcac acctatccag ttacacggcg tctcgtcaat gccgttccag 60 ttgtgcagac ggttgaatga atcttgaaat cctctgttct tcagctccaa tagaaactga 120 c 121 <210> 8 <211> 121 <212> DNA <213> Brassica oleracea <400> 8 agctggtgtc caggctgatc ctcttggaga tctaaatacc gaaacagaga gaaaacttgg 60 cgagctagtt cgggaaaagt atgacaccga gttctacatc ctgcatcgct atccttcggc 120 t 121 <210> 9 <211> 121 <212> DNA <213> Brassica oleracea <400> 9 acaatcagtc tgaaagtaat gtctatgtgg ttggcctttt acatatgatt tccagtagta 60 ctcagcttcc tcagaggttc tgtcaatata actgcaaagc aaggaaatag ttaatttatt 120 t 121 <210> 10 <211> 121 <212> DNA <213> Brassica oleracea <400> 10 ataaccacac tcatctcgtg tgtttctttc ttttgagaat gcgcctccca caacatctcg 60 gtcctttgag aatgtcatta catgttccgt gatcttgact tatttttgct acagaccttg 120 t 121 <210> 11 <211> 121 <212> DNA <213> Brassica oleracea <400> 11 gataacggtg acatgagctg attgtgtttt gttggatact aaatcgccga ggctaagaga 60 ctggagatta ttgacttggt gaatttccag agcctcattg ataattacac tgacttatca 120 t 121 <210> 12 <211> 121 <212> DNA <213> Brassica oleracea <400> 12 aacataagtg gaaacagaga ttagcacaac agaaccgttc aaatacaaga taatgaatca 60 gctaagttaa tgcaaaacaa aagattcatg tcacaaagaa accaatcaaa tatcagctaa 120 g 121 <210> 13 <211> 121 <212> DNA <213> Brassica oleracea <400> 13 agctttgcaa tcaagttatc cctactctta cctgtaatca cggcaccagt tacgcgagca 60 taaacggctc gtatcagccc acttggataa gatacagtct ttgttaaatt tagatgatga 120 g 121 <210> 14 <211> 121 <212> DNA <213> Brassica oleracea <400> 14 tacatgcaac cgcagacgag aaagagttac aagtctgaac ctcggaggat tcaaactggc 60 cggtgtgatc tctccctcca ttggtaatct ctcctttctc atatcactta atcttggaga 120 c 121 <210> 15 <211> 121 <212> DNA <213> Brassica oleracea <400> 15 agattcaaca agaagaaact ctccaggaga cgatgtaagg ctctcacatc aagacagctt 60 cttatgatgc tctataagat ttgaatgttt gtcttttcaa tgtaaggtgg ctctttgagg 120 g 121 <210> 16 <211> 121 <212> DNA <213> Brassica oleracea <400> 16 cagttcactg gctgcgtgat atatggaatg taaaaacaat ccccaagttg aaagacttct 60 ttggagagta ataaaaggag ctataccggt cagctcaaac ttggaaagga gagggctccc 120 g 121 <210> 17 <211> 121 <212> DNA <213> Brassica oleracea <400> 17 acgtacgggc tcagacaaat tgtcacgtgt tgcaatatag gaggttcaaa atatagatgc 60 cgagtcaggt ccatgcaaca atgtttcctc aaattctgta gcattatcag ctcttagttt 120 t 121 <210> 18 <211> 121 <212> DNA <213> Brassica oleracea <400> 18 taggttggag aaggagtctg gctttttctt caacatgagg tactttgaag actgtataac 60 agctggtgaa tgggacgatg tggagaagta cctttctgga ttcactaaag ctgatgacaa 120 t 121 <210> 19 <211> 121 <212> DNA <213> Brassica oleracea <400> 19 agatctcagt atcggattcg atgcttttgt ttctgctgtt caactatata aaagcttgtg 60 gagggtgttc taagtttcaa gactcttgca taatcgttct tgagccatac taatcaattt 120 c 121 <210> 20 <211> 121 <212> DNA <213> Brassica oleracea <400> 20 ttaaaaacta tatatttatt atcattgtta gcttgatgaa accacaaatt aaagaaatac 60 atatcagctg gtctcgatgt taacttaaat gttaaagcca cactaatccc ataggttgta 120 g 121 <210> 21 <211> 121 <212> DNA <213> Brassica oleracea <400> 21 aattataatg tatatggcca atacaagaag gaggaactga aaaacttgaa acatctactt 60 gttcgtcgaa aatatgacgt gataaggtat ctgctccata tttctttcac gattgaccga 120 g 121 <210> 22 <211> 121 <212> DNA <213> Brassica oleracea <400> 22 tctgcggagt tcaatacaca gatcaacata cgcacataga agaaaatgta gtgattaaag 60 gggaagacgt atcaaataaa gacctggatc tggattttta tcaggatggt attgaatgga 120 c 121 <210> 23 <211> 121 <212> DNA <213> Brassica oleracea <400> 23 tcaacggaaa aaggaagatt taaaataatt aaaaccgaaa aagatacgag gaggaagagc 60 tgagttttag ttcattagtg gtggggactt acggagtaat aaggtgcggc ggcgacgaca 120 c 121 <210> 24 <211> 121 <212> DNA <213> Brassica oleracea <400> 24 ggtatgttgc ctttggcagt ggtgaattct gtattttaga tgtcgagtag ctcgggaagt 60 ttctcaggac gcagtagctc ggcttgtagt tccacaagtg attgccaaaa caactccttt 120 g 121 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ccatttctgt tcctcagcat acac 24 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tccatttctg ttcctcagca tacat 25 <210> 27 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 tttcaggata tcaggttttg ctctcga 27 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 tcaacctatc aacactcgtc ca 22 <210> 29 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 atgctctttc ttcaaaccta tacaaacac 29 <210> 30 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 gatgctcttt cttcaaacct atacaaacat 30 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ggccaccgct tacaattttc tatca 25 <210> 32 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tgttgctaat ttgtatttta agatgctctt t 31 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 caccgcaact ttattctcct cg 22 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ccaccgcaac tttattctcc tca 23 <210> 35 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 ttggcttgca tgctgatatt tgct 24 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 cgacttcggc tattagtaat aacca 25 <210> 37 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 caaagcgtat aagccatccg ttatac 26 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tcaaagcgta taagccatcc gttatag 27 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 gatcgactgg tggacgacta atgt 24 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 acctgaagca cgatgttcaa ag 22 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 cgcacttgct ctagctcgg 19 <210> 42 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 cgcacttgct ctagctcga 19 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 acgacgcagc tcttgaagca 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ttatccacaa acttcctcat cgc 23 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 catctcgtgg gagcctgt 18 <210> 46 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 atctcgtggg agcctgc 17 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 aaccgacggc acgggta 17 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 gaggccacaa gaaatggatt actag 25 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 gattcattca accgtctgca cag 23 <210> 50 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 gattcattca accgtctgca caa 23 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 agttacacgg cgtctcgtca 20 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 gctgaagaac agaggatttc aaga 24 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 accgaaacag agagaaaact tgga 24 <210> 54 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 ccgaaacaga gagaaaactt ggc 23 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 aactcggtgt catacttttc ccga 24 <210> 56 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 ctgatcctct tggagatcta aatacc 26 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 cagaacctct gaggaagctg ac 22 <210> 58 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 cagaacctct gaggaagctg ag 22 <210> 59 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 gtggttggcc ttttacatat gatttcca 28 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 tccttgcttt gcagttatat tgaca 25 <210> 61 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 61 ggaacatgta atgacattct caaaggat 28 <210> 62 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 62 ggaacatgta atgacattct caaaggac 28 <210> 63 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 63 cttttgagaa tgcgcctccc a 21 <210> 64 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 64 caaaaataag tcaagatcac ggaacat 27 <210> 65 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 65 ctaaatcgcc gaggctaaga gat 23 <210> 66 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 66 aaatcgccga ggctaagaga c 21 <210> 67 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 67 aggctctgga aattcaccaa gtca 24 <210> 68 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 68 agctgattgt gttttgttgg atact 25 <210> 69 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 69 cagaaccgtt caaatacaag ataatgaatc aa 32 <210> 70 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 70 agaaccgttc aaatacaaga taatgaatca g 31 <210> 71 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 71 ctttgtgaca tgaatctttt gttttgcatt aact 34 <210> 72 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 72 gattagcaca acagaaccgt tca 23 <210> 73 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 73 ggctgatacg agccgtttg 19 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 74 gggctgatac gagccgttta 20 <210> 75 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 75 acctgtaatc acggcaccag t 21 <210> 76 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 76 caaagactgt atcttatcca agtggg 26 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 77 tcggaggatt caaactggca 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 78 tcggaggatt caaactggcc 20 <210> 79 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 79 attaccaatg gagggagaga tcacac 26 <210> 80 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 80 cgagaaagag ttacaagtct gaacc 25 <210> 81 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 81 ggctctcaca tcaagacagc ttt 23 <210> 82 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 82 gctctcacat caagacagct tc 22 <210> 83 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 83 ccaccttaca ttgaaaagac aaacattcaa at 32 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 84 tccaggagac gatgtaaggc 20 <210> 85 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 85 acaatcccca agttgaaaga cttcta 26 <210> 86 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 86 caatccccaa gttgaaagac ttctt 25 <210> 87 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 87 gagctgaccg gtatagctcc tt 22 <210> 88 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 88 ctgcgtgata tatggaatgt aaaaacaat 29 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 89 tgttgcatgg acctgactca 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 90 tgttgcatgg acctgactcg 20 <210> 91 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 91 tcacgtgttg caatatagga ggttca 26 <210> 92 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 92 tgctacagaa tttgaggaaa cattgt 26 <210> 93 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 93 tcgtcccatt caccagcg 18 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 94 catcgtccca ttcaccagct 20 <210> 95 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 95 gtctggcttt ttcttcaaca tgaggt 26 <210> 96 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 96 tccagaaagg tacttctcca cat 23 <210> 97 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 97 caagagtctt gaaacttaga acacccta 28 <210> 98 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 98 agagtcttga aacttagaac accctc 26 <210> 99 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 99 cgatgctttt gtttctgctg ttcaac 26 <210> 100 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 100 gctcaagaac gattatgcaa gagt 24 <210> 101 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 101 aagttaacat cgagaccagc tgatag 26 <210> 102 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 102 tttaagttaa catcgagacc agctgatat 29 <210> 103 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 103 tcattgttag cttgatgaaa ccacaaatta aagaa 35 <210> 104 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 104 ggattagtgt ggctttaaca tttaagtt 28 <210> 105 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 105 accttatcac gtcatatttt cgacgaat 28 <210> 106 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 106 ccttatcacg tcatattttc gacgaac 27 <210> 107 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 107 gccaatacaa gaaggaggaa ctgaaaa 27 <210> 108 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 108 ggagcagata ccttatcacg tca 23 <210> 109 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 109 ccaggtcttt atttgatacg tcttcct 27 <210> 110 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 110 ccaggtcttt atttgatacg tcttccc 27 <210> 111 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 111 caacatacgc acatagaaga aaatgtagtg att 33 <210> 112 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 112 tcctgataaa aatccagatc caggt 25 <210> 113 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 113 ccccaccact aatgaactaa aactct 26 <210> 114 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 114 ccccaccact aatgaactaa aactca 26 <210> 115 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 115 aaaaccgaaa aagatacgag gaggaaga 28 <210> 116 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 116 ccttattact ccgtaagtcc cca 23 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 117 gtcgagtagc tcgggaagtc 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 118 gtcgagtagc tcgggaagtt 20 <210> 119 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 119 acaagccgag ctactgcgt 19 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 120 ggcagtggtg aattctgtat tttaga 26

Claims (10)

A polynucleotide consisting of a nucleotide sequence of SEQ ID NOS: 1 to 24, wherein the polynucleotide is composed of 10 or more consecutive bases including a single nucleotide polymorphism (SNP) position (61st from SEQ ID NO: 1 to SEQ ID NO: 24) Or a complementary polynucleotide thereof. &Lt; Desc / Clms Page number 24 &gt; delete delete Isolating the genomic DNA from the cabbage sample; And
Determining the genotype of a polymorphic site that is a base of each SNP (single nucleotide polymorphism) of a polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 described in claim 1, and determining the systematic purity of the cabbage and the early fixed system selection method . Wherein each set of oligonucleotide primers set forth in SEQ ID NOS: 25 to 120, wherein each of the primer sets comprises, in sequence, four oligonucleotides of adjacent SEQ ID Nos. A primer set for amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 24. delete A kit for screening cabbage for systematic purity and early fixation system, comprising the oligonucleotide primer set of claim 5 and a reagent for carrying out an amplification reaction. 8. The kit according to claim 7, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. Isolating the genomic DNA from the cabbage sample;
Amplification reaction is carried out using the separated genomic DNA as a template and the oligonucleotide primer set of claim 5 to amplify a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 24 described in claim 1 ; And
And detecting the amplification product. 2. The method according to claim 1, wherein the amplification product is detected. 10. The method according to claim 9, wherein the detection of the amplification product is performed by sequencing, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images