KR101704382B1 - Specific primer set for discrimination of cabbage clubroot disease-resistant cultivar and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for specifically discriminating cabbage clubroot disease-resistant cultivar, and uses thereof. According to the present invention, cabbage clubroot disease-resistant cultivar can be specifically discriminated in an easy and rapid manner. Also, when breeding cabbage clubroot disease-resistant cultivar, root-related properties and disease resistance of cultivar or line are effectively evaluated so the primer set can be used for breeding cabbage clubroot disease-resistant cultivar.

Description

[0001] The present invention relates to a primer set and a use thereof for discriminating specifically the cabbage root-knocker resistant varieties.

The present invention relates to a primer set for specifically discriminating a cabbage root disease resistant variety and a use thereof. More particularly, the present invention relates to a primer set for specifically discriminating a cabbage root-blight resistance resistant variety comprising five kinds of primer sets , A kit for specifically discriminating a cabbage root disease resistant variety including the primer set, and a method for specifically discriminating a cabbage root disease resistant variety using the primer set.

A total of nine locus-related loci (CRa, CRb, CRc, CRk, Crr1, Crr2, Crr3, Crr4 and CRaki) The CRb locus was reported by Piao et al. (2004, Theor Appl Genet 108: 1458-1465), and the results of the study were reported by using associative mapping and QTL analysis using AF shrimp with AFLP / SCAR marker. These CRb locus-related markers (TCR09, TCR05, TCR01) could be used as an index to determine the presence of resistance locus. However, since they are related markers, they are physically distant from the resistance gene and lack information on precise resistance locus. There was a difficulty in selecting the resistance resource / object used.

Recently, the accuracy of the mapping has been reported for the CRb locus (Teng et al., 2014 Mol Breeding 34: 1173-1183). The closer the markers were developed (TCR079, TCR108) (Polyacrylamide gel electrophoresis), and the difference between resistance and dyspepsia is small, which is somewhat inconvenient for use as MAS (marker assisted selection). Therefore, we tried to develop a marker that is easier to detect and ultimately uses genes that are mainly involved in resistant traits.

Korean Patent No. 1095220 discloses a 'Chinese cabbage disease resistance-related molecule marker and its use', Korean Patent Laid-Open Publication No. 2014-0023618 discloses 'a primer for diagnosis of cabbage root disease and a detection method using the same' However, as described in the present invention, there is no disclosure of a primer set and its use for specifically discriminating a cabbage root disease-resistant variety.

The present invention has been made in view of the above-described needs. The present inventors have found that the CRb locus-related markers (TCR09, TCR05, TCR01) related to the presently known Chinese cabbage pathogen-resistant trait can be used as an indicator for determining the presence of a resistance locus , It is physically distant from the resistance gene because it is an association marker, and it is confirmed that there is a lack of information on precise resistance locus, which makes it difficult to select resistance resources / individuals using markers. Therefore, in order to develop a primer capable of specifically discriminating the resistant varieties of cabbage root rot, the present invention is directed to genome data of the resistant strain CR shinki and susceptible strain 94sk, and the reference assemble and de novo assemblage (de novo assemble), the present inventors have completed the present invention by developing a total of five types of primer sets for specifically discriminating the cabbage root rot resistance disease varieties.

In order to accomplish the above object, the present invention provides oligonucleotide primer sets of SEQ ID NOS: 5 and 6; An oligonucleotide primer set of SEQ ID NOS: 33 and 34; Oligonucleotide primer sets of SEQ ID NOs: 35 and 36; An oligonucleotide primer set of SEQ ID NOS: 37 and 38; And an oligonucleotide primer set of SEQ ID NOs: 39 and 40. The present invention provides a set of primers for specifically identifying a cabbage root-knot disease resistant variety comprising at least one primer set selected from the group consisting of SEQ ID NOs:

In addition, the present invention provides a kit for specifically identifying a cabbage root-knot disease resistant variety comprising the primer set.

In addition, the present invention provides a method for specifically identifying a cabbage root-knot disease resistant variety using the primer set.

In the present invention, it was confirmed that a total of five primer sets selected in the final selection can be used to specifically discriminate the cabbage root-knot disease resistant varieties. Therefore, it is possible to easily and quickly perform a specific discrimination on the resistant varieties of cabbage root disease by the present invention. Therefore, when cultivating the root-related resistant varieties of Chinese cabbage, it is possible to efficiently evaluate the root-related characteristics and disease resistance of the varieties or strains, And can be usefully used for related disease-resistant breeding.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram illustrating a method of developing a primer set for specifically identifying a Chinese cabbage disease resistant variety of the present invention through a reference-based assemble and a de novo assemble method.
FIG. 2 is a graph showing the relationship between the target area and the target area of the marker based on the TCR079 and TCR108 marker information for the reference-based assembly used in the present invention. The target area was 84,945 bp, It is the result of confirming that there are 15 genes (positions are indicated in green).
FIG. 3 shows the results of PAGE (polyacrylamide gel electrophoresis) analysis on CR shinki, gelria, and susceptible strains 94SK and chiifu using a total of 15 primers obtained through the reference-based assays used in the present invention It is the result of confirming that resistance and sensitivity can be distinguished in CRb_003.
FIG. 4 shows that the sequence of the PCR product of FIG. 3 was sequenced by repeating the CR shinki three times and the resistance system Gelria four times to find out the sequence information of the PCR product. As a result, (SEQ ID NO: 31) and AAAACCCCCACCTATC (SEQ ID NO: 31) were not found at the positions after 37 bp.
Fig. 5 shows the results of PCR of CR shinki, gelria, siloga, 94sk, and chiifu as CRb_048 primer. CR shinki and gelria of the resistant strains showed the lowest bands. Sensory strains 94SK and chiifu showed the above bands and the amplicon size , And it was confirmed that the resistance system and the susceptible system were distinguished from each other.
FIG. 6 shows the results of the PCR shinki 2 repeat, gelria 2 repeat and 94sk 1 repeat sequencing analysis performed on Bionissa to obtain information on the sequence of the PCR product of FIG. 5, and when the obtained sequences were aligned, the susceptibility strain 94sk, chiifu ), Which is the result of confirming that there are three insertions.
7 shows the location of CRb_057 developed in the present invention.
Fig. 8 shows the results of PCR using CRb_057 against resistant strains CR shinki and Gelria, and susceptible strains 94sk and chiifu. The CR for each lane represents CR shinki and GE represents Gelria.
FIG. 9 is a graph showing the results of a test on the resistance and susceptibility to germplasm using CRb_057 developed in the present invention. As a result, bands appeared in CR shinki and Gelria, which are known to have CRb, and in Chiifu, 94sk (A), automatic electrophoresis apparatus (B), and HRM (C). The automated electrophoresis apparatus was a Labchip GX manufactured by lifescience. Agarose gelo reproduces the result of gelation on agarose gel. Although exact size difference with each band is unknown, it is possible to know more accurate bp with each band by using this machine.
FIG. 10 shows the results of a test on the resistance and susceptibility to germplasm using CRb_065 developed in the present invention. As a result, CR shinki, which is known to have CRb, band was identified in Gelria, and Chiifu, 94sk Amplified in the position. The top view is the result of agarose gel and the bottom view is the result of gel electrophoresis.
FIG. 11 is a result of HRM analysis of the results of FIG. 10 obtained by testing the resistance and susceptibility to germplasm associated with root canal disease using CRb_065 developed in the present invention.
FIG. 12 shows a result (b) of the CRb_065 position (a) developed in the present invention and the results of PCR using CR shinki and Gelria as resistance strains and 94sk and chiifu as susceptibility strains. The CR for each lane represents CR shinki and GE represents Gelria.
FIG. 13 is a result (b) of the CRb_060 developed in the present invention and HRM analysis performed on resistive strains CR shinki and Gelria and susceptible strains 94sk and chiifu.

In order to achieve the object of the present invention, the present invention provides oligonucleotide primer sets of SEQ ID NOS: 5 and 6; An oligonucleotide primer set of SEQ ID NOS: 33 and 34; Oligonucleotide primer sets of SEQ ID NOs: 35 and 36; An oligonucleotide primer set of SEQ ID NOS: 37 and 38; And an oligonucleotide primer set of SEQ ID NOs: 39 and 40. The present invention provides a set of primers for specifically identifying a cabbage root-knot disease resistant variety comprising at least one primer set selected from the group consisting of SEQ ID NOs:

The primers include 16 or more, 17 or more, 18 or more, 19 or more in the sequence of SEQ ID NOS: 5, 6, 33, 34, 35, 36, 37, , And oligonucleotides consisting of fragments of 20 or more consecutive nucleotides. For example, the primer of SEQ ID NO: 5 comprises at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24 And the primer of SEQ ID NO: 6 may comprise at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , 22 or more, 23 or more, 24 or more, or 25 or more consecutive nucleotides. The primers may also include additional, deleted or substituted sequences of the nucleotide sequences of SEQ ID NOS: 5, 6, 33, 34, 35, 36, 37, 38, 39 and 40.

An oligonucleotide primer set according to one embodiment of the present invention comprises oligonucleotide primer sets of SEQ ID NOS: 5 and 6; An oligonucleotide primer set of SEQ ID NOS: 33 and 34; Oligonucleotide primer sets of SEQ ID NOs: 35 and 36; An oligonucleotide primer set of SEQ ID NOS: 37 and 38; And a set of oligonucleotide primers of SEQ ID NOs: 39 and 40. The primer set of SEQ ID NO:

The simultaneous use of the oligonucleotide primer sets of SEQ ID NOS: 5, 6, 33, 34, 35, 36, 37, 38, 39 and 40 can more efficiently diagnose, predict or detect cabbage root disease resistant varieties.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In order to achieve still another object of the present invention, the present invention provides a kit comprising at least one set of oligonucleotide primers according to the present invention; And a reagent for carrying out an amplification reaction. The present invention also provides a kit for specifically identifying a Chinese cabbage disease resistant variety.

In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In order to achieve still another object of the present invention,

Separating the genomic DNA from the sample to be analyzed;

Amplifying the target sequence by using the separated genomic DNA as a template and carrying out an amplification reaction using the oligonucleotide primer set; And

And detecting the amplification product. The present invention also provides a method for specifically discriminating a Chinese cabbage disease resistant variety.

The method of the present invention comprises separating genomic DNA from a sample to be analyzed. As a method for separating the genomic DNA from the sample, a method known in the art can be used. For example, the CTAB method may be used, or a wizard prep kit (Promega) may be used. The target sequence may be amplified by performing amplification reaction using the separated genomic DNA as a template and using one or more oligonucleotide primer sets according to one embodiment of the present invention as primers. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The set of one or more oligonucleotide primers used to amplify the target sequence is as described above.

The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, high resolution melting (HRM) analysis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto.

As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Preferably, CRb_003 consisting of the oligonucleotide primer set of SEQ ID NOS: 5 and 6 and CRb_048 consisting of the oligonucleotide primer set of SEQ ID NOS: 33 and 34 are used for analysis of polyacrylamide gel electrophoresis analysis The method is preferably an agarose gel analysis method when analyzing a PCR product using CRb_057 consisting of the oligonucleotide primer set of SEQ ID NOs: 35 and 36 and CRb_065 consisting of the oligonucleotide primer set of SEQ ID NOs: 37 and 38, The HRM (high resolution melting) analysis method may be preferable when analyzing PCR products using CRb_065 consisting of the oligonucleotide primer sets of numbers 37 and 38 and CRb_060 consisting of the oligonucleotide primer set of SEQ ID NOs: 39 and 40, Not limited.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. The present invention CRb Marker  Two Ways to Develop

For the development of CRb markers, CR shinki, a resistant strain, and re-sequencing of 94sk, a susceptible strain, were performed with Illumina Hi-seq 2000. The generated genomic data was processed in two ways. One method is a reference genome assemble method based on a reference, and the other method is a de novo method using a short read own nucleotide sequence assemble method) (Fig. 1). In the case of the reference - based assembly method, the total amount of genome produced was 277,083,473bp (277M) and the total coverage of the genome was about 52.4%. The total number of contiguities was 514,436, from a short length of 22bp to a long length of 10,813,819bp, with an average contig size of 36,724bp.

In the de novo assemble method, the total amount of produced genome was 235,018,193 bp (235M), and the total coverage of the genome was about 44.4%. The total number of contigues was 459,971, ranging from a length of 201bp to a length of 9,378bp, with an average contig size of 511bp.

Example  2. The present invention reference  base Assembly ( reference assemble ) Results CRb _003 Marker  Development

In the present invention, the marker development has been largely carried out in two directions, that is, a method using a reference-based assembly result and a method using a de novo assemble result.

In the case of the reference - based assembly, the target region is set as a dielectric region which makes both ends of these markers by using the previously reported TCR079 and TCR108 marker information. The total length of the target region was 84,945 bp, and 15 genes were present as predicted genes (Fig. 2). First, CR shinki (genetic reanalysis (ref.seq) result information) was blasted to the target area, and a total of 250 scaffolds were hit. Scaffold000013 was selected based on the selection of scaffolds located at A03 and high in HSP score (value with high degree of similarity). A total of 20 SNPs were found as a result of aligning Scaffold00013 with the target region. Thus, 15 primers of Table 1 were prepared.

Name of the primer Forward (SEQ ID NO) Reverse (SEQ ID NO) Target (CR shinki / Chiifu) size One CRb_001 ATCACGAATTCTAGTTCGAACACC (1) AATATGATAGTCGAGGACGAACGA (2) A / T 141 2 CRb_002 GATGTTGAGCAAATAAAACCGC (3) GACATAATACAAGGTCAAGCTCCG (4) T / A 108 3 CRb _003 ACGAGAAGACAGAGAGACAGTGGT (5) GATAGAAACCACCACCGATAAAAAC (6) C / A 150 4 CRb_004 ATTTGTAGGAGTAACCTCAGCCAA (7) AGGAGACATGGTCTTTCATGTGAC (8) S / G, A / T 96 5 CRb_005 TAAACGAACTCTCAATCGAACTCC (9) TTCTCGACGCTCTAAGGTGAGTAT (10) A / C 108 6 CRb_006 ATTTAGTGAATGCAGGCACATCTC (11) TTACCCAATGGAGAAGACACTACC (12) A / T 135 7 CRb_007 GTAGGGCAGTTAAATAGGACATGG (13) CTTGCCTAAGCTACGACACTTTCT (14) Y / G 136 8 CRb_008 AGGGTGGGTAGTAACCTCCTGTAT (15) TACTTGGAACGTACAACGAGTCAG (16) C / T 133 9 CRb_009 CGTACCTATGCCACACTCTAGGA (17) AAGTAACTTGGAGGAATGGGGTT (18) C / A 129 10 CRb_010 AAAAAGCAATATCACGGAACCC (19) CTTCCTAAGGGTCTTTGTGAGAAG (20) C / A 138 11 CRb_011 TCCTTGACAGTTCCAGCTCATAAT (21) CTCCAAACGTAAGACTCCTTTGAC (22) A / C 136 12 CRb_012 AAATCTTGGAGGAACACTGAGATG (23) ATTGTCAGCGACTTACACATGAGA (24) R / T 146 13 CRb_013 CATTTGGAATAGCGTTAGGGATAG (25) GAAACACTTGATCTGCATCTTGC (26) S / A, T / G 134 14 CRb_014 ATCACAATGTCTTGAAGAGAACCC (27) GTAAGGTAACATTATTTGCCGGG (28) S / T, C / T 125 15 CRb_015 CCCACTCCATATTTTACTCCAGAA (29) CAACCCCACTTCATATTTACTCC (30) M / G, G / A 148

HRM (High-Resolution Melting) analysis was performed using a total of 15 primers shown in Table 1 above. Twelve pairs of primers were amplified and three pairs of primers were not amplified. PAGE analysis of fifteen pairs of primers made it possible to distinguish between CRb_003 resistance and susceptibility. The remaining primers did not show polymorphism. In contrast to the development of SNP primers, polyacrylamide gel electrophoresis (PAGE) results showed differences in size between the PCR products (Fig. 3), indicating that there is a difference from the sequence with CR shinki in the reference-based assemble. Sequence submissions were made to Bioneer to obtain information on the sequence of the PCR products. Three repetitions of the resistance shunt CR shinki and four cycles of the resistant strain Gelria were performed. There were two types of Gelria sequences, with AAAACCCCCACCTATC (SEQ ID NO: 31) and AAAACCCCCACCTATC (SEQ ID NO: 31) missing at positions after 37 bp (FIG. As a result, PAGE can explain why Gelria showed two bands. This indicated that the reference-based assembly was different from the actual sequence and proceeded to de novo assemble in the next experiment.

We performed the marker test on the SRC-152011 in the laboratory with the above CRb_003 primer and compared the results with the TCR-079 that was used previously. Comparing the results, the bands showing resistance in TCR_079 were resistant to CRb_003 except for 8 cases, and those amplified with two bands from TCR_079 to heterotypes were susceptible (Table 2). Therefore, the TCR_079 marker, which was difficult to use as a MAS in PAGE due to the small difference in polymorphism, could be replaced by CRb_003.

One 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 TCR_079 H R H R H R H R R R H R H H R H H H R H R CRb_003 S R S R S R S S R R S R S S R S S S R S R 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 TCR_079 R H R R H H H H R H H R H H R H - H H H R CRb_003 - S R R S S S S R S S R S S R S R S S S R 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 TCR_079 R R H - - R H - H R R H R R H H R R R H H CRb_003 R R S - - R S - S - R S R R - S R R R S S 64 65 66 TCR_079 R R H CRb_003 R R S

Example  3. In the present invention, Novo Assembly ( de novo assemble Development of four markers using results

The sequence of TCR_079 and TCR_108, which are the target regions, was blasted with CR shinki de novo sequence as a query. As a result, 250 contigs were hit and HSP was ordered in the order of highest. The alignment of 31 contigs resulted in indel and SNP in C6605327 contig (Fig. 4).

The aim of this study was to identify the differences in the nucleotide sequence of the target gene (83.5 Kb), which is one of the candidate genes for the resistance trait of the CRb locus. Blast was performed on the de novo information of CR shinki, a resistant strain, and a total of 143 contigues were hit. Among them, polymorphism (InDel) was confirmed in C6605327 and C6416411. The primer CRb_048 (forward primer 5'-TGTACTAGATGGCAACGAGAAGAA-3 '(SEQ ID NO: 33) and reverse primer 5'-CAGTGGAGTAGACGTAGCTCATCA-3' (SEQ ID NO: 34)), which amplifies the portion containing InDel, was prepared and based on the nucleotide sequence information The predicted PCR amplicon size was 627 bp. CR shinki, gelria, siloga, 94sk, and chiifu were PCR tested with CRb_048 primer. Resistant strains CR shinki and gelria showed the lowest bands. Sensory lines 94SK and chiifu showed the above bands and showed polymorphism in amplicon size , And the resistance system and the susceptibility line were distinguished (Fig. 5).

PCR shinki 2 repeat, Gelria 2 repeat, and 94sk 1 repeat sequencing analysis were requested to Bionissa to obtain the amplified sequence of the PCR product. When each sequence is aligned, it can be confirmed that there are three insertions in the susceptibility line (94sk, chiifu) (Fig. 6). In addition, frequent SNPs were found in each resistant susceptible strain. In the case of the susceptible insertion, 29bp, 9bp and 16bp, respectively, were found. For the CRb_048 primer, the size of the prepared amplicon is 627 bp and the InDel is 54 bp. In this case, it is difficult to confirm with agarose gel, and it is necessary to perform the gel electrophoresis on PAGE. In order to solve this problem, an additional primer capable of performing agarose gel electrophoresis was designed using the nucleotide sequence in the amplicon. Two primer pairs were constructed and are shown in Table 3 as CRb_057 and CRb_065, respectively. In the case of CRb_057, the size was 350bp. Its position is shown in Fig. Resistant strains, CR shinki and Gelria, are shown at 300bp, and the susceptible strains, 94sk and chiifu, are 350bp larger than the resistant strain. In the case of 94sk, the band is amplified at a position of 300bp in a faint range other than 350bp (Fig. 8). CRb_065 was prepared to compensate for this.

Name of the primer (5 '- > 3') (SEQ ID NO: 5) Reverse direction (5 '- > 3') (SEQ ID NO: CRb_057 TGCGGTTTTCTTACAGAGTTAGG (35) TCTGTTCCCTGAAGAAAAATGG (36) CRb_065 TGACATTGTTGATGTGCTGA (37) AAATATGCCTTCAATTGCTTC (38)

Tests of CRb_057 for resistance to root apoptosis and susceptibility to germplasm showed that the band was identified in CR shinki and Gelria, which is known to have CRb, and amplified at other positions in Chiufu, 94sk (also known as susceptible) 9). This same result was obtained in CRb_065 (FIG. 10). Tests of CRb_065 for resistance to root apoptosis and germplasm revealed that the band was identified in CR shinki and Gelria, which is known to have CRb, and amplified at other positions in the susceptible Chiifu and 94sk 10 and 11). In case of CRb_065, the size is 202bp, and its position is as shown in FIG. 12A. 148bp in the case of the CR shinki and Gelia strains, 202bp in the case of the 94sk and Chiifu strains, and the distinction became clear, and the discrimination was easy in the agarose gel (Fig. 12B).

In addition, we aimed to identify one of the candidate genes for the resistance trait of CRb locus in the target region (83.5 Kb), bra012541. Blast was performed on the de novo information of the resistant strain CR shinki, resulting in a total of 65 contiguous hits, of which three polymorphisms (SNPs) were identified in C6162466. The primer CRb_060 (forward primer 5'-ATGACTTACTGCTTACAATGGGGA-3 '(SEQ ID NO: 39) and reverse primer 5'-CTGGCTCACCGTTTTGTACTTTA-3' (SEQ ID NO: 40)), which can be detected by HRM, And its position was as shown in FIG. 13A, and the PCR amplicon size predicted based on the nucleotide sequence information was 128 bp. CR shinki, gelria, siloga, 94sk and chiifu were PCR tested with CRb_048 primer. Resistant strains CR shinki and gelria showed the lowest bands, 94SK and chiifu showed the bands showed polymorphism in amplicon size, There is a distinction between the resistance system and the susceptibility line (data not provided). CR shinki, gelria, and 94sk, chiifu were not distinguished by default, but lowering the curve shift from 0.05 to 0.00 resulted in a difference between resistance and susceptibility, and heterotypes were also distinguishable. Resolution is very poor to differentiate between resistance and susceptibility. However, if you create a heterotypic band by mixing artificially mixed gDNA with resistance and susceptibility, analysis is easy.

In summary, the markers developed in the present invention are all markers capable of discriminating CRb, and CRb_003 and CRb_048 can be identified through PAGE migration. For CRb_057 and CRb_065, Agarose gel, CRb_065 and CRb_060 can be HRM analyzed (Table 4).

identification of loci Marker name Agarose gel PAGE HRM CRb CRa CRaki Crr1 CRb_003 + + - - - CRb_048 + + - - - CRb_057 + + - - - CRb_065 + + + - - - CRb_060 + +

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Specific primer set for discrimination of cabbage clubroot          disease-resistant cultivar and uses thereof <130> PN15348 <160> 40 <170> Kopatentin 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 atcacgaatt ctagttcgaa cacc 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 aatatgatag tcgaggacga acga 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gatgttgagc aaataaaacc gc 22 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gacataatac aaggtcaagc tccg 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 acgagaagac agagagacag tggt 24 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gatagaaacc accaccgata aaaac 25 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atttgtagga gtaacctcag ccaa 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aggagacatg gtctttcatg tgac 24 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 taaacgaact ctcaatcgaa ctcc 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ttctcgacgc tctaaggtga gtat 24 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 atttagtgaa tgcaggcaca tctc 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ttacccaatg gagaagacac tacc 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gtagggcagt taaataggac atgg 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 cttgcctaag ctacgacact ttct 24 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 agggtgggta gtaacctcct gtat 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tacttggaac gtacaacgag tcag 24 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 cgtacctatg ccacactcta gga 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 aagtaacttg gaggaatggg gtt 23 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 aaaaagcaat atcacggaac cc 22 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 cttcctaagg gtctttgtga gaag 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 tccttgacag ttccagctca taat 24 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ctccaaacgt aagactcctt tgac 24 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 aaatcttgga ggaacactga gatg 24 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 attgtcagcg acttacacat gaga 24 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 catttggaat agcgttaggg atag 24 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gaaacacttg atctgcatct tgc 23 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 atcacaatgt cttgaagaga accc 24 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 gtaaggtaac attatttgcc ggg 23 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 cccactccat attttactcc agaa 24 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 caaccccact tcatatttta ctcc 24 <210> 31 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 aaaaccccca cctatc 16 <210> 32 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 aaaaccccca cctatc 16 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 tgtactagat ggcaacgaga agaa 24 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 cagtggagta gacgtagctc atca 24 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 tgcggttttc ttacagagtt agg 23 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tctgttccct gaagaaaaat gg 22 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 tgacattgtt gatgtgctga 20 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 aaatatgcct tcaattgctt c 21 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 atgacttact gcttacaatg ggga 24 <210> 40 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 ctggctcacc gttttgtact tta 23

Claims (6)

An oligonucleotide primer set of SEQ ID NOS: 5 and 6; An oligonucleotide primer set of SEQ ID NOS: 33 and 34; Oligonucleotide primer sets of SEQ ID NOs: 35 and 36; An oligonucleotide primer set of SEQ ID NOS: 37 and 38; And a set of oligonucleotide primers of SEQ ID NOs: 39 and 40. A primer set for specifically identifying a cabbage root-knot disease resistant variety. delete An oligonucleotide primer set according to claim 1; And a reagent for carrying out an amplification reaction. &Lt; Desc / Clms Page number 19 &gt; 4. The kit according to claim 3, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. Separating the genomic DNA from the sample to be analyzed;
Amplifying the target sequence by performing amplification reaction using the separated genomic DNA as a template and using the oligonucleotide primer set according to claim 1; And
And detecting the amplification product. &Lt; Desc / Clms Page number 19 &gt; 6. The method of claim 5, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, HRM (High resolution melting) analysis, fluorescence measurement or phosphorescence measurement.

Images