KR102167788B1 - A primer set for discrimination of clubroot disease-resistant cultivar and idenditication method by using the same - Google Patents

Abstract

The present invention relates to a primer set for determining root-knot disease-resistant strains and a method for determining root-knot disease-resistant strains using the same, and when using the marker for root-knot disease-resistant variety identification according to the present application, since it can be applied to various cabbage materials, Varieties with disease resistance can be identified very effectively. Accordingly, the present invention can reduce the cost and manpower consumption for drug control, and promote stable Chinese cabbage production by selecting varieties that do not recur even when cultivated continuously.

Description

A primer set for discrimination of clubroot disease-resistant cultivar and idenditication method by using the same}

The present invention relates to a primer set for determining root-knot disease-resistant varieties, a kit including the same, and a method for determining root-knot disease-resistant strains using the primer set.

The above-ground part of a plant infected with root lump disease is sluggish compared to the case where it is not infected, and as the disease progresses, the symptoms of wilting become severe. The phenotype of infected plants in the early stages of growth shows a symptom of withering the leaves as a whole blue, and plants infected after the mid-growth period mainly show signs of wilting only the lower leaves or not very much. Roots of plants infected with pathogens are abnormally hypertrophy, forming several small or large irregular lumps. In the late growth stage, bacteria or other fungi invade the lump's wound, causing the root to rot. The dormant spores of root-knot pathogens present in the soil can survive for many years, and are transmitted by rainwater, irrigation water, dirt breeze, animals and farm equipment. Pathogens can easily occur in wet fields with more than 80% soil humidity, temperatures of 20 to 25℃, and acidic soils below 6.0. Root lump disease is a widespread incidence in cruciferous vegetables at home and abroad, and it is a pathogen that causes disruption in the supply of cabbage by frequently occurring in domestic cabbage cultivation regions. Cabbage root lump disease occurs in all seasons across the country, and as a result, the production of cabbage is reduced by 30-70%, which poses a great threat to stable production.

Plasmodiophora brassicae is a pathogen that specifically attacks cruciferous vegetables. A lump occurs due to excessively produced IAA (indole-3-acetic acid) in the roots due to the interaction between the pathogen and the host (Butcher et al. , 1976; Dekhuijzen and Overeem, 1971). Glucosinolate, which is specifically present in cruciferous vegetables, is finally converted to IAA by the enzymes myrosinase and nitrilase. Therefore, one of the causes of the onset of root lump disease has been regarded as a chemical factor in the body, and it was found that glucosinolate is deeply involved in the pathogenesis through an experiment on a model plant of Arabidopsis (Grsic-Rausch et al. ., 1999, 2000).

On the other hand, changes in the body content of individual glucosinolates during the onset of root lump disease in Chinese cabbage belonging to the cruciferous vegetable were analyzed, and indolic and aliphatic glucosinolate in the roots of cabbage after inoculation of pathogens. It was confirmed that the content of was excessively increased (Ludwig-Miiller et al., 1997). As a result of investigating the degree of incidence of Chinese cabbage cultivars with resistance and susceptibility to root lump disease and the variation of indolic and phenylglucinoleate content in the roots, glucobrassicin and gluconastertin ( gluconasturtiin) showed a positive correlation with the incidence of root nodules, and the content of 4-methoxy-glucobrassicin showed a negative correlation (Lee and Kim, 2010).

Methods of using chemicals, pesticides, and antagonists have been developed for the control of root lump disease (Datnoff et al., 1987; Cheah et al., 2000; Yeoung et al., 2003). However, because drugs must be controlled at each planting period, cost is required. It consumes a lot of money and manpower. In addition, the control effect is also effective only in the treated small plant, and there is a problem that the disease occurs again when cultivated continuously. Therefore, in the long term, it is necessary to develop varieties that are resistant to root lump disease. However, when the resistant varieties were grown continuously for three or more crops, the phenomenon of resistance collapse occurred. According to Yoshikawa (1981), in Japan, more than 50 Chinese cabbage varieties with resistance to root lump disease (CR, clubroot resistance) were grown and released in Japan using European fodder turnip. However, after cultivation of resistant Chinese cabbage varieties, root-knot germs that invade them appeared, causing the resistance of most CR varieties to collapse (Kuginuki et al., 1999; Tanaka et al., 1998). Therefore, it is necessary to develop a variety of breeding materials with different resistance genes and supply them to private companies in order to provide a stable annual supply of Chinese cabbage.

Various markers related to Crr1a, Crr2, CRb, CRa, Crr3, and CRc have been reported as the Chinese cabbage root lump disease marker. However, the marker is physically distant from the resistance gene, and there is a limitation that it cannot be applied to various Chinese cabbage materials. In addition, since the conventionally reported markers are not simple to use and require expensive equipment, they are limited to use in small farms or companies. Furthermore, there is a limitation that the already developed markers are not applied to certain breeding materials.

1. Butcher et al., 1976; Dekhuijzen and Overeem, 1971 2.Grsic-Rausch et al., 1999, 2000 3. Ludwig-Miiller et al., 1997 4. Datnoff et al., 1987; 5. Cheah et al., 2000; 6. Yeoung et al., 2003 7. Lee and Kim, 2010 8. Kuginuki et al., 1999 9. Tanaka et al., 1998

Accordingly, the main object of the present invention is to provide a primer set for identifying root-knot disease resistant varieties.

Another object of the present invention is to provide a method for determining root-knot disease resistant varieties using the primer set.

Another object of the present invention is to provide a root-knot disease-resistant variety identification kit comprising the primer set of the present invention.

According to one aspect of the present invention, the present invention provides a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2; And

It provides a primer set for discrimination of root lump disease resistant varieties, including any one or more primer sets selected from the group consisting of a primer set consisting of a nucleic acid sequence of SEQ ID NOs: 3 and 4.

In the primer set, the primer set is preferably a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4.

According to another aspect of the present invention, a) extracting genomic DNA from cruciferous vegetables to determine varieties;

b) using the genomic DNA treated with the restriction enzyme as a template, amplifying the DNA using a primer set; And

c) It provides a method for determining the root-knot disease resistant varieties, comprising the step of analyzing the amplified DNA product.

In the method of determining, the step of c) analyzing further includes the step of treating a restriction enzyme.

In the method of determining, the restriction enzyme is preferably Tag I.

In the method of determining, the cruciferous vegetables are cabbage, cabbage, radish, mustard, kale, broccoli, radish, rapeseed, mustard, cauliflower, Brussels sprout, field?牡?, bok choy, and It may be any one or more selected from the group consisting of turnips.

In the method of determining, the cruciferous vegetable is preferably Chinese cabbage.

In the method of determining, the primer set is a primer set consisting of the nucleic acid sequence of SEQ ID NO: 1 and 2; And

It may be any one or more primer sets selected from the group consisting of a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4.

In the method of discrimination, the primer set is preferably a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4.

In the method of discrimination, the analysis of the amplified product is preferably performed by a DNA chip, electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement method.

According to another aspect of the present invention, the present invention provides a root lump disease resistant variety identification kit comprising a reagent, DNA polymerase, dNTPs, and a buffer solution for PCR reaction by complementarily binding to a root lump disease resistance gene. .

In the discrimination kit, the agent capable of detecting by complementarily binding to the root lump disease resistance gene is preferably a primer set.

In the discrimination kit, the primer set is a primer set consisting of the nucleic acid sequence of SEQ ID NO: 1 and 2; And

It may be any one or more primer sets selected from the group consisting of a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4.

In the discrimination kit, the primer set is preferably a primer set composed of the nucleic acid sequences of SEQ ID NOs: 3 and 4.

In the discrimination kit, it is preferable that the restriction enzyme is Tag I.

In the case of using the marker for identifying root-knot disease-resistant varieties according to the present application, since it can be applied to various Chinese cabbage materials, it is possible to very effectively discriminate varieties with root-knot disease resistance. Accordingly, the present invention can reduce the cost and manpower consumption for drug control, and promote stable Chinese cabbage production by selecting varieties that do not recur even when cultivated continuously.

FIG. 1 is a schematic diagram schematically showing a method of developing a primer set for specifically discriminating resistant varieties of cabbage root lump disease Yeoncheon strain of the present invention through the GBS and GWAS method according to an embodiment of the present invention.
2 shows Manhattan plots visualizing the calculated p-value by performing association analysis using the incidence of inoculation of Yeoncheon strain as trait data in GWAS analysis according to an embodiment of the present invention.
3 is a polymerase chain reaction targeting 96 points of resistance, sensitivity, and moderate resistance resources using a pair of initial primers obtained through GWAS analysis according to an embodiment of the present invention, and then electrophoretic analysis is performed. It shows one result.
4 is a result of performing an electrophoretic analysis after polymerase chain reaction for 96 points of resistance, sensitivity, and moderate resistance resources using a primer prepared according to an embodiment of the present invention. It shows the result of checking what is possible.

Hereinafter, embodiments and embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those of ordinary skill in the art can easily implement them.

However, the present invention may be implemented in various different forms, and is not limited to the embodiments and examples described herein. In the drawings, parts not related to the description are omitted in order to clearly describe the present invention. Throughout the specification of the present invention, when a part "includes" a certain component, it means that other components may be further included rather than excluding other components unless otherwise stated.

The present invention provides a primer set consisting of a nucleic acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2 capable of amplifying by specifically binding to a root-knot disease-resistant gene to determine root-knot disease-resistant varieties; And a primer set consisting of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4;

The primer sets of the present invention are used as a primer set for amplifying DNA, particularly SNP related to root-knot disease resistance, and may preferably be a primer set composed of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4, but is limited thereto. It does not become. The primer consisting of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 is based on a primer set consisting of the nucleic acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2, redesigned to be suitable for use of restriction enzymes for determining the presence or absence of a resistance gene. As a primer set, it has the advantage of not only having high accuracy in determining root-knot disease-resistant varieties, but also being able to identify varieties with moderate resistance.

The primer of the present invention is a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be replicated, and may serve as an starting point for a synthetic product of a polymerase chain reaction. The length and sequence of the primers should be able to allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required. In addition, the primer sequence may include all of the sequences added, deleted, or substituted to the nucleic acid sequences of SEQ ID NOs: 1 to 4.

The primer set of the present invention is prepared to analyze the nucleotide sequence of the CAPS SNP marker band, and is used in a manner to check the presence or absence of the band on electrophoresis. Since the CAPS SNp marker is relatively insensitive to the amplification environment compared to other molecular markers and can easily read the results, it can be used as a more accurate and detailed primer set to determine the resistance gene of cruciferous vegetables.

The method for discriminating root-knot disease-resistant varieties of the present invention includes: a) extracting genomic DNA from cruciferous vegetables to determine varieties; b) using the extracted genomic DNA as a template, amplifying DNA using a primer set; And c) characterized in that it comprises the step of analyzing the amplified DNA product.

The method of extracting genomic DNA in step a) of the present invention may be performed by a conventional method known in the art, for example, CTAB (CetylTrimethylAmmonium Bromide) method, phenol/chloroform extraction method, SDS extraction method, etc. It is possible to use or commercially available DNA extraction kit (QIagen prep kit), but is not limited thereto.

The cruciferous vegetables that can be discriminated in step a) of the present invention are mustard plants of the dicotyledonous plant of the Papaveraceae family consisting of four petals, cabbage, cabbage, radish, mustard, kale, broccoli, radish, rapeseed, mustard , Cauliflower (cabbage), Brussels sprout, field?牡?, bok choy, turnip, etc., may be preferably, but may be cabbage, but is not limited thereto.

In step b) of the present invention, DNA amplification may be performed by PCR (Polymerase Chain Reaction). PCR may be performed using a PCR reaction mixture containing components known to be necessary for a PCR reaction in the art or using a commercially available kit. The PCR reaction mixture may contain genomic DNA extracted from cruciferous vegetables, a primer set of the present invention, an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water (H ₂ O), and the PCR buffer solution is Tris- HCl, MgCl ₂ , KCl, etc. may be included, but is not limited thereto.

A primer set consisting of the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 capable of specifically binding to and amplifying the root-knot resistance gene; And a primer set consisting of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4;

The primer sets of the present invention are used as a primer set for amplifying DNA, particularly SNP related to root-knot disease resistance, and may preferably be a primer set composed of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4, but is limited thereto. It does not become. The primer consisting of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 is based on a primer set consisting of the nucleic acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2, redesigned to be suitable for use of restriction enzymes for determining the presence or absence of a resistance gene. As a primer set, it has the advantage of not only having high accuracy in determining root-knot disease-resistant varieties, but also being able to identify varieties with moderate resistance.

The primer of the present invention is a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be replicated, and may serve as an starting point for a synthetic product of a polymerase chain reaction. The length and sequence of the primers should be able to allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required. In addition, the primer sequence may include all of the sequences added, deleted, or substituted to the nucleic acid sequences of SEQ ID NOs: 1 to 4.

The nucleotide sequence amplified in step b) of the present invention may be labeled with a detectable labeling material. For example, the labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but may not be limited thereto. Preferably, the labeling material may be Cy-5 or Cy-3. When amplifying the target sequence, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, when a radioactive material is used for labeling, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized, and the radioactive isotope may be incorporated into the amplification product to be radiolabeled. Alternatively, the amplification product may be visualized using a kit such as a silver dyeing kit (Bioneer, Daejeon, Korea), but is not limited thereto.

The step c) of the present invention may further include treating a restriction enzyme. The step of treatment with a restriction enzyme may be performed using a restriction enzyme reaction mixture containing components known to be necessary for a restriction enzyme treatment reaction in the art or using a commercially available kit. Preferably, the restriction enzyme may be Tag I, but any restriction enzyme capable of detecting a SNP specific for a root lump disease resistance gene may be included, and thus the restriction is not limited thereto.

Analysis of the DNA product amplified in step c) of the present invention can be performed by a conventional method known in the art, for example, electrophoresis such as gel electrophoresis and capillary electrophoresis, DNA chip, radioactivity measurement, It may be performed through fluorescence measurement or phosphorescence measurement, but is not limited thereto. For example, capillary electrophoresis may be performed to detect an amplification product, and may be performed using an ABi sequencer, but is not limited thereto. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. For example, 1 to 5%, preferably 1.5% agarose gel electrophoresis can be used. In addition, the fluorescence measurement method is to label Cy-5 or Cy-3 at the 5'-end of the primer and perform PCR, and the target sequence is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter. When the amplified DNA product is analyzed using gel electrophoresis, the amplified product is electrophoresed on an agarose gel or an acrylamide gel, and the band can be identified by ethidium bromide (EtBr), silver staining, etc. However, it is not limited thereto.

The kit for discriminating root-knot disease-resistant varieties of the present invention is characterized in that it comprises a detection agent, DNA polymerase, dNTPs, restriction enzymes, and a buffer solution for PCR reaction by complementarily binding to the root-knot disease resistance gene.

The agent capable of detecting by complementarily binding to the root lump disease resistance gene of the present invention may be a primer set, but is not limited thereto.

The primer set of the present invention comprises a primer set consisting of a nucleic acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2 capable of specifically binding to and amplifying a root-knot disease resistance gene; And a primer set consisting of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4;

The primer sets of the present invention are used as a primer set for amplifying DNA, particularly SNP related to root-knot disease resistance, and may preferably be a primer set composed of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4, but is limited thereto. It does not become. The primer consisting of the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 is based on a primer set consisting of the nucleic acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2, redesigned to be suitable for use of restriction enzymes for determining the presence or absence of a resistance gene. As a primer set, it has the advantage of not only having high accuracy in determining root-knot disease-resistant varieties, but also being able to identify varieties with moderate resistance.

The primer of the present invention is a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be replicated, and may serve as an starting point for a synthetic product of a polymerase chain reaction. The length and sequence of the primers should be able to allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required. In addition, the primer sequence may include all of the sequences added, deleted, or substituted to the nucleic acid sequences of SEQ ID NOs: 1 to 4.

The buffer solution for PCR reaction of the present invention has a composition commonly known in the art, and may include, for example, Tris-HCl, MgCl ₂ , KCl, etc., but is not limited thereto.

The kit of the present invention may further include known components required for electrophoresis to determine whether a PCR product is amplified.

Hereinafter, the present invention will be described in more detail through examples. Since these examples are for illustrative purposes only, the scope of the present invention is not to be construed as being limited by these examples.

<Example>

Example 1

Genomic DNA extraction from Chinese cabbage

In order to select plant materials for specific selection of cabbage root-knot strain-resistant cultivars, the cultivars grown from 2006 to 2016 held by the National Institute of Horticultural Science and Technology of the Rural Development Administration, Introduced resources were used. For the wide selection of various root-knot-resistance genes present in the cruciferous family, a total of 96 points, including 57 points of resources that are difficult to interpret with existing molecular markers, and 39 points of heterogeneous resources such as Korean native varieties, are scored. It was used for GWAS analysis.

Genotyping-by-squencing (GBS) analysis

A total of 96 plant materials were used for the GBS analysis, and the analysis was conducted at Seeders. After extracting genomic DNA, processing it with ApeKI restriction enzyme, a GBS library was constructed as follows using a standard protocol. Genomic DNA (100 ng/uL) of each 96 point plant material was treated with 3.6 U of ApeKI (New England Biolabs, Ipswitch, MA) at 75°C for about 4 hours (20 uL reaction volume), 200 U T4 DNA After attaching the adapter containing the barcode and the general adapter to the restriction enzyme-treated fragment using ligase, 96 samples were pooled and prepared. Pooled samples were cleaned up using QIAquick PCR Purification kit (Qiagen, Valencia, CA), and PCR was performed under the following conditions: 95°C for 2 minutes (one cycle), 95°C for 30 seconds (16 cycles), 62°C for 30 seconds, 68°C for 30 seconds, 68°C for 5 minutes. Quantification of the constructed GBS was measured using a high sensitivity DNA chip at an Agilent Tape station. DNA sequencing was performed using Illumina Hiseq 2000, and GBS sequencing data was subjected to a demultiplexing process in which sequences were separated for each sample using a barcode sequence before performing subsequent analysis. As a result, the final demultiplexed reads were 338,111,100. In the sequence file for each sample produced through the demultiplexing process of GBS data, barcode and adapter sequence were removed, and sequence quality trimming was performed. For adapter trimming, cutadapt (v.1.8.3) program was used, and for sequence quality trimming, DynamicTrim and LengthSort programs of SolexaQA (v.1.13) package were used.

Example 2

Selection and correction of CAPS SNP primers

Root-knot disease-resistant Yeoncheon strain inoculation incidence was used as trait data and converted into data usable for GWAS analysis, and then whole-length genetic association analysis (Genome-wide) using the GAPIT (v. 2.0) program with 20,540 SNP loci. Association Study, GWAS) was performed, and the results are shown in FIG. 2.

A preliminary experiment was conducted by selecting 9 types of primer sets and restriction enzymes through full-length genome association analysis. DNA sample construction was performed by selecting resistance (DS; 1.0) and sensitivity (DS; 5.0). Using the finally selected primer sets (SEQ ID NOs: 1 and 2), an applicability test was performed for 96 lines and additional resources. Here, using a device (Bioer, Life echo) 95 ℃; 3min, [95°C; 10sec, 60°C; 30sec, 72°C; 30sec] 35 cycles, 72°C; Under the PCR condition of 5min, the total voulme was added to 20 uL, 40ng template DNA, and 0.4uM primer were added, and PCR was performed using a commercial PCR premix (Onsol, Cat. No. OSP10030096). Thereafter, a 20uL PCR product, 5U TaqI restriction enzyme, and 1× reaction buffer were used, and the total volume was 30 uL, mixed with restriction enzyme, and reacted at 37°C for 2 hours or more. Then, the reaction product was subjected to electrophoresis on 1.5% agarose gel to confirm the band pattern.

In addition, in order to more clearly distinguish the CAPS markers, a primer set was re-created using the sensitive TaqI site (SEQ ID NOs: 3 and 4), and applicability assay was performed in the same manner as above.

Sequence number Primer name Base sequence target
(Resistance/Byeongseong Lee) One 23098226(F) TTCCTCCGCCGACGATTATG G/T 2 23098858(R) TTCCTCCGCCGACGATTATG 3 Bra016021(F) ATCGCATGAAGTTGGGAGCT 4 Bra016021(R) TTCTCTACACGGTGGTGCTTCT

Example 3

Confirmation using CAPS SNP primer

In order to confirm whether it is possible to select resistant resources/individuals by the CAPS SNP primer obtained in Example 2, the genotype was confirmed in the same manner as in Example 2 together with the identification of phenotypes in various species, The results are shown in FIGS. 3 and 4.

As shown in FIG. 3, as a result of analyzing all 96 points used for GWAS analysis using a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, GW163, which is not well amplified, among 15 points whose root lump disease phenotype is resistant It was confirmed that the results of phenotype and genotype were consistent in all of the 14 resources excepted. However, in the case of a resource showing a phenotype of moderate resistance, the pattern of genotype was not constant, and the pattern of resistance band was generally displayed. In addition, in the case of GW108, it showed a sensitivity band pattern. As a result of selecting and analyzing 23 points of resistance 11 points, moderate resistance 6 points, and susceptibility 6 points for further testing with the selected molecular markers, the phenotype and genotype results of resistance and sensitivity were almost identical.

As shown in FIG. 4, as a result of re-testing using the primer sets of SEQ ID NO: 3 and SEQ ID NO: 4, the distinction between phenotype and genotype related to root lump disease was confirmed. As a result of analyzing 96 samples with the finally developed molecular marker, the distinction between resistance and sensitivity became clear, and in the case of GW166, it was confirmed that a hetero-type band appeared. In addition, it was confirmed that the bands of resistance GW10, GW16, GW34, GW46, GW47, GW67 and the sensitivity of GW51, GW60, GW62, GW63, GW65, GW66 were clearly distinguished.

Furthermore, it was confirmed that the band patterns of resistance and sensitivity were clearly separated as a result of applying to not only the 9 resources used in the GWAS analysis, but also to the 7 root lump-resistant turnip resources newly sold from the Agricultural Genetic Resource Center. From these results, it can be seen that it can be used as a marker that can be used for a wide range of resources.

Through the above results, it was evaluated that the primer sets of SEQ ID NOs: 1 and 2 according to the present invention have a co-dominant band pattern of the corresponding molecular label, which has a high possibility of development as a molecular label and can be used for selection of resistant resources. In addition, with the CAPS SNP primers produced based on Bra016021 (SEQ ID NOs: 3 and 4), it was possible to separate resistance and pathogenic resources. In addition, the marker developed in the present invention can be used as a new marker in addition to the existing marker to select resources resistant to Yeoncheon strain.

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> primer set for discrimination of clubroot disease-resistant cultivar and idenditication method by using the same <130> 0 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial <400> 1 ttcctccgcc gacgattatg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial <400> 2 ttcctccgcc gacgattatg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial <400> 3 atcgcatgaa gttgggagct 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial <400> 4 ttctctacac ggtggtgctt ct 22

Claims (15)

A primer set consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2; And
A primer set for determining root lump disease resistant varieties comprising any one or more primer sets selected from the group consisting of a primer set consisting of a nucleic acid sequence of SEQ ID NO: 3 and 4.
The method of claim 1,
The primer set includes a primer set consisting of a nucleic acid sequence of SEQ ID NOs: 3 and 4, and a primer set for determining root lump disease resistant varieties.
a) extracting genomic DNA from cruciferous vegetables to identify varieties;
b) using the genomic DNA as a template, amplifying DNA using a primer set; And
c) analyzing the amplified DNA product,
The primer set includes a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2; And
Any one or more primer sets selected from the group consisting of a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4, the method for determining the root lump disease resistant variety.
The method of claim 3,
The c) analyzing step further comprises the step of treating a restriction enzyme, the method of determining the root lump disease resistant varieties.
The method of claim 4,
The restriction enzyme is TaqⅠ, the method of determining the root-knot disease resistant varieties.
The method of claim 3,
The cruciferous vegetable is one or more selected from the group consisting of cabbage, cabbage, radish, mustard, kale, broccoli, radish, rapeseed, mustard, cauliflower (cabbage), Brussels sprout, perilla, bok choy, and turnip. That, how to determine the root lump disease resistant varieties.
The method of claim 6,
The cruciferous vegetable is Chinese cabbage, how to determine the root lump disease resistant varieties.
delete The method of claim 3,
The primer set comprises a primer set consisting of the nucleic acid sequence of SEQ ID NOs: 3 and 4, a method for determining root lump disease resistant varieties.
The method of claim 3,
The analysis of the amplified product is performed by DNA chip, electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement method.
Includes a primer set, DNA polymerase, dNTPs, restriction enzymes, and buffer solutions for PCR reactions that can be detected by complementarily binding to a root-knot disease resistance gene.
The primer set includes a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2; And
Any one or more primer sets selected from the group consisting of a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4, root lump disease resistant variety identification kit.
delete delete The method of claim 11,
The primer set comprises a primer set consisting of the nucleic acid sequence of SEQ ID NO: 3 and 4, root lump disease resistant variety identification kit.
The method of claim 11,
The restriction enzyme is TaqⅠ, root lump disease resistant variety identification kit.

Images