KR102415534B1 - Molecular marker based on high-resolution genetic map for discriminating clubroot disease-resistant or sensitive cabbage cultivar and uses thereof - Google Patents

Abstract

The present invention relates to a molecular marker for distinguishing clubroot resistance or susceptible Chinese cabbage varieties based on a high-density genetic map of Chinese cabbage and uses thereof. The molecular marker of the present invention can accurately identify Chinese cabbage individuals exhibiting resistance or susceptibility to cabbage Chinese clubroot resistance so that Chinese cabbage varieties resistant to Chinese cabbage clubroot resistance are selected and grown at an early stage. Therefore, the molecular marker can be used very usefully to reduce the time, cost, and effort required for breeding.

Description

Molecular marker based on high-resolution genetic map for discriminating clubroot disease-resistant or sensitive cabbage cultivar and uses thereof

The present invention relates to a molecular marker for distinguishing root-knot-resistant or susceptible cabbage varieties based on a high-density genetic map of Chinese cabbage and its use.

Clubroot is a soil disease caused by the fungus Plasmodiophora brassicae , which causes great damage to cruciferous crops. Root-knot fungus ( P. brassicae ) is an active parasitic bacterium that is not cultivated in an artificial medium, and it occurs not only in Chinese cabbage, but also cabbage, radish, and broccoli, and causes great damage worldwide. Root-knot fungus forms countless dormant spores in diseased tissues (root-knot) and survives or overwinters in unfavorable environments. These dormant spores can survive in the soil for up to 15 years, so it is very difficult to control the root-knot disease. it's sick

In Korea, the occurrence of cabbage root nodules was first reported in Gyeonggi-do in 1928, and 30~70% of cabbages are damaged every year. Most of the Chinese cabbage varieties have race-specific resistance to the Chinese cabbage root-knot, so many seed companies are focusing on developing varieties that are resistant to all races of the Chinese cabbage root-knot.

Chromosomal maps based on molecular genetic methods enabled determination of relative distances between genes based on molecular marker positions and recombination rates. Furthermore, the construction of the molecular genetic map made it possible to discover map-based gene cloning, Quantitative Trait Loci (QTL), and predict the location of Marker Assisted Selection (MAS).

On the other hand, Korean Patent No. 1560736 discloses a 'Primer for diagnosing Chinese cabbage root-knot and its use' based on the TSA gene of Plasmodiophora brassicae , and Korean Patent No. 1815220 discloses four phenotypes for root-knot disease. Although a 'new method for discriminating the race of Chinese cabbage root-knot disease' is disclosed for a method of discriminating the race of the Chinese cabbage root-knot disease ( Plasmodiophora brassicae ) using the cabbage variety of There is no description of a molecular marker and its use for distinguishing a specific resistant or susceptible cabbage variety from Byeongbangrim.

The present invention was derived by the above request, and the present inventors used the 09CR500 line showing resistance to the cabbage root-knot disease Banglim pathotype and the 09CR501 line showing sensitivity, on chromosome 8 of Chinese cabbage. After confirming the QTL ( PbBrA08 ^Banglim ) related to Chinese cabbage root nodule resistance, fine-mapping was performed on the PbBrA08 ^Banglim QTL region between the 09CR. Candidate genes ( ORF1 , ORF2 and ORF3 ) associated with root nodule resistance were identified. In addition, five markers present on the ORF2 gene were developed, and the present invention was completed by confirming that the developed markers can accurately discriminate resistant or susceptible cabbage lines to root-knot disease.

In order to solve the above problems, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; oligonucleotide primer sets of SEQ ID NOs: 7 and 8; And oligonucleotide primer sets of SEQ ID NOs: 9 and 10; provides a primer set composition for discriminating a root-knot-resistant or susceptible Chinese cabbage, comprising one or more primer sets selected from the group consisting of.

In addition, the present invention provides a kit for discriminating a root-knot resistant or susceptible cabbage individual comprising the primer set composition.

In addition, the present invention comprises the steps of isolating genomic DNA from a cabbage sample; amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition; and detecting the product of the amplification step.

In addition, the present invention provides a Chinese cabbage-derived ORF2 gene comprising the nucleotide sequence of SEQ ID NO: 57, which increases the resistance of plants to root-knot disease.

In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57; and re-differentiating the transgenic plant from the transformed plant cells; provides a method for producing a transgenic plant having increased resistance to root-knot disease, comprising a.

In addition, the present invention provides a method for increasing the resistance to root-knot disease of a plant, comprising the step of transforming the plant cell with a recombinant vector comprising a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57.

In addition, the present invention provides a composition for increasing the resistance to root-knot disease of a plant comprising a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57.

Since the molecular marker of the present invention can accurately identify cabbage individuals showing resistance or sensitivity to cabbage root lump disease, it is possible to select and cultivate cabbage varieties resistant to cabbage root lump disease at an early stage, the time required for breeding; It is expected to be very useful in reducing cost and effort.

Figure 1 shows the severity (Disease Index) grade of cabbage root lump disease. 0: Asymptomatic, 1: Occurrence of weak bulge limited to lateral root, 2: Occurrence of a small number of small spherical lumps in lateral root, 3: Multiple small lumps in lateral root, 4: large lump and major root ( The occurrence of weak swelling of the main root), 5: The occurrence of large lumps on the main root, 6: The occurrence of severe lumps throughout the root and deformation of the root morphology.
Figure 2A shows the location of the PbBrA08 ^Banglim QTL and the markers (09CR.11755754 and 09CR.11390652) associated with the Chinese cabbage root lump resistance in association group A08 of the previously reported Chinese cabbage ( Brassica rapa ) association map, 2B is a result of performing fine-mapping for PbBrA08 ^Banglim QTL.
3 is a result of performing fine-mapping of PbBrA08 ^Banglim QTL related to Chinese cabbage root nodule resistance. P ₁ means that the Chinese cabbage root lump resistance allele is homozygous, P ₂ means that the Chinese cabbage root lump resistance allele is homozygous, and F ₁ means heterozygosity (resistance).
4 is a diagram showing the location of candidate genes ( ORF1 , ORF2 , ORF3 ) related to root-knot resistance after performing fine-mapping of PbBrA08 ^Banglim QTL (A) (B and C).
5 is a result of confirming the expression levels of root-knot resistance-related candidate genes ORF2 and ORF3 in the leaf and root tissues of the 09CR500 line showing resistance to the Chinese cabbage root-knot disease and the 09CR501 line showing sensitivity.
Figure 6A is a diagram showing the positions of the markers SH_852, SH_866, SH_868, SH_820 and SH_870 developed in the candidate gene ORF2 related to Chinese cabbage root knot resistance, and Figure 6B is two parental lines 09CR500 (resistance) and 09CR501 (resistance) and 09CR501 ( susceptibility), their F ₁ individuals (resistance) and Chiifu (susceptibility) are the results of performing PCR. In A, blue means the entire ORF2 gene, green means the CDS (coding sequence) region of the ORF2 gene, and purple means the PCR amplification region of the marker.
7 is a result of performing a universality test of the SH_866 marker. A is the result of analyzing the phenotype for the root-knot disease Bangrim pathogenic type. The vertical axis indicates the Disease Index (DI), and the horizontal axis indicates the sample ID. B shows the genotype in which the PbBrA08 ^Banglim locus exists, and the red and blue colors mean that the genotype of the marker is resistance and susceptibility, respectively.

In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; oligonucleotide primer sets of SEQ ID NOs: 7 and 8; And oligonucleotide primer sets of SEQ ID NOs: 9 and 10; provides a primer set composition for discriminating a root-knot-resistant or susceptible Chinese cabbage, comprising one or more primer sets selected from the group consisting of.

The primer set of the present invention preferably includes one or more primer sets selected from the group consisting of the five primer sets, and when the five primer sets are used at the same time, it is possible to more efficiently distinguish root-knot resistant or susceptible cabbage individuals. can

The primer may include an oligonucleotide consisting of a fragment of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NOs: 1 to 10, depending on the sequence length of each primer. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may include an oligonucleotide consisting of a fragment of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 1. . In addition, the primer may also include an addition, deletion or substitution of the nucleotide sequence of SEQ ID NOs: 1 to 10.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present invention, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included.

In the present invention, the root nodule may be caused by a Plasmodiophora brassicae pathogen, and preferably may be a Chinese cabbage root nodule caused by a local pathogen Banglim, but is not particularly limited thereto. doesn't happen

The present invention also provides a kit for discriminating a root-knot-resistant or susceptible cabbage containing the primer set composition.

In one embodiment of the present invention, the kit may further include a reagent for performing the amplification reaction, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs and a buffer, but not limited

In one embodiment of the present invention, the kit may further include a user guide describing optimal conditions for performing the reaction. The handbook is a printout explaining how to use the kit, eg, how to prepare reverse transcription buffer and PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

The present invention also

isolating genomic DNA from the Chinese cabbage sample;

amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition; and

Detecting the product of the amplification step; provides a method for discriminating a root-knot-resistant or sensitive cabbage individual, including.

In the method according to an embodiment of the present invention, the primer set composition is the same as described above.

The method of the present invention includes isolating genomic DNA from a Chinese cabbage sample. A method for isolating the genomic DNA may use a method known in the art, for example, the CTAB method may be used, or a Wizard prep kit (Promega) may be used. A target sequence may be amplified by using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set according to an embodiment of the present invention.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling material may be a material emitting fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer during amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution for labeling using a radioactive material, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radioactively labeled. The oligonucleotide primer set used to amplify the target sequence is the same as described above.

In one embodiment of the present invention, the method for distinguishing the root-knot resistant or susceptible cabbage individual comprises the step of detecting a product of the amplification step, and the detection of the product of the amplification step is a DNA chip, gel electrophoresis, capillary tube. It may be performed through electrophoresis, radiometric measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. Capillary electrophoresis may use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorometer. can do. In addition, in the radioactive measurement method, when performing PCR, a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation The radioactivity can be measured using a liquid scintillation counter.

In addition, in the method according to an embodiment of the present invention, when PCR is performed using the primer sets of SEQ ID NOs: 1 and 2 (SH_852 marker), 2,305 bp, the primer sets of SEQ ID NOs: 3 and 4 (SH_866 marker) 390 bp when PCR was performed using , 275 bp when PCR was performed using primer sets of SEQ ID NOs: 5 and 6 (SH_868 marker), and PCR using primer sets of SEQ ID NOs: 7 and 8 (SH_820 marker) 514 bp, when PCR was performed using the primer sets of SEQ ID NOs: 9 and 10 (SH_870 marker), if a single band with a size of 242 bp is shown, it can be determined as a root-knot resistant cabbage individual, and a single band is detected If not, it can be identified as a cabbage individual susceptible to root lump disease.

The present invention also provides a Chinese cabbage-derived ORF2 gene comprising the nucleotide sequence of SEQ ID NO: 57, which increases the resistance of plants to root-knot disease.

The ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57, which increases the resistance of plants to root-knot according to the present invention, is a newly discovered gene in the PbBrA08 ^Banglim region, which is a QTL resistant to root-knot caused by the Chinese cabbage root-knot Banglim strain. , Plasmodiophora brassicae was isolated from 09CR500 Chinese cabbage resistant to the Banglim pathogenic type, and susceptible to the Chinese cabbage reference genome (Chiifu) and the Banglim pathogenic type of Plasmodiophora brassicae . It is characterized by showing mutations in the base sequence and the 09CR501 cabbage showing .

Homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene comprises a nucleotide sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% sequence homology to the nucleotide sequence of SEQ ID NO: 57, respectively. may include The "% sequence homology" for a polynucleotide is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to (not including).

The present invention also provides a recombinant vector containing the ORF2 gene derived from Chinese cabbage.

The term “recombinant” refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, heterologous peptide or protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.

The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector." The term "expression vector" refers to a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expression of an operably linked coding sequence in a particular host organism.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.); It generally includes a ribosome binding site for initiation of translation and a transcription/translation termination sequence. When Escherichia coli is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthesis pathway, and the left-handed promoter of phage λ (pLλ promoter) can be used as regulatory regions.

On the other hand, vectors that can be used in the present invention include plasmids (eg, pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.) often used in the art, phage (eg, λgt4-λB) , λ-Charon, λΔz1, and M13) or viruses (eg, SV40, etc.).

On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno viral late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The recombinant vector of the present invention is preferably a plant expression vector.

A preferred example of a plant expression vector is a Ti-plasmid vector capable of transferring a part of itself, the so-called T-region, into a plant cell when present in a suitable host such as Agrobacterium tumefaciens . Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells, or protoplasts from which new plants can be produced that properly insert the hybrid DNA into the genome of the plant and have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce a gene according to the invention into a plant host include viral vectors such as those that can be derived from double-stranded plant viruses (eg CaMV) and single-stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous, especially when it is difficult to adequately transform a plant host.

The expression vector preferably comprises one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol There is a resistance gene, but is not limited thereto.

In the plant expression vector according to the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in a plant cell. A “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Constitutive promoters may be preferred in the present invention since the selection of transformants may be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the plant expression vector according to the present invention, as the terminator, a conventional terminator may be used, for example, nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacter The terminator of the octopine gene of Leum tumourfaciens, etc., but is not limited thereto.

The present invention also provides a host cell transformed with the recombinant vector of the present invention.

As a host cell capable of stably and continuously cloning and expressing the vector of the present invention, any host cell known in the art, including microalgae and microorganisms, may be used, for example, E. coli JM109, E. coli BL21, Bacillus genus strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis , B. thuringiensis , And Salmonella typhimurium ( Salmonella typhimurium ), Serratia marcescens ( Serratia marcescens ) and enterobacteriaceae and strains such as various Pseudomonas species.

In addition, when the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast (eg, S accharomyce cerevisiae ), insect cell, human cell (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS- 7, 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cells may be used, preferably plant cells.

The method of delivering the vector of the present invention into a host cell is, when the host cell is a prokaryotic cell, the CaCl ₂ method, the Hanhan method (Hanahan, D., J. Mol. Biol., 166:557-580 (1983)) and an electroporation method. In addition, when the host cell is a eukaryotic cell, the vector may be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. can

The present invention also

Transforming plant cells with a recombinant vector containing a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57; and

It provides a method for producing a transgenic plant having increased resistance to root nodules, including the step of re-differentiating the transgenic plant from the transformed plant cells.

Transformation of a plant refers to any method of transferring DNA into a plant. Such transformation methods need not necessarily have a period of regeneration and/or tissue culture. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include calcium/polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, particle bombardment (DNA or RNA-coated) of various plant elements, infiltration of plants or traits of mature pollen or vesicles In Agrobacterium tumefaciens mediated gene transfer by conversion (incomplete) infection by a virus, and the like can be appropriately selected. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particular preference is given to using the so-called binary vector technique as described in EP A 120 516 and US Pat. No. 4,940,838.

The method of the present invention comprises transforming a plant cell with a recombinant vector according to the present invention, wherein the transformation may be mediated by A. tumefiaciens . In addition, the method of the present invention comprises the step of redifferentiating a transgenic plant from the transformed plant cell. Any method known in the art may be used for a method of redifferentiating a transgenic plant from a transgenic plant cell.

A "plant cell" used for transformation of a plant may be any plant cell. A plant cell may be any form of cultured cell, cultured tissue, cultured organ or whole plant, preferably cultured cell, cultured tissue or cultured organ and more preferably cultured cell. "Plant tissue" refers to a tissue of a differentiated or undifferentiated plant, such as, but not limited to, fruits, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie, single cells, protoplasts. (protoplast), shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture state.

In one embodiment of the present invention, the plant may be a plant of the Cruciferae family, preferably Chinese cabbage, broccoli, cabbage, radish, mustard, radish, red radish, Chinese cabbage, bachelor radish, bok choy, rapeseed, cauliflower, kale (Ssam kale, kale for green juice), may be red radish, etc., and most preferably may be Chinese cabbage, but is not limited thereto.

The present invention also provides a method for increasing root nodule resistance of a plant, comprising transforming the plant cell with a recombinant vector comprising a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57.

The present invention also provides a composition for increasing root nodule resistance of plants, comprising the ORF2 gene derived from Chinese cabbage consisting of the nucleotide sequence of SEQ ID NO: 57. The composition of the present invention contains a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57 or a recombinant vector containing the gene as an active ingredient, and transforming plant cells with the gene or a recombinant vector containing the gene, It can increase the resistance of plants to root lumps.

Hereinafter, the present invention will be described in detail through examples. It should be noted that the specific examples and examples that follow are inclusive of some and not all embodiments of the invention. It is apparent that the content of the invention disclosed by the present specification is not limited to the specific embodiments described herein, and includes that those skilled in the art can implement variously. Accordingly, it should be understood that the content of the invention disclosed herein is not limited to the specific embodiments described herein, and modifications and other embodiments thereof are also included within the scope of the claims.

Materials and Methods

1. Plant material and phenotypic analysis

In a previous study (Int. J. Mol. Sci., 2020, 21, 4157), 09CR500 and 09CR501 specimens showing sensitivity (provided by a bio-breeding breeding company) were used to show resistance to Chinese cabbage root lump disease. The QTL region ( PbBrA08 ^Banglim ; 207,889-13,590,812 bp on A08 of the association map) was identified. For the selection of recombinant plants for fine-mapping of the QTL region, 2,986 F ₂ plants were subjected to genotyping and phenotype using two resistance trait-associated markers (InDel marker 09CR.11755754 and SNP marker 09CR.11390652). An evaluation was performed. A total of 22 recombinant plants in which recombination was confirmed between the InDel marker 09CR.11755754 and the SNP marker 09CR.11390652 were selected for fine-mapping.

After the development of the marker, 188 Brassica core-collection lines (Table 1) were used for universality validation for practical use. All plants were grown and tested in the Chungnam National University greenhouse.

188 Brassica core-collection systems Species Number Scientific name Genome Chinese cabbage 172 Brassica rapa ssp . pekinensis AA Pak choi 6 Brassica rapa ssp . chinensis AA Turnip 2 Brassica rapa ssp . rapa AA Yellow Sarson 2 Brassica rapa ssp . tricolaris AA Caixin 2 Brassica rapa ssp . parachinensis AA Komatsuna One Brassica rapa var . perviridis AA Mizuna One Brassica rapa ssp . nipposinica AA Wutacai One Brassica rapa ssp . narinosa AA Rutabaga One Brassica napus var . napobrassica AACC Total 188

2. Cabbage root-knot disease inoculation and symptom evaluation

Banglim is a local pathogen collected from a domestic area (Bangrim-myeon, Pyeongchang-gun, Gangwon-do) where a serious root-knot disease has occurred by a seed company BioBreeding Co., Korea. The cabbage was continuously infected.

Specifically, after preparing the spore suspension (2×10 ⁶ spores/ml) of the Bangrim pathogen, 5 ml of the spore suspension was inoculated into the 2 week-old seedlings by irrigation (soil injection). did The evaluation criteria for the degree of club formation were classified into a total of 7 scales shown in FIG. 1 , and resistance was evaluated when the average scale of plants was 2 or less.

To analyze the quantitative trait locus (QTL), the scale was converted into a disease index (Disease Index), and the disease index was calculated using the following formula.

Disease index=[(n ₁ +2n ₂ + … +6n ₆ )/N _T ×6]×100.

n ₁ to n ₆ represent the number of symptomatic plants for each scale, and N _T means the total number of plants used in the test.

2. Marker development and genotyping

09CR500 (resistance) genome sequencing was performed with 30-fold Illumina sequence coverage using the Illumina Genome Analyzer-IIx system and paired-ends method, and a reference assembly was generated using CLC Genomic Workbench v12.0.2 (CLC bio, USA). , Map saturation between the reference assembly ( B. rapa_sequence_v3.0) and adjacent markers of the PbBrA08 ^Banglim locus was performed according to the CLC Genomic Workbench v12.0.2 manual.

HRM primers were designed using CLC genomic workbench 12.0 with the following parameters (Table 2). primer product size range=80~200, primer GC clamp=2, 1, or undefined, primer max diff TM=3 or 4, primer min GC=30, primer max GC=60, primer product optimal TM=60, primer self any=4 or 5, primer max size=25 or undefined.

In addition, PCR was performed under the conditions of 94℃ 4 min → [94℃ 20 sec, 55~60℃ 20 sec, 72℃ 20 sec] (repeat 45 times) → 72℃ 7 min. Idaho Technologies, USA).

Primer set information of the present invention Marker ID Primer information (5' → 3') (SEQ ID NO:) physical position Forward sequence Reverse sequence SH_620 GCACCATTACAAGCAACA (11) GGTCGTCTTCTTCATCATCA (12) 11,398,602 SH_748 GGCTTTTGTACTTTCTGAG (13) TGTGGTGAGAAGCAGTAA (14) 11,494,371 SH_636 TCTGACGCCGGTTACTTT (15) GCTTTGGTTCGGTTTGTTT (16) 11,529,337 SH_680 ATCGACAAAGAAGTAAGGCA (17) AACAGTCTAGTGGCAAAC (18) 11,531,238 SH_752 CTTGTTAGACCTTGAAATAC (19) ACCTTACATAACTTTTACCC (20) 11,533,744 SH_758 ATTCGGTTTTAAGGTTGT (21) AATCGAAGCAAATATCCA (22) 11,544,797 SH_764 AATGATAATTTCGGTGGT (23) TGGAATAACTCAACTGCT (24) 11,553,709 SH_798 TTTGTCCTTATTTTCCTTG (25) GTGGAATTTCTTTTTAGTC (26) 11,571,921 SH_918 CCTCCCTTTATGTATCCCC (27) CCTTTATGCAACTCAAGCTC (28) 11,573,137 SH_922 TGCTCGCATCATCAGGAA (29) AAGCTCTGATGTGATGGAA (30) 11,573,772 SH_924 ATCAGAGCTTTTTGGACC (31) CGAGTCAGTCATCGATTT (32) 11,573,854 SH_852 GTGTAGCAAGATTAGTGAGA (1) AAAGAGTTACACGAGCGA (2) - SH_866 CTCTTTGCCACTCTCTTT (3) TGCAGGTTGTCTTTTTCG (4) - SH_868 GTACGGATGGTATTTCAG (5) GGGGAGAGAGAACAAGGA (6) - SH_820 ATACAGAGGAGCCCAAAA (7) ATGGCAGGAATAGGTAAGA (8) - SH_870 CCAAACCCTCCAACTACA (9) GCTCCAGACTACGATATG (10) - SH_930 GTGAATCGAACGCTGAGG (33) TGTTGCTGATAGTGGTGAGGG (34) - SH_812 GCCATCTATATCGTCCCT (35) CAACTCATGTTCTCCACAA (36) 11,579,889 SH_774 GCAGAAGACAAAACACAAGA (37) CCACGCCTATTTTTACACA (38) 11,581,442 SH_778 AAACAGAACATCGAGACC (39) TGCTTTTGTAGCTTCTTCC (40) 11,589,330 SH_648 GCTAGGAATGACAGAAGG (41) GCAGACTACTCAAACAACAA (42) 11,600,699 SH_654 GAAAGACGGGTACGCAAA (43) TCATCGAGGTTAGGCATT (44) 11,645,087 SH_656 ATCGGTTTGAGCTTTCTTG (45) TTAAATCTTGGTGGGCGT (46) 11,658,513 SH_658 ACGATAGTTCCTGCTGAT (47) ACAACCCCCGACTCTTTA (48) 11,673,816 SH_662 CCGTAAGTCAACGATTCCA (49) CAAGTCCCATACCCACCA (50) 11,718,035 SH_664 GGAAACCTCATCCTCCAC (51) TCGTACTTCTTCTTTGGGG (52) 11,722,479

3. Search for Candidate Genes Related to Cabbage Root Knot Resistance

PbBrA08 To predict candidate genes in the narrowed region through ^Banglim 's Fine-mapping, Brassica database (BRAD) version 3.0 (http://brassicadb.org/brad/) was used, and FGENESH (http:// Softberry.com; Salamov and Solovyev, 2000) predicted the position of the dominant candidate gene. And the domain of the candidate gene was confirmed through sequence analysis of the reference genome (Chiifu) through CLC genomic workbench 12.0.2 (CLC bio, Denmark) based on the Pfam database.

4. PCR analysis

For RT-PCR (reverse transcription PCR) and qRT-PCR (quantitative real-time PCR) analysis, total RNA was inoculated with 'Banglim', a Chinese cabbage root tuber, into two parental lines (09CR500 and 09CR501), and 1.5 hours After , 3 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 1 week and 2 weeks, leaf and root samples were collected and extracted using RNeasy plant Mini Kit (QIAGEN Inc., USA). For 1 μg total RNA, cDNA was synthesized using oligo-(dT) primer and TOPscript™ reverse transcriptase (Enzynomics Co., Korea). Using the cDNA as a template, qRT-PCR analysis (CFX96™ Real-Time System, Bio-Rad Co., USA) was performed using a gene-specific primer set (Table 3) and SYBR Green Supermix. Relative gene expression levels were calculated by the method of 2 ^-ΔΔCt , and all experiments were performed in triplicate.

Primer set information of the present invention Marker ID Primer information (5' → 3') (SEQ ID NO:) Target
ORF Forward sequence Reverse sequence SH_928 GTTTGCAGAGGCGAGAAGA (53) TTGGAGGGTTTGGCTGGA (54) ORF2 SH_936 ATAGTGAATCGAACGCTGAGG (55) GTTGCTGATAGTGGTGAGGC (56) ORF3

Example 1. Analysis of segregation pattern of Chinese cabbage root knot

To confirm the inheritance of PbBrA08 ^Banglim , 2,986 F ₂ plants were harvested. Plasmodiophora brassicae ( P. brassicae ) was tested with a forest pathogen. Of the two parental lines, 09CR500 showed resistance to forestation and 09CR501 showed sensitivity to forestation, and it was confirmed that the number of resistant and susceptible plants among F ₂ plants was 2,076 and 910, respectively (Table 4). In addition, 9 strains out of 188 Brassica core-collection strains included in F ₂ showed resistance to the Bangrim pathogen type, and the remaining 179 strains showed sensitivity (data not shown).

Genetic analysis of cabbage root lump disease plant materials Total no. phenotype of Resistance (R) Susceptible (S) 09CR500 10 10 0 09CR501 10 0 10 F ₂ population 2,986 2,076 910

Example 2. PbBrA08 ^Banglim Development of QTL-related markers

The QTL region ( PbBrA08 ^Banglim ; 207,889-13,590,812 bp on A08 of the association map) was identified using 09CR500 and 09CR501 showing resistance to Chinese cabbage root lump disease (provided by a bio-breeding breeding company) ( After Fig. 2A), 09CR.11755754 (physical position: 11,755,630) and 09CR.11390652 (physical position: 11,390,629) markers present in the PbBrA08 ^Banglim QTL region were combined with 09CR500 to saturate the gene map for the flanking region. Mutations between Chiifu were confirmed.

As a result, 3,186 single nucleotide variants (SNV), 210 multiple nucleotide variants (MNV), 364 deletions, 418 insertions and 26 substitutions in the region between markers 09CR.11755754 and 09CR.11390652 (substitution), a total of 4,204 mutations were identified (Table 5).

Analysis of mutations between 09CR500 and Chiifu Sample ID Number of each variation within flacking markers SNV MNY Deletion Insertion replacement Total 09CR500 3,186 210 364 418 26 4,204

Thereafter, a primer set capable of amplifying 94 InDel markers was designed for HRM analysis. Among the 94 primer sets, 41 (43.6%) of the primer sets amplified the predicted sequence, and it was confirmed that polymorphism was also observed in both parental lines and their F ₁ individuals (Table 6). Afterwards, 26 markers (Table 2) were selected from among the 41 InDel markers and the experiment was performed ( FIG. 2B ).

Marker information used to create associative maps Maker ID Type Plants source Number of makers Polymorphic rate (%) SH_618-924 InDel 09CR500, Chiifu 94 43.6

Example 3. PbBrA08 ^Banglim Fine-mapping analysis of QTL

PbBrA08 ^Banglim Fine-mapping of PbBrA08 ^Banglim was performed to select the most significant marker for Banglim root-knot resistance in the QTL region. First, a total of 22 recombinant plants (F ₂ ) were selected based on the genotyping results of specific markers (InDel marker 09CR.11755754 and SNP marker 09CR.11390652) (FIG. 3). Genotyping was performed on the selected 22 recombinant plants using newly developed markers (Table 2). Based on the results of genotyping using the newly developed markers, 22 recombinant plants were divided into 16 groups (G1-G16). ) were separated. The range of the target region was determined based on 22 recombinant plants divided into 16 groups (G1 to G16) according to each genotype.

Specifically, in the case of the P ₁ and F ₁ genotype at any marker position in FIG. 3 , resistance will be exhibited, and if the P ₂ genotype, it can be predicted to exhibit sensitivity. In addition, the phenotype described on the far left of FIG. 3 is a pathological test result, where 0 means resistance to root nodules, a larger number means sensitivity, and 6 means complete sensitivity. Therefore, it is possible to find a marker representing the genotype that can explain the pathological test result through fine-mapping.

Looking at G1 and G6~G16 showing the phenotype of root nodule resistance, it contains a fragment of the 09CR500 genome that gradually decreases in size from the 09CR.11390652 marker to the 09CR.11755754 marker, and the PbBrA08 ^Banglim QTL region is the 09CR.11390652 marker. was narrowed down to between the SH_930 markers.

Also, looking at G2~G5 showing the phenotype of root nodule susceptibility, since the 09CR500 genome fragment is included between the 09CR.11390652 marker and the SH_922 marker, the PbBrA08 ^Banglim QTL region is located between the 09CR.11390652 marker and the SH_922 marker. knew it wasn't.

Through the fine-mapping analysis, the PbBrA08 ^Banglim QTL was narrowed to the region between SH_852 and SH_930, and it was found that the narrowed region contained the SH_852, SH_866, SH_868, SH_820, SH_870 and SH_930 markers.

Example 4. Prediction and expression level analysis of candidate genes

Using SH_924, which explains the phenotype best in the fine-mapping results, to find out the structure of the genomic fragment in the vicinity of the resistant strain, BlastN analysis was performed using the resequencing data of 09CR500 using the CLC genomic workbench. It was confirmed that scaffold14322 had excellent homology with the BraA08g013480.3C gene (Table 7).

BLAST result Query sequence Hit E-value Score Identity (%) Gaps (%) BraA08g013480 Scaffold14322 0 2,778 96.58 0

The 1,518-3,183 bp region of the scaffold14322 (21,498 bp) overlapped with the 2nd and 3rd exons of the BraA08g013480.3C gene, which means that there is an insertion of 21 kb or more including ^PbBrA08 Banglim in 09CR500 .

In addition, through the FGENSH program (http://linux1.softberry.com/berry.phtml), three candidate genes related to root-knot resistance in Chinese cabbage 14322 were predicted, and the genes were named ORF1 , ORF2 and ORF3 , respectively. . ORF1 and ORF3 genes were expected to encode a Nodulin-like protein, and ORF2 gene to encode a TIR-NBS-LRR domain associated with disease resistance (Fig. 4 and Table 8).

Candidate gene information Gene ID Gene position (bp) ^a Results of BLAST ^b Start End ORF2 4,598 11,405 TIR-NBS-LRR domain ORF3 17,787 19,105 Nodulin-like ^a Region of scaffold14322
^b Gene functions were assigned according to the best match of the alignments against pfam databases (http://pfam.xfam.org/)

Among the three genes, the 2nd and 3rd exon portions of the ORF1 (BraA08g013480.3C) gene partially overlapped with the reference genome (Chiffu), but the ORF2 gene did not overlap with Chiifu.

The ORF2 gene was predicted to have a size of 6,808 bp (mRNA: 4,598 bp) and consist of 7 exons, and the ORF3 gene was predicted to have a size of 1,319 bp (mRNA: 366 bp) and consist of 3 exons.

In addition, as a result of PCR analysis of the expression levels of ORF2 and ORF3 genes in the roots and leaf tissues of both parental lines before and after inoculation of the Chinese cabbage root-knot bungnim strain, ORF2 and ORF3 in 09CR500 (resistance) compared to 09CR501 (susceptibility) It was confirmed that the expression level of the gene was significantly increased (FIG. 5). Among them, the structure of the ORF2 gene had a TIR-NBS-LRR structure reported to be involved in plant disease resistance.

It is known that the CR genes (CRa, Crr1a), which confer complete resistance to plant pathogens of Chinese cabbage, encode TIR-NBS-LRR, and the NBS-LRR type plant disease resistance gene is resistant to infection by various plant pathogens. Since it is known to be involved in regulation, in the present invention, the ORF2 gene was finally selected as a potential candidate gene for resistance to root nodules caused by the Bangrim pathogenic type.

Example 5. Molecular Marker Development and Root Knot Resistance Discriminant Analysis

Fine-mapping was performed on PbBrA08 ^Banglim QTL to select SH_852, SH_866, SH_868, SH_820, SH_870, and SH_930 markers as the most significant markers for root lump resistance. Among them, SH_852, SH_866, SH_868, SH_820 and SH_870 markers were It was constructed to target the TIR-NBS-LRR domain of ORF2 (FIG. 6A), and the SH_930 marker was constructed to target ORF3.

Thereafter, each of the SH_852, SH_866, SH_868, SH_820 and SH_870 markers (Table 2) targeting the ORF2 gene finally selected as a potential gene for resistance to root lump disease was used to resist the Chinese cabbage root lump disease (R, 09CR500) , PCR was performed on susceptible individuals (S, 09CR501; and Chiifu) and resistant heterozygotes (H, 09CR F ₁ ). In previous studies, the resistance trait to the Bangrim pathogenic type of Chinese cabbage root-knot was single-factor dominance through genetic analysis, so F ₁ plants showed resistance to root-knot disease.

As a result of PCR, it was confirmed that a band was detected only in resistant individuals (R and H), and no band was detected in susceptible individuals (S and chiifu) (FIG. 6B). Through this, it was found that the molecular marker of the present invention can accurately discriminate resistant or susceptible cabbage root nodules.

In addition, 187 Brassica core-collection lines (Table 1) were utilized for universality validation (validation) for the practical use of the SH_866 marker among the five markers. As a result of the assay, only 9 lines showed resistance, while the remaining 178 plants showed sensitivity including two intermediate resistant lines (DI: 13 and 25) (FIG. 7).

As a result of genotype evaluation of 187 Brassica core-collection lines, 7 resistant lines were consistent with phenotypic and genotype data. Of the 178 susceptible lines, the phenotypes of 177 lines were matched by the susceptibility genotype except for CSR_098 (DI: 25) and CSR_045 (DI: 37.5). That is, the SH_866 marker of the present invention has a phenotype and a genotype of about 98.4%, so that it is possible to accurately discriminate the resistant and susceptible strains to root nodules (Table 9).

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Molecular marker based on high-resolution genetic map for discriminating clubroot disease-resistant or sensitive cabbage cultivar and uses thereof <130> PN21452 <160> 57 <170 > KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gtgtagcaag attagtgaga 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 aaagagttac acgagcga 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctctttgcca ctctcttt 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgcaggttgt ctttttcg 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gtacggatgg tatttcag 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ggggagagag aacaagga 18 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atacagagga gcccaaaa 18 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 atggcaggaa taggtaaga 19 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220 > <223> primer <400> 9 ccaaaccctc caactaca 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gctccagact acgatatg 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gcaccattac aagcaaca 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ggtcgtcttc ttcatcatca 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ggcttttgta ctttctgag 19 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tgtggtgaga agcagtaa 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tctgacgccg gttacttt 18 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gctttggttc ggtttgttt 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 atcgacaaag aagtaaggca 20 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 aacagtctag tggcaaac 18 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cttgttagac cttgaaatac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 accttacata acttttaccc 20 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 attcggtttt aaggttgt 18 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 aatcgaagca aatatcca 18 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence < 220> <223> primer <400> 23 aatgataatt tcggtggt 18 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tggaataact caactgct 18 <210> 25 <211 > 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 tttgtcctta ttttccttg 19 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer < 400> 26 gtggaatttc tttttagtc 19 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 cctcccttta tgtatcccc 19 <210> 28 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> primer <400> 28 cctttatgca actcaagctc 20 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tgctcgcatc atcaggaa 18 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 aagctctgat gtgatggaa 19 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 atcagagctt tttggacc 18 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 cgagtcagtc atcgattt 18 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gtgaatcgaa cgctgagg 18 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220 > <223> primer <400> 34 tgttgctgat agtggtgagg 20 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gccatctata tcgtccct 18 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 caactcatgt tctccacaa 19 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 37 gcagaagaca aaacacaaga 20 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 ccacgcctat ttttacaca 19 <210> 39 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 aaacagaaca tcgagacc 18 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 40 tgcttttgta gcttcttcc 19 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 gctaggaatg acagaagg 18 <210> 42 <211> 20 <212> DNA <213 > Artificial Sequence <220> <223> primer <400> 42 gcagactact caaacaacaa 20 <210> 43 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 gaaagacggg tacgcaaa 18 <210 > 44 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 tcatcgaggt taggcatt 18 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> < 223> primer <400> 45 atcggtttga gctttcttg 19 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 ttaaatcttg gtgggcgt 18 <210> 47 <211> 18 < 212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 acgatagttc ctgctgat 18 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 acaacccccg actcttta 18 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 ccgtaagtca acgattcca 19 <210> 50 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 caagtcccat acccacca 18 <210> 51 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 ggaaacctca tcctccac 18 <210> 52 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 tcgtacttct tctttgggg 19 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence < 220> <223> primer <400> 53 gtttgcagag gcgagaaga 19 <210> 54 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 ttggagggtt tggctgga 18 <210> 55 <211 > 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 atagtgaatc gaacgctgag g 21 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 gttgctgata gtggtgaggc 20 <210> 57 <211> 6602 <212> DNA <213> Brassica rapa <400> 57 atggaggaag actttgtcag aagacttgaa gtccagacga cttttagga a gtccagacga 60 cttccaggaa gtccagacga ctttcaggaa gtccagacga ctttcaggaa gtccagatga 120 ctgaagtgga agtagtctag aagacttcct ggaagtcgtt tagtgcatta tattttagac 180 gactaatagg taagtcgtcc cagaagtctt tcagatctga aaaatctgca tatcaaatcc 240 agatctgaaa attctgcata tccaaaaacg ttgaaatggc ttaaaaacag aaaaaatgag 300 tggaagatta gatcaatata cttttataga acacacaaaa atacatatct aaaattaata 360 gatctacctt taaatgagtg gaagatgagt atcatctgat taaaaacctg taaaaaagat 420 agattagtaa aaaagacatg agacaaaact gaaaaattca tataaagttt ggtgttttta 480 agtcaaagag attatagtgg gtttggagag ttttagtttc aaaaacttta tacaacaaga 540 agttaccaaa tgaagaaaaa tcagacataa aaacttacca aaacactcag atctattatg 600 aaagggagac ttcgtcagaa gacttccatg aagttcagat gacttccaag aagtccagac 660 gacttcgaag tcgtctggac ttcttggaag tcatctggac ttcaaatcca gatctgaaaa 720 acctgcatat ccaaaaacgt tgaaatgact taaaaataga gaaaatgagt ggaagattag 780 aaaaaatcta catttataga acgcataaaa atacatatct aaaattaata gatctacctt 840 taaattagtg gaagaggagt accatctgat aaaaacctgt aaaagagata gattagtaag 900 aaat acatga gacaaaactg aaaattcata taaagtttgg tgttttcaag tcaaatagat 960 tagagagagg ttgaagagtt ttagaatgat gaacattaca tttttgttgc agccatttga 1020 aaggaggaga gagaatgtgt aaatttttct ttatataggg agacagaaaa tccaattagg 1080 ttaaatattt ttgattcaga cgactttcta gacgacttac ttgtaagtcg tccagaagag 1140 tttaatattt taatgggaaa ttaaaatatt tttagcggga aactaaaata gaagacttaa 1200 attatttaag cgggaaaata atttttttta aaaattttag gcgggaatat ttggacgact 1260 tacatgtaag tcgtctattt taatttcttt actagacgac tgaaatgtaa gtcgtctaca 1320 ccctaaacat aacccccaaa attaattaac taactaaaca cttcataaaa tcaaattaaa 1380 cttcaaaagt gtttactata cacaaaaata aacacgtata ggtaaaaaat tattttttca 1440 aataaacatt caaactttcc aaaatctaac cctaagaata catacaatac tacaacatat 1500 gttgccaaac cttagaccaa agaatacgat gattcactac ctacactcat ctatgttgaa 1560 aacaattcaa ttttgttata ttttaattta tattacttaa aggtgtttat aattacatga 1620 ttttaatttt tcgattatca aaatattttt tttaaatttt aaaaattatt tctaagatca 1680 gctacactag gagacttact ttgaagttgt ccagacgact ttcaacatct cagactgact 1740 cagacgactt agtagggtta tactcgtaaa aatagcttct gtttttttgt ttggtcacaa 1800 ggtgctgtgc tgtaatttca gaaagctttt atgttagttt tgtgtttgat tcaagtttgg 1860 gtatagattt gaggttaaag tcaagttgtg gattaatttt ggcaaatttc cctcgtctat 1920 tttgcagcta cttgagtccc aggaaccggt aatcatcact ggagctgcgt taggaggatc 1980 tgtcgcatct ctctttacac tatggctcct agaagcagtc gatcgaagac taaaacgccc 2040 cttgtgcatc acatttggat cgcctttaat cggagacgct gctctccagc agattctaca 2100 acattctgtg atgaactcat gtttccttca cgtggttgac gctgcacaaa gtcccatcac 2160 cgaagatttg ttcaaacctt ttggaatgtt cttgatctgt tttggctcag aatgtatttg 2220 catcgatgac cccgaggctg tactggagtt gcttaacggt gttgacacgg atctagtggg 2280 ctggactgac tatggggaag ttataaagcg cctgcgttat tcctcaatgg cggcgtcgag 2340 tctgatgatt gatgatacta ttatcgatcg aatggaggga cgtgcacgga aaaagaagct 2400 gcgatttgat ctgcttaaaa aactaaacga cataaagata gggatgatat atcttgacag 2460 ttacgtaaag caaagcaaga aatcgaagat atgttcctac gattgcttca agacccaaac 2520 catttttccg tattcacagt ttagaaatga gctaaacgat ttctttaaat cagtggtgga 2580 agaaatagag aatatg ccac ggaaggaaaa gtcggcgctc aagacaagga gtctattcgc 2640 tgggaacaat tacagacggc tggtggaacc gttcgatatt gctgaacact acctcagcgg 2700 tcggaaagag taccgtacca cggggaggtc tcgccactac gttatgctcg agaaatggct 2760 taacgaatta ttttataaat cgtatagtac tcatagaccg gggaaagatc tgagtgatct 2820 aataacggtt gattcttgtt tctgggccga agttgaggaa gctatcattg taatcaattt 2880 gctgaaaaca aacgtgggga tgaaacacga ggaattgata ggaaaactcg tgaggtttga 2940 ggaatacgtg tgggagatga tcttaaaaag tgaagtttca ccagaaattt tcttggagaa 3000 aagcagtttt atgaggtggt ggaaagagta caaagagatc aaaggaagat atgggtttaa 3060 ctcttcaccg tcacccttca cgaagtttat gaactctgag atgtacaaga attacggtta 3120 gtaaaaagtt gttaaattgt tcatattgac ttgatggatg attgttatta tatatttaca 3180 atgaagtagt actttttttt aaatcaaatt tcgttaccaa tttataggtt tgcccttcac 3240 gaaagataac attgatgatt tggaaacggc accaaggccc ggtcatagac tgaatacttt 3300 caaggaggag gagggccagg aggtctgttt gaaagttaga gatgattatt tgcaggttgt 3360 ctttttcgaa tttcatgtac ttgactatga caaaaccccg gacgaaaaat ctaaggccct 3420 taacacaatt tctaagatct c aggtaactt tttttgttat tccactggca gtctgccgtt 3480 ttttctttta aagtccctta caacttataa ctgattcttg atataagctt tcacgggttg 3540 ttttaacgtt ccattgtata ttgttttcgt gtttaggagt ctttcctaca gtggaatggt 3600 tcgaggagac taagttgatt gtatttgcga cgatggatcc aatagagaca gtggaaaagc 3660 tgggaaaata ctggaacgcc gaaattgtta atgtttggcg cagtaagaaa gccaagccaa 3720 ataaagagag tggcaaagag caatcggaga aacaagttga agtgagtgtt aaaaccaaag 3780 aaatcaagga cgggaggagt gttttgtcag gttcagggtg catcattgca accgttagag 3840 gcaaatccac agatacagct ctcagcatga ggaatcctaa cgatgactgg tcctccttct 3900 gcgagttcct tagcacccac cagcctccac tgaatctctc tgagtgcaga gcggaaaacg 3960 ttattgattt tctccgcatg cagcaggctt caggcgacgt ggaggccctt gctggccacc 4020 tcagtgccat gtgtgaggcg tacgatataa aactgaagga aaatcctttc cacagcctag 4080 ctgtaacccg atacgttgaa gaggtgacta gagaatcaca atgcatattg atcttttacg 4140 acagccatga tgtggacgag ccacatttca tggaaaccat cttaaaagag ttacacgagc 4200 gacaactcac acctctgacg tataatctat cggggagaga gaacaaggac acagagttac 4260 tagacaggtc tagtgttggt attgtag tgc tttcaaatag ctactcttgt tctagtgagt 4320 ccctagctta tctggtggca atcatggaac attggcaagc agaaaaattc gtaaccactc 4380 ctgtacattt tagagtaaca ctatcagaca ccgggctgga agaagtacag acgcagtgtc 4440 tgaatcctat ccaggcagac agagttcaga attggaaggc ggctatggct gaaataccat 4500 ccgtacatgg acatggatgg acaaaagggt aaattaactt ctcttcacta ggaaatatcc 4560 aatgcgctta tattaacaac ttttgtttct tgcaggactc aggttatgct tgccaaggaa 4620 gttgtaagaa acacatgttt aaggctagac ttgaagaaat acacgaatct ggccagaacc 4680 gtagcatata taaaaaacct caaaccttcc gacgtggaaa ttgtaggact ctggggtatg 4740 gcaggaatag gtaagacatc cattgctcga gagatttatg gacttctagc tccagactac 4800 gatatgtgtt actttctgca agacttttat ctaacgtgtc aaaagaaagg gatgatgcaa 4860 atgcgtgatg atttcttatc taaagtattt agggaagaaa aactaagtat aagcgcttgt 4920 gatataaaac caagtttcat gaggcactgg ttccacagta aaaaaattct tcttgttctc 4980 gatgacgtga gcaacgccag cgatgcagaa gctgtagttg gagggtttgg ctggatctct 5040 catggacaca gaatcatctt aacctctagg cggaaacaag ttcttgtaca gtgcaaggtt 5100 caagagccgt acgagattcg aagattgtgc ca gtttgaat cttctcgcct ctgcaaacaa 5160 tatttgaatg gagaaagtga agtcatcaaa gagcttgtga gctgcagtag tggtattcca 5220 ttgtctctcg aagttttggg ctcctctgta tcaaagcagc gtataaaaga catgaagaag 5280 catctccaaa gcttgcggag aaatcctcca actcagattc aggaaacatt ccggagaagc 5340 tttgatgggc tagatggaaa ccaaaagaac atatttttgg accttgcatg ttttttcagt 5400 ggggagaaca aagatcacgt ggtgcagtta cttgatgctt gcgggtttct tactaatttg 5460 ggaatttgtg atcttataga cgagtctctc attactcttg tggacaatgc gatagagatg 5520 cctattcctt tccaagattt tggtcgattt attgttcttg aagaagacga ggatccatgc 5580 gagcgtagca gattgtggga ctctgacgac attactaatg tattgacaaa aaattcagta 5640 agttaaaatg tgtttagttc tttttaacac tccagataac ttcataatca tcctttctga 5700 tgttacccta ccaataatgt gctttttctt ggtcagggaa cagaagcaat tgaaggaatc 5760 ttcctggatg cgtctgactt gacctgtgaa aactttatca agttgagtcg tactgtgttt 5820 gataacatgt atggacttag attgctgaag ttctatgatt ccacctcttg gaaccagtgc 5880 aagctaagtc tacctgacgg ccttgacacg ttacccgatg agctaaggct acttcactgg 5940 gagcattacc ctctggaata cttgcctcac gaatttat tc cggagaatct tgtcgagtta 6000 aacatgccat atagcaacat ggagaagctc tgggaagaga agaaagtaag tgctgacatt 6060 atgctatatt acatgaattt ataaaacatg catctgatgt tggttatcga cgttgtaaac 6120 agaatctcaa gaagctaaag aaaatcagac tgagtcactc acgaaaatta actgatattc 6180 tgatgttatc agaagccctg aaccttgagg atattgatct cgaaggatgt actagtctag 6240 ttgacattag cacgtccatt cctcgttatg ggaagcttgt tactttgaat atgaaagact 6300 gttctggctt gcggactttg ccagccatga tggttgattt gacttctctc aagcttctaa 6360 atttgtctgg ctgctcagag ctcgatgagg ttcaggattt tgcacctaac ttgaaagagt 6420 tatatctagc tgggacagct ataagagagc ttccattgtc aacagagaat ctcactaatc 6480 ttgctacact agatctggaa aactgcagta ggcttcagca actgccatactc 540 tattcat actgcttagtc acctcat 66 acta

Claims (8)

oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; oligonucleotide primer sets of SEQ ID NOs: 7 and 8; and oligonucleotide primer sets of SEQ ID NOs: 9 and 10; A primer set composition for discriminating against root-knot resistance or susceptible Chinese cabbage. A kit for discriminating against root-knot resistance or susceptible cabbage individuals, comprising the primer set composition of claim 1. isolating genomic DNA from the Chinese cabbage sample;
amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition of claim 1; and
Detecting the product of the amplification step; A method of discriminating a root-knot resistant or sensitive cabbage individual, including. The method according to claim 3, wherein the detection of the product of the amplification step is performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement or phosphorescence measurement. ORF2 gene derived from Chinese cabbage, which consists of the nucleotide sequence of SEQ ID NO: 57, and increases the resistance of plants to root-knot disease. Transforming plant cells with a recombinant vector containing a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57; and
Re-differentiation of the transgenic plant from the transformed plant cells; A method for producing a transgenic plant having increased resistance to root nodules, comprising a. A method of increasing root nodule resistance of plants, comprising transforming plant cells with a recombinant vector comprising a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57. A composition for increasing the resistance to root-knot disease of a plant comprising a Chinese cabbage-derived ORF2 gene consisting of the nucleotide sequence of SEQ ID NO: 57.

Images