KR101483595B1 - SNP Maker for identifying of clubroot resistance in Cabbage and uses thereof - Google Patents

Abstract

The present invention examines the possibility of application of the disease resistance-associated SNP primer of cabbage to other cabbages, and provides a SNP molecular marker capable of efficiently evaluating resistance to cabbage root rot and its use.

Description

SNP markers for identifying resistant varieties of cabbage roots and their uses BACKGROUND ART [0002]

The present invention examines the possibility of application of the disease resistance-associated SNP primer of cabbage to other cabbages, and provides a SNP molecular marker capable of efficiently evaluating resistance to cabbage root rot and its use.

Cabbage ( Brassica oleracea ), Chinese cabbage ( Brassica There is rapa . glabra Regel ), Rapeseed ( Brassica napus ) and most of the cabbage and crops are suffering greatly from the root disease. The clubroot disease is caused by Plasmodioophora brasicae WORON. Plasmodioophora brasicae WORON., A kind of absolute parasite that can only multiply in living plants. Plants infected with P. brassicae , a soil infectious parasitic strain, are eliminated from the roots and the hairs are formed in the main roots, inhibiting nutrients and moisture absorption, and inhibiting growth. P. brassicae was recorded for the first time by Woronin in Russia in 1878, and later records of root canal disease were found in many countries around the world (Karling, JS 1968. 2nd ed. Hafner, New York. (Ikegami, H., Ito, T., Imuro, Y. and Naiki, T. 1981. In: Chinese Cabbage, ed. By NS Talekar and TD Griggs, pp. 81-90. , Taiwan.). It is now one of the most serious diseases of cabbage and crops worldwide.

The root germs occur in almost all cabbages and crops, and they are not only diverse but also form numerous dormant spores in diseased tissues. These spores can survive for up to 15 years in the soil, making them very difficult to control Mattush, P. 1977. pp. 22-28, University of Wisconsin, Madison, Wis., USA). It has been known that the control of the pH of the soil or the control of crops such as rotting of crops and crops rather than crops, but it is difficult to apply due to economical reasons and biological control methods using antagonistic microorganisms. It is difficult to use because of low effect. In addition, the use of synthetic disinfectants for controlling root canal disease is costly, has a short period of control effect, and is limited in use due to environmental toxicity concerns (Cheah, LH, Veerakone, S. and Kent, G. 2000. Plant Protection 53: 18-21 .; Yoshikawa, H. 1983. Jpn Agr Res. Quart. 17: 6-11.). Therefore, today, resistant cultivars that can be used in environmentally friendly agriculture are also required for the control of root canal disease. In addition, in order to cultivate resistant cultivars, it takes much time, such as separation of pathogens, measurement of dormant spore concentration, artificial inoculation and evaluation, and it is costly, and it is difficult to select an accurate disease-resistant individual due to variation in environment.

B. The rapeseed cabbage ( B. rapa subsp . The plant pathogen-resistant varieties of pekinensis were developed by introducing the resistance gene of European fodder turnip (Yoshikawa, H. 1993. Plants Tea Japan, Ser. A 7: 1-165 .; Hirai, M. 2006. Breed Sci. 56: 223-229.). And the cabbage resistance gene is known to have a mono-dominant dominance (James, RV and Williams, PH 1980. Phytopathology 70: 776-779 .; Kuginuki, Y., Yoshikawa, H. and Hirai, M. 1999. Eur. J Plant Pathol 105: 327-332 .; Yoshikawa, H. 1993. Plants Tea Japan, Ser 7: 1-165.). On the other hand, only few varieties of cabbage ( B. oleracea ) have been developed and used in Japan (Baggett, JR and Kean, D. 1985. HortScience 20: 784-785). Several B. oleracea resistant genetic resources have been reported, but these resistances are known to be multifactorial rather than single factor in classical genetic analysis and molecular marker analysis (Figdore, SS, Ferreira, ME, Slocum, MK and Williams, PH 1993. Euphytica 69: 33-44 .; Grandclement, C. and Thomas, G. 1996. Theor. Appl. Genet. 93: 86-90 .; Landry, BS, Hubert, N., Crete, R. , Chiang, MS, Lincoln, SE and Etoh, T. 1992. Genome 35: 409-420 .; Moriguchi, K., Kimizuka-Takagi, C., Ishii, K. and Nomura, K. 1999. Breed Sci. 48: 257-265 .; Nomura, K., Minegishi, Y., Kimizuka-Takagi, C., Fujioka, T., Moriguchi, K., Shishido, R. and Ikehashi, H. 2005. Plant Breed 124: Bibliot, S., Barbeyron, G., Thomas, G. and Manzanares-Dauleux, MJ 2004. Theor., Appl. Genet., 108: 371-375 .; Rocherieux, J., Glory, P., Giboulot, 1555-1563 .; Voorrips, RE, Jongerius, MC and Kanne, HJ 1997. Theor. Appl. Genet. 94: 75-82.). However, a major gene such as the QTL gene pb-3, which can account for about 54% resistance, is present. Unfortunately, no specific primers or RFLP markers were available to test them. As described above, the pathogen-resistant cabbage is a quantitative resistance involving two or more genes, and information on the resistance gene is still lacking, and the development of resistant varieties is delayed (Hirai, 2006). Therefore, this effort to identify resistance research and new materials resistant six kinds of cabbage (B. oleracae) for P. brassicae is required.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide a method for evaluating the applicability of disease resistance-associated SNP primers of Chinese cabbage to cabbage, and to provide a SNP molecular marker capable of efficiently evaluating resistance to cabbage root disease It is intended to provide use.

In order to solve the above-described problems, one aspect of the present invention provides a marker for identifying a cabbage root-knocker resistance resistant variety comprising at least one base sequence selected from markers for identifying the root- to provide.

According to another aspect of the present invention, there is also provided a method for isolating a cabbage, comprising: isolating genomic DNA of cabbage; A genetic DNA template is used as a template, and a marker for identifying a cabbage root-knot disease resistant variety comprising at least one base sequence selected from markers for identifying the root-knot disease-resistant varieties shown in SEQ ID NOs: Respectively; Identifying a specific gene for each of the amplified varieties by electrophoresis, and analyzing the combined bands to identify the varieties resistant to P. tuberculosis.

According to another aspect of the present invention, there is also provided a method for isolating a cabbage, comprising: isolating genomic DNA of cabbage; Amplifying a specific region of each strain using the primer set of claim 1 using the genomic DNA as a template; And identifying each of the amplified products by a High Resolution Melt (HRM) analysis to identify a root-knot disease resistant variety.

Yet another aspect of the present invention is a marker for identifying a cabbage root disease resistant variety of the present invention; And a nucleic acid amplification reagent. ≪ Desc / Clms Page number 2 >

Hereinafter, the present invention will be described in more detail.

In order to develop a marker for the identification of resistant varieties of cabbage root rot disease according to the present invention, the applicability of 7,645 SNP primer pairs to the cabbage was evaluated by 425 disease-resistant Resistant gene-linked SNP primer pair (BRP) was selected.

(BSNP) and 425 SNP primer pairs (BRP), which are applicable to cabbage, and BRPs, which are used in the cabbage, for analysis of HRM (High Resolution Melt) The 123 SNP primer pairs newly constructed for HRM analysis were evaluated for six cultivars of VMBL_CV048, VMBL_CV049, and VMBL_CV050, which were high in the resistance to root apoptosis, and VMBL_CV001, VMBL_CV002, and VMBL_CV003, As a result, 108 primers in BSNP, 415 primers in BRP, and 118 primer pairs in BRS were amplified in cabbage.

A total of six Chinese cabbage SNP primer pairs (BSNP017, BSNP157, BRS6, BRS18, BRS18, and BRS18) were selected from six cabbage cultivars, including three cabbage varieties with strong resistance to root damage, and three varieties of strong cabbage , BRS114) was identified as a cabbage root disease resistance-specific marker.

As used herein, "primer" refers to a single stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of the primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

The nucleotide sequence shown in SEQ ID NOs: 1 to 12 represents the nucleotide sequence of the marker for identification of the cabbage root-knot disease resistant variety identified as a preferred embodiment of the present invention. The odd sequence represents a forward primer and the even sequence represents a reverse primer.

The cabbage root rot resistance resistant variety identification markers according to the present invention as shown in SEQ ID NOS: 1 to 12 did not determine the position of the cabbage genome but were made from the cabbage resistance-related SNP markers.

(BSNP), 425 SNP primer pairs (BRP) applicable to cabbage, and HRM among BRPs, which are applicable to HRP (High Resolution Melt) analysis of 7,654 disease resistant SNP primer pairs of the developed Chinese cabbage A total of 123 SNP primer pairs for analysis were evaluated in six varieties of cabbage. As a result, 108 pairs in BSNP, 415 in BRP, and 118 primer pairs in BRS were amplified in cabbage.

The selected pairs of primers were evaluated in six cabbage cultivars such as three kinds of cabbage VMBL_CV048, VMBL_CV049, and VMBL_CV050 having high resistance to root-knot disease and three varieties of cabbage VMBL_CV001, VMBL_CV002, VMBL_CV003 having stronger viability, The SNP primer pair (BSNP017, BSNP157, BRS6, BRS18, BRS79, BRS114) was identified as a cabbage root disease resistance specific marker.

Lab name Seq_id Forward sequence Reverse sequence BSNP017 KBrH005D17_4 CGGAAACCCTAATCAACCAC (SEQ ID NO: 1) AGGGTGACTGCTCCGATTAT (SEQ ID NO: 2) BSNP157 KBrH065D07_11 CCATATCCGAAGAGCCAAAG (SEQ ID NO: 3) GGAGAACATTTTACTCAAGAGATGA (SEQ ID NO: 4) BRS6 KBrB001N22_16 TCAACTCTCTGTGTGTGCCTG (SEQ ID NO: 5) CAAAGCGGAAGCTCAAGAAC (SEQ ID NO: 6) BRS18 KBrB023N08_5 GTGGCACTTGTGTTTGCTGT (SEQ ID NO: 7) GGCCCCATAGAGTGATTCTG (SEQ ID NO: 8) BRS79 KBrH092O19_2 CCATGGACTGAAAGAGGCAT (SEQ ID NO: 9) CCTCTCCGATCCAATCTTCA (SEQ ID NO: 10) BRS114 KBrH087J23_15 TCAGCTTCCCGTTTTCTGAG (SEQ ID NO: 11) GGGTTTGGTTAGGGACGTTT (SEQ ID NO: 12)

Each of the primers may be used alone or in combination of two or more as a marker for identifying the cabbage root-knot disease resistant variety. The size of the PCR product obtained using the primers is designed to be 152-200 bp.

The identification method of each primer or cabbage rootstock disease resistant variety using them is as follows.

In order to identify the pathogens resistant to cabbage root disease, genomic DNA is first isolated from cabbage, and genomic DNA is used as a template to amplify a specific region of each species by using a marker for resistance to varieties of cabbage root disease. After confirming the amplified gene specific genes by electrophoresis, it is possible to identify the individual varieties by analyzing the combined bands.

Genomic DNA was isolated from cabbage in order to identify the resistant varieties of cabbage root, and genomic DNA was used as a template to amplify the specific regions of the varieties by using the marker for resistance to varieties of cabbage root disease. Each amplified product can be identified by HRM (High Resolution Melt) analysis.

As a result, the marker for identifying the cabbage root disease resistant variety according to the present invention can quickly, cheaply, and effectively identify the cabbage root disease resistant varieties.

The kit of the present invention is a marker for identifying a cabbage root disease resistant variety of the present invention; And nucleic acid amplification reagents. The markers for the identification of the cabbage root disease resistant varieties are as described above. The nucleic acid amplification reagent may be a dNTP mixture; Thermostable polymerase; And PCR buffer. The dNTP mixture may include dATP, dCTP, dGTP, dTTP, and the heat-resistant polymerase may be a commercially available heat-resistant polymerase such as Taq DNA polymerase or Tth DNA polymerase. In addition, the kit of the present invention may further include a user's manual describing optimal reaction performing conditions.

According to the present invention, a SNP primer pair obtained from the genome information of Chinese cabbage was applied to cabbage to develop cabbage root-knocker resistance specific marker. The SNP primer pair provided in the present invention can be usefully used in the cabbage root-knot disease resistance breeding and the root-knot disease resistance breeding by efficiently evaluating the cabbage root-knot resistance cultivars.

Fig. 1 is an electrophoresis image of a PCR amplification result applied to a cabbage using a total of 693 Chinese cabbage SNP primer pairs including 145 Chinese BSNP primer pairs, 425 BRP primer pairs, and 123 BRS primer pairs.
FIG. 2 shows HRM analysis of three cabbage root-knot disease resistance varieties and three Lee Byeongseong varieties using cabbage root-knot disease resistance specific markers BSNP017 and BSNP157 among SNP primer pairs prepared for HRM analysis among Chinese cabbage resistant SNP primer pairs to be.
FIG. 3 shows HRM analysis of three cabbage root-knot disease resistance varieties and three Lee Byeongseong variety varieties using four BRS6, BRS18, BRS79, and BRS114 resistant BRS6, BRS18, BRS79 and BRS114 selected from 118 BRS primer pairs.

Example 1: Extraction of genomic DNA from cabbage

(1) plant material

Of the 53 cabbages selected from the National Institute of Horticultural Science, Rural Development Administration, 6 collected resources of the following Table 2 were used in this experiment. Cabbage collection resources used in the experiment were evaluated by the National Institute of Horticultural Science, National Rural Development Administration in 2009. Three points (VMBL_CV048, VMBL_CV049, VMBL_CV049, ) And three low points (VMBL_CV001, VMBL_CV002, VMBL_CV003) were selected for the evaluation of cabbage root disease resistance association markers.

Lab name Variety name Origin Resistance Index Resistance degree VMBL_CV001 Chungam-45 Korea 2 Susceptibility VMBL_CV002 Bogam-1 Korea 10 VMBL_CV003 Junggam-21 Korea 14 VMBL_CV048 YR Chunrok Korea 71 Resistance VMBL_CV049 YR Dongjanggun Korea 76 VMBL_CV050 Grandmart cabbage Korea 83

(2) DNA extraction

Five leaves were sown in each cabbage cultivar and the young leaves grown in the greenhouse for 20 days were extracted with Qiagen DNA extraction kit. The extracted cabbage DNA was checked for relative purity and concentration using NanoDrop ND-1000 (NanoDrop Technologies Inc.), and the final DNA concentration was 20 ng / ml.

Example 2: Selection and design of SNP primers

In order to analyze the utility of the resistance-associated SNP primer pair developed in Chinese cabbage, a sequence of 7,645 Chinese cabbage SNP primer pairs was mapped to the nucleotide sequence of the cabbage registered in the database, and SNP primers When applied to pair of cabbage, it was analyzed whether PCR was possible. The results are shown in Table 3 below.

organism Cabbage ( B. oleacea ) Rapeseed (B. napus ) Black mustard
(B. nigra ) Freshly (B. juncea) Ethiopian mustard ( B. cari nata) Gaetmu (Raphanus sativus ) Arabidopsis thaliana ( A rabidopsis thaliana) template # 742,612 757,941 2,373 6,180 2,574 124,002 5 PCR success marker # 425 1,779 6 51 14 234 142 PCR success rate (%) 5.56 23.25 0.08 0.67 0.18 3.06 1.86

The PCR success marker in Table 3 refers to a marker in which a pair of primers in a currently available template (GSS, ESTs, mRNA) sequence shows a 100% match at an interval of 50 to 1500 bp, which is a size that can be confirmed by sequencing. However, if the same primer is bound to several templates, all of them are recognized as successful PCR. This shows redundancy between the template sequences.

145 pairs of Chinese cabbage SNP primers (BSNP) were selected for the analysis of High Resolution Melt (BSNP) among 7,645 diseased SNP primer pairs.

In addition, the cabbage genome of NCBI dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/) was set as a reference, and 7,645 Chinese cabbage SNP primer sequences were paired-and-labeled using the CLC Genomics Workbench program, end (forward / reverse) alignment was performed. These PCR product sizes were restricted to 50 ~ 1,500 bp, and SNP primers that could be used for exactly one alignment with the cabbage genome sequence were set as the SNP primers, and 425 cabbage-applicable cabbage SNP primers among 7,645 SNP primer pairs Pair (BRP) were selected.

In addition, 123 new cabbage - applicable cabbage SNP primer pairs (BRS) were constructed which can be used for HRM analysis, using the nucleotide sequence information of the selected 425 cabbage - applied pairs of Chinese cabbage SNP primers.

These selected 145 pairs of Chinese cabbage BSNP primers, 425 pairs of BRP primers, which is a pair of SNP primers applicable to cabbage among 7,645 Chinese cabbage pairs obtained through bioinformation analysis, and a pair of Chinese cabbage SNP primers A total of 693 Chinese cabbage SNP primer pairs, including 123 BRS primer pairs, were tested for the possibility of PCR amplification using two cabbage varieties VMBL_CV001 and VMBL_CV002.

For the PCR reaction, 10 μl of template DNA (1 μl), 0.5 μM forward and reverse primers (1 μl) and 2 μ GoTaq Green Master Mix (Promega, USA) A total volume of 20 [mu] l of PCR reaction mixture was made.

PCR amplification conditions of the BSNP SNP primer were 95 ° C for 10 minutes, 95 ° C for 10 seconds, 60 ° C for 10 seconds, 72 ° C for 15 seconds, 95 ° C for 10 seconds, and the above procedure was repeated 40 times , Followed by 10 seconds at 95 ° C, and then the melt curve was increased from 65 ° C to 95 ° C by 0.2 ° C every 10 seconds.

The PCR amplification conditions of BRP and BRS primers were 2 minutes at 98 ° C, 2 seconds at 98 ° C, 15 seconds at 57 ° C (53 ° C, 55 ° C, 62 ° C and 65 ° C depending on the annealing conditions of each primer pair) , And the melt curve was increased from 65 캜 to 95 캜 every 0.2 캜 every 10 seconds. The above procedure was repeated 39 times from 98 ° C for 2 seconds.

To confirm amplification results, PCR products were electrophoresed on 1.0% agarose gel. The results are shown in Fig. 1 and Table 4. Fig. 1 is an electrophoresis image of a PCR amplification result applied to a cabbage using a total of 693 Chinese cabbage SNP primer pairs including 145 Chinese BSNP primer pairs, 425 BRP primer pairs, and 123 BRS primer pairs.

Primer * No. PCR amplification amplification No amplification BSNP 145 108 37 BRP 425 415 10 BRS 123 118 5

As can be seen from Table 4, 145 SNP primer pairs (BSNP) for analysis of HRM (High Resolution Melt) among the disease resistance gene-related SNP primer pairs developed in Chinese cabbage using Chinese cabbage genome information and 425 SNPs applicable to cabbage As a result of evaluating 123 pairs of SNP primers newly developed for HRM analysis of primer pair (BRP) and BRP, six pairs of cabbage were evaluated. 108 pairs of BSNP, 415 of BRP and 118 pairs of BRS were amplified in cabbage Respectively.

As a result of HRM analysis of 98 pairs of PCR amplifiable Chinese cabbage BSNP primers in cabbage, two specimens of cabbage root - knot disease resistance - specific markers were selected. At this time, 10 pairs of SNP primers among 108 PCR-amplifiable Chinese cabbage BSNPs were confirmed as multi-band PCR results and excluded from the HRM analysis.

As a result of HRM analysis using newly constructed pairs of BRS primers, BRS6, BRS18, and BRS79, which are specific candidates for resistance to cabbage root disease. Four additional BRS114 were selected. At this time, BRS primer pairs are 118 pairs of SNP primers newly made for BSNP among 425 Chinese cabbage SNP primer pairs applicable to cabbage obtained from bioinformation analysis.

Example 3: Marker specificity assay

The results of HRM analysis of three points (VMBL_CV048, VMBL_CV049, and VMBL_CV050) and three low points (VMBL_CV001, VMBL_CV002, and VMBL_CV003), which had high values of resistance to root canal disease using the selected two cabbage root disease resistance resistance markers, are shown in Tables 5 and 2 Respectively. FIG. 2 shows HRM analysis of three cabbage root-knot disease resistance varieties and three Lee Byeongseong varieties using cabbage root-knot disease resistance specific markers BSNP017 and BSNP157 among SNP primer pairs prepared for HRM analysis among Chinese cabbage resistant SNP primer pairs to be.

Lab name Melt temperature (℃) Resistance degree BSNP017 BSNP157 VMBL_CV001 78.6 78.2 Susceptibility VMBL_CV002 78.6 78.2 Susceptibility VMBL_CV003 78.6 78.2 Susceptibility VMBL_CV0048 78.4 78.0 Resistance VMBL_CV0049 78.4 78.0 Resistance VMBL_CV0050 78.4 78.0 Resistance

As shown in Table 5 and FIG. 2, HRM analysis of three cabbage root-knot disease resistance varieties and three Lee Byeongseong varieties using the BSNP017 and BSNP157 primer pairs revealed that only specific reactions occurred and nonspecific reactions did not occur. Thus, BSNP017 and BSNP157 markers Is a marker specific to cabbage root disease resistance.

In addition, four selected cabbage pathogen resistance - specific candidate markers BRS6, BRS18, BRS79. The results of HRM analysis of three points (VMBL_CV048, VMBL_CV049, VMBL_CV050) and three low points (VMBL_CV001, VMBL_CV002, VMBL_CV003), which had high values of resistance to root canal disease using BRS114, are shown in Table 6 and FIG. FIG. 3 is a graph showing the results of bioinformation analysis of four cabbage root-knot disease resistance-specific markers BRS6, BRS18, and BRS18 selected from 118 pairs of BRS primers, which are SNP primer pairs newly made for BSNP among 425 Chinese cabbage SNP primers applicable to cabbage. BRS79 and BRS114 were used for HRM analysis of 3 varieties of cabbage root disease and 3 varieties of Lee Byeongseong.

Genotypes Melt temperature (℃) Resistance degree BRS6 BRS18 BRS79 BRS114 VMBL_CV001 80.2 79.2 82.2 84.4 Susceptibility VMBL_CV002 80.2 79.2 82.2 84.4 Susceptibility VMBL_CV003 80.2 79.2 82.2 84.4 Susceptibility VMBL_CV048 80.0 79.0 81.8 84.2 Resistance VMBL_CV049 80.0 79.0 81.8 84.2 Resistance VMBL_CV050 80.0 79.0 81.8 84.2 Resistance

According to Table 6 and FIG. 3, BRS6, BRS18, BRS79. BRS114, BRS114, and BRS114 were detected by HRM analysis of three varieties of cabbage rootstock disease and three varieties of Lee, Byeongseong using only the BRS114 primer pair, and no specific reaction occurred. The BRS114 marker is a unique marker for the resistance to cabbage root disease.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> SNP Maker for identifying the clubroot resistance in Cabbage and          uses thereof <160> 12 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BSNP017 forward primer <400> 1 cggaaaccct aatcaaccac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > BSNP017 reverse primer <400> 2 agggtgactg ctccgattat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BSNP157 forward primer <400> 3 ccatatccga agagccaaag 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > BSNP157 reverse primer <400> 4 ggagaacatt ttactcaaga gatga 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BRS6 forward primer <400> 5 tcaactctct gtgtgtgcct g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS6 reverse primer <400> 6 caaagcggaa gctcaagaac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS18 forward primer <400> 7 gtggcacttg tgtttgctgt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS18 reverse primer <400> 8 ggccccatag agtgattctg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS79 forward primer <400> 9 ccatggactg aaagaggcat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS79 reverse primer <400> 10 cctctccgat ccaatcttca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS114 forward primer <400> 11 tcagcttccc gttttctgag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRS114 reverse primer <400> 12 gggtttggtt agggacgttt 20

Claims (4)

A primer set consisting of SEQ ID NOS: 1 and 2, a primer set consisting of SEQ ID NOS: 3 and 4, a primer set consisting of SEQ ID NOS: 5 and 6, a primer set consisting of SEQ ID NOS: 7 and 8, A primer set for identifying a cabbage root-knot disease resistant variety in which at least one is selected from the group comprising a set of primers consisting of SEQ ID NOs: 11 and 12. Isolating the genomic DNA of the cabbage;
Amplifying a specific region of each strain using the primer set of claim 1 using the genomic DNA as a template; And
Identifying the specific gene for each amplified strain by electrophoresis, and analyzing the combined band to identify the rootstock disease resistant strain. Isolating the genomic DNA of the cabbage;
Amplifying a specific region of each strain using the primer set of claim 1 using the genomic DNA as a template; And
Identifying each of the amplified products by a High Resolution Melt (HRM) analysis to identify the root-knot disease resistant variety. A primer set for identification of the cabbage root-knot disease resistant variety according to claim 1; And a nucleic acid amplification reagent.

Images