KR20130075511A - Composition for promoting hair growth containing fermented extracts of herb mixture - Google Patents

Abstract

PURPOSE: A hair growth composition is provided to realize a radical treatment of depilation by improving the characteristic reproduction capacity of human skin, and to maintain effects of treatment and improvement of skin diseases and depilation. CONSTITUTION: A manufacturing method of a natural complex fermentation extract comprises the steps of: (1) mixing arrowroot, garlic, walnut, mulberry, paprika, perillae Herba, black sesame, Rhynchosia Nulubilis, brown seaweed, bamboo leaf, salmon, and pine nuts lobe in a ratio of 1-10 : 1-5 : 1-10 : 1-10 : 1-10 : 1-5 : 1-10 : 1-10 : 1-5 : 1-10 : 1-5 : 1-10; (2) pulverizing the mixture in the previous step and extracting with water, alcohol having 1-4 carbon number, or a mixed solvent of them; (3) filtering the extract from the previous step and injecting more than one between lactic acid bacteria and yeast, and then fermenting the result. [Reference numerals] (AA) Experiment; (BB) Abstract of an experimental result: VEGF gene expression of the specimen-2 is increased compared to a control group; (CC) Specimen-1 (1% extract); (DD) Specimen-2 (1% fermented extract); (EE) Specimen-3 (1% extract)

Description

Hair-repellent composition comprising as an active ingredient natural complex fermented extract {COMPOSITION FOR PROMOTING HAIR GROWTH CONTAINING FERMENTED EXTRACTS OF HERB MIXTURE}

The present invention relates to a hair regrowth composition comprising the natural complex fermented extract as an active ingredient, more specifically, consisting of 칡, garlic, walnut, audi, paprika, lobule, black sesame, mouse eye, seaweed, bamboo leaf, salmon, and pine needles The present invention relates to a complex fermentation extract having hair loss prevention, hair growth promoting and hair growth effects, a preparation method thereof, and a hair restorer composition comprising the extract as an active ingredient.

Hair loss is evidence of aging. The most feared woman is aging, such as wrinkles, blemishes, freckles, and hair loss. Hair loss is the symbol of aging that men fear most.

In particular, hair loss is a sensitive issue directly related to social life that afflicts adolescents, young people, women, and men, and it is easy to find people who are worried because they have too much hair. Those who make up one third of the population.

Each hair grows 0.3 ~ 0.4 ㎜ a day, and when the average number of hairs is about 100,000, hair grows about 30-40 ㎜ a day. The rapid growth of hair in the human body is due to active cell division in the hair cells corresponding to the roots. It's a rapid multiplication at a rate not found in any other part of the body.

Conversely, if there is any disruption to this rapid cell division in the hair roots, hair growth will occur immediately and hair loss will occur. These alopecia are caused by excessive sebum production due to circulatory problems such as endocrine disorders, autonomic nervous system disorders, blood circulation disorders, physical factors such as malnutrition of hair roots, allergies and bacterial infections, genetic factors such as the effects of male hormones, and Pollution, processed foods such as food, shampoo, soap, mousse, hair gel, hair spray, perm, dyeing, hair dryer, environmental factors such as the use of mental and social factors that are often stressed and social, and aging It is known to appear.

In addition, in recent years, regardless of gender and age, hair loss is increasing, and the starting age of hair loss is gradually decreasing.

Topical coatings, oral dosages, dietary supplements, gene transplants, hair transplants, and the like, are being used to treat hair loss. However, these methods have a limited scope of use, prevent continuous hair loss, have a temporary effect on drug treatment, rather accelerate the production of scalp or sebum, and especially adversely affect heart disease. There was a lung with accompanying side effects.

After all, the present invention was devised to solve the above problems, the main purpose of the present invention is to prevent hair loss, as well as new hair is coming up, thin hair is thick, once hair has a normal hair cycle It is to provide a natural complex fermentation extract and a hair regrowth composition comprising the natural complex fermentation extract as an active ingredient.

In order to achieve the above object, the present invention provides a natural product complex fermentation extract having hair loss prevention, hair growth promotion and hair growth effect.

In the present invention, the natural complex fermented extract is mixed with any one or more selected from 칡, garlic, walnut, mulberry, paprika, lobule, black sesame, rat eye, seaweed, bamboo leaves, salmon and pine needles, water, 1 to After extraction with a lower alcohol or a mixed solvent of 4, characterized in that the fermented by inoculating the extract with lactic acid bacteria or yeast, wherein the 칡, garlic, walnut, mulberry, paprika, leaflet, black sesame, rat eye, seaweed , Bamboo leaf, salmon and pine needles are 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ It is good to mix in the weight ratio of 5: 1-10.

In addition, the present invention provides a method for producing the natural product complex fermentation extract.

The present invention also provides a hair regrowth composition comprising the natural complex fermentation extract as an active ingredient.

For reference, this application was performed as a technical support project of Daegu Techno Park Oriental Medicine Industry Support Center.

As described above, the present invention can fundamentally focus on increasing the intrinsic regenerative ability of the skin, rather than temporarily improving hair loss, and simultaneously treats and improves skin diseases and hair loss, and is continuously effective. Can be represented.

In addition, the natural product mixed fermentation extract of the present invention is effective in inhibiting scalp itch and dandruff, scalp cleaners, dandruff treatments and the like can also be useful.

Figure 1 confirms the effect on the growth factor (growth factor) gene expression in all the flow cells of the natural product fermentation extract of the present invention.
Figure 2 is a photograph showing the state before and after using the natural compound fermentation extract of the present invention and the first one to three months after the test subjects with seborrheic alopecia.
Figure 3 is a photograph showing the state before and after 4 months of use of the natural product complex fermentation extract of the present invention to test subjects with male pattern hair loss.

Hereinafter, the present invention will be described in detail.

The present invention provides a natural product complex fermentation extract having hair loss prevention, hair growth promotion and hair growth effects.

In the present invention, the natural product complex fermentation extract, it is preferably any one or more selected from 칡, garlic, walnut, mulberry, paprika, lobule, black sesame, rat eye, seaweed, bamboo leaves, salmon and pine needles, 칡, garlic , Walnuts, mulberry, paprika, leaflets, black sesame seeds, rats, seaweed, bamboo leaves, salmon and pine needles 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 5: 1 ~ 10 It shows the optimum effect when mixed and used.

The sample selected as above is about 1 to 20 times the powder weight, preferably 5 to 15 times water, lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, preferably 35 to 120 ° C. after powdering. Preferably, using an extraction method such as stirring extraction, hot water extraction, cold extraction, warm extraction, reflux cooling extraction or ultrasonic extraction for about 0.1 to 48 hours, preferably 1 to 24 hours at 95 to 100 ℃ Preferably, after extracting hot water, the obtained extract is filtered, concentrated or dried to obtain an extract.

In the present invention, the 'extract' includes all extracts, purified products, diluents, concentrates, and dried products, the extract obtained as described above is inoculated at least one of lactic acid bacteria and yeast fermented at 24 ~ 72 hours at 30 ~ 50 ℃ It is preferable to make it.

Lactic acid bacteria that can be used in the present invention is Lactobacillus genus of lactic acid bacteria (Lactobacillus sp.), Streptococcus genus of lactic acid bacteria (Streptococcus sp.), Phedi OKO kusu in lactic acid bacteria (Pediococcus sp.), Flow Pocono stock in lactic acid (Leuconostoc sp.) And May be one or more strains selected from the group consisting of Bifidobacterium sp., And the yeast is Saccharomyces sereviciae , Saccharomyces rouxii , Saccharomyces oviformis , Saccharomyces steineri and the like. Preferably, Lactobacillus paracasei may be used as the lactic acid bacterium.

However, the type of the strain or yeast is selected in consideration of the human stability and fermentation power, so that the composition according to the present invention is applied directly to the human body in the form of external preparations for skin, etc., used in the art as long as human stability and fermentation power are recognized. Any strain or yeast may be used, the present invention is not limited to the type of lactic acid bacteria and yeast.

In addition, the 'hair loss' in the present invention includes all the hair loss classified in the art except for hair loss (rebound) alopecia, preferably alopecia areata, male type hair loss, general hair loss, female hair loss, pediatric hair loss, Alopecia are any one or more of alopecia areata accompanied by alopecia skin disease, such as alopecia, drug hair loss, seborrheic dermatitis or psoriasis.

Er ( Pueraria thunbergiana Sieb. Et Zucc.) Used in the present invention is good for hangover relief, fatigue recovery, anti-aging, diabetes prevention, menopause and growth development,

Garlic ( Allium sativum L) has a strong bactericidal effect, and it has the effect of anti-aging to revitalize the action of the heart and muscles, prevent the oxidation of vitamin C or fats and prevent the production of fat peroxide in the body.

In addition, walnuts ( Juglans sinensis Dode) are alkaline foods that contain high-quality proteins and fats that are well digestible and absorbed. They include bronchial, asthma, hemorrhage and muscle bones, postpartum, uterine bleeding, bruises and urine. It is widely used in the treatment of excessive stomach acid, rashes and burns, and it is a health food that improves the function of the kidneys and promotes diuretic effect, prevents various diseases such as low back pain, joint pain, and constipation for children and improves lung function. In addition, it helps prevent and cure various adult diseases, and it is good to eat when the hair is white or shiny.

Also, Morus bombycis Koidz, a fruit of the mulberry tree, also known as loss and mulberry, improves the function of the liver and kidneys, quenches thirst, softens joints, and is effective against insomnia and forgetfulness. have. In addition, it prevents the head from counting, hematopoietic action is used to treat rheumatism, blood sugar and cholesterol lowering effect.

In addition, paprika ( Capsicum annuum L.) is rich in vitamin C, vitamins A, E, carotene, fiber, iron, calcium, potassium, etc., and antioxidants, immune system, osteoporosis prevention, colon cancer prevention, anticancer activity , Brain development, and skin moisturizing effects.

In addition, perilla frutescens var. Acuta is called perilla and chazilla. In oriental medicine, the leaves are called lateral leaves (蘇), and the leaves are blue with anemia, sweating, antipyretic, analgesic. It is used as a medicine for bronchitis, seawater, asthma, expectorant, gastroenteritis, digestion, dizziness and pain in the body, nasal congestion and runny nose, and also as an antidote for poisoning by fish.

In addition, black sesame seeds (Sesamum indicum) has been used as a food for reinforcing the energy of the kidney, which is deeply related to hair, in black herbs, and it is effective for preventing baldness and hair loss by nourishing the scalp. In addition, it is rich in lecithin, vitamin B, E, memory, concentration, cataract treatment, blemishes, skin aging prevention effect.

In addition, Rhynchosia Nulubilis Loureiro contains more than 5 to 6 times more isoflavones than ordinary soybeans. Isoflavones have anticancer effects, lower blood cholesterol, prevent heart disease, damage and repair osteoblasts. In addition, polyphosphate contained in rat bean has been demonstrated to suppress skin aging caused by ultraviolet rays.

In addition, seaweed ( Undaria pinnatifida ) is a seaweed (brown seaweed), and contains special ingredients such as alginic acid, laminarin, fucoidan, folksterol, chlorophyll, EPA, DHA, linoleic acid, vitamin A, B1, B2, and mannitol. In particular, iodine (I) contained in seaweed is known to prevent thyroid edema and to prevent hair from falling out, has the effect of coercive action, anticancer action, anticoagulant action, detoxification action.

Bamboo leaves are bamboo leaves, which have the effect of lowering heat, removing severity, generating essences, and diuresis, and the smallest bamboo of bamboo, cancer, Diabetes, high blood pressure, gastritis, gastric ulcers, chronic hepatitis is effective.

In addition, salmon ( Oncorhynchus keta ), which is distributed in Korea's east coast, Japan, Yeonhae, Kamchatka Peninsula, and North America, is rich in omega-3 fatty acids such as EPA, DHA, and vascular diseases such as hypertension, arteriosclerosis, heart disease, and stroke. It is effective in prevention.

In addition, the pine needles are the leaves of the pine tree Pinus koraiensis Zieb et Eucc. In the old document, Myeongseung, it manages the diseases, chills and hunger of nerve palsy, protects the fragile body, fattens the skin, and gives skin It is recorded to make it moisturize, and the herbaceous wood has been recorded to soothe the lungs and control cough.

The present invention also provides a hair restorer composition comprising the natural product complex fermentation extract as an active ingredient.

The hair regrowth composition of the present invention may include the natural complex fermented extract in any amount within a range that does not have toxicity to the human body depending on the degree of symptoms or use of hair loss, specifically 0.001 to 99.99 based on the total weight of the composition It may be included in the weight%, preferably 0.1 to 50% by weight.

The composition of the present invention further contains a pharmaceutically or cosmetically acceptable carrier and is a conventional formulation of creams, lotions, tonics, sprays, aerosols, oils, solutions, suspensions, gels, ointments, emulsions, sesame seeds, pastes and the like. It can be prepared as. The composition of this invention contains a conventional base, and the other component generally used as a pharmaceutical or cosmetic raw material can be mix | blended suitably as needed.

The base of the composition of the present invention can be used as long as it is commonly used, such as purified water, mineral water, ethanol, glycerin, squalene, 1,3-propylene glycol, 1,3-butylene glycol, castor oil, Tsubaki Oils and liquid petrolatum. Examples of other components to be incorporated into the compositions of the present invention include, but are not limited to, surfactants, emulsifiers, thickeners, preservatives (eg, methyl paraoxybenzoate), antioxidants, fragrances, and the like.

In addition to the above components, the composition of the present invention may include components that may serve to supply nutrients to hair follicles or hair growth promoting auxiliary components that are commonly used. For example, vitamins, amino acids, animal and vegetable oils, sodium chloride And the like, but are not limited thereto. These amounts are preferably added at 0.0001 to 10% by weight, preferably 0.01 to 1% by weight of the total composition. In this case, the vitamins include all but not limited to vitamin A, vitamin B1, vitamin B2, niacin (nicotinic acid), vitamin C, vitamin E, sodium pantothenate, potassium pantothenate, biotin H (vitamin H), and the like, amino acids The class includes, but is not limited to, waveguides. In addition, animal and vegetable oils include, but are not limited to, horse oil, egg oil, olive oil, camellia oil, rapeseed oil, sesame oil, germ oil, and the like.

The composition of the present invention can be used by a method such as direct application or scattering on hair or scalp. In the present invention, the term "hair" includes hair follicles and hair follicles of hair, hair and eyelashes, and eyelashes, beards, armpits, pubic hair, and all parts having hair roots and hair follicles throughout the body. Accordingly, the present invention provides hair tonics, hair lotions, hair creams, hair sprays, hair mousses, hair gels, hair conditioners, hair shampoos, hair rinses, hair packs, hair treatments, eyebrow regrowths, eyelash regrowths or eyelash nutrients, or pets. It can be used as a shampoo and pet rinse.

The dose of the composition according to the present invention should be appropriately determined in consideration of sex, age, alopecia, hair condition and the like. Preferably it can be applied 1 to 5 times 3 ~ 15 ~ 1 day extract based on adults

When the hair regrowth composition of the present invention is applied to a male hair loss patient, which is said to be the most refractory, hair loss becomes significantly thicker after 1 to 4 weeks, hair loss begins to emerge after 4 to 8 weeks, and 4 months after application. Since then, it has returned to the normal level.

In addition, the bactericidal effect against dandruff and seborrheic dermatitis was excellent, and when applied to patients with seborrheic alopecia, it was confirmed that hair loss was also cured at the same time as the scalp improvement effect after 4 months. Therefore, the composition of the present invention can be used for hair loss preventing agent, hair growth promoting agent, hair growth agent, scalp cleaner, dandruff treatment agent and the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example. Preparation of complex fermented extract derived from natural products

Dry 칡, garlic, walnut, mulberry, paprika, lobule, black sesame, rat's eye, seaweed, bamboo leaf, salmon, and pine needles purchased in the market, and then powder each of them 5: 5: 5: 5: 5: After mixing at a weight ratio of 3: 5: 5: 3: 5: 2: 5, 500g was taken from the mixed powder, 6L of water was added thereto, and extracted at 95˜100 ° C. for 24 hours.

The extract was sterilized after filtration, and Lactobacillus paracasei KW3110 was added to the sterilized extract at a concentration of 10 mg strain per 100 mg of the extract, followed by fermentation for 72 hours (3 days) while maintaining 35 to 40 ° C. Fermented extract was prepared.

Experimental Example 1. Confirmation of growth factor gene expression

In order to determine the effect of the natural complex fermented extract prepared in the above example on the growth factor gene expression in all milk cells, total RNA was isolated after drug treatment in dermal papilia cells (DP cells) and Growth factor expression was measured by RT-PCR.

Specifically, the dermal papilla cells (DP cells) were pulverized with a dissecting knife on the back skin of rats 1 day old, and then reacted while rotating in a 37 ° C. incubator for 4 hours by adding 200 unit / ml collagenase I solution. .

In order to separate the cells from the tissue after the reaction, it was allowed to stand at room temperature for 30 minutes after blowing for 1 minute. The supernatant was then placed on 5 ml of Histopaque 1083 solution (Sigma-Aldrich, Inc, USA) and centrifuged for 20 minutes at 2,500 rpm. After centrifugation, an intermediate cell layer was taken to obtain 10% fetal bovine serum (FBS), 100 unit / ml penicillin, 100 μg / ml streptomycin, 0.25 μg / ml amphotericin B (amphotericin). B; Dulbecco's modified Eagle's medium (DMEM) medium containing Gibco BRL., USA) was placed in a cell culture plate (Sarstedt, 100 × 20 mm) and incubated under 5% CO ₂ , 37 ° C.

In order to confirm the activity of the extract on DP cells, 50 ㎍ / ㎖ each extract on the 5th day of the DP cell has a confluency of 70 ~ 80%, and after 24 hours to recover the cells Trizol Reagent (Gibco BRL , USA), and total RNA was extracted, and total RNA was quantified by measuring absorbance at 260 nm.

Total RNA extracted was M-MLV reverse transcriptase (Gibco BRL, USA), 10 reaction buffer (20 mM Tris-Cl pH 8.4, 50 mM KCl), 2 mM dNTP mixture, 1.5 U Taq polymerase (Takara Co., Tokyo, Japan), 20 pmol of PCR was added with 20 pmol forward and reverse primers to obtain an image analyzer (BIO-PROFIL BIO 1D ⁺⁺ Window Application V99.04) containing ethidium bromide (EtBR). PCR results of each gene were analyzed.

PCR was performed by volume, and each primer sequence is shown in the table below.

Gene Sequence SEQ ID NO: VEGF F: TGGAAGGCACAGCAGTTTACC One R: TCATGGCCCACACGATTCAC 2 KGF F: GACATGGATCCTGCCAACTT 3 R: AATTCCAACTGCCACTGTCC 4 HGF F: ATCCTCATGGACCCTGGTG 5 R: GGCCTGGCAAGCTTCATTA 6 IGF F: TCAACAAGCCCACAGGGTAT 7 R: ACTCGTGCAGAGCAAAGGAT 8 β-actin F: TGGAATCCTGTGGCATCCATGAAAC 9 R: TAAAACGCAGCTCAGTAACAGTCCG 10

Figure 1 confirms the effect of the natural complex fermentation extract prepared in Example on the growth factor (GA) gene expression in the dermal papilla cells.

Growth factor is a generic term for polypeptides that promote various cell divisions, growth and differentiation, and various types have been found, their functions are diverse, and they are involved in cell signaling systems. In scalp cells and dermal papilla cells, cell proliferation or differentiation occurs and hair growth occurs.

As shown in FIG. 1, in the case of 1% fermented extract (Sample-2), VEGF gene expression was increased compared to the control group, and from the above results, the natural product complex fermented extract of the present invention has a hair production (hair growth) effect. It can be seen.

However, in Figure 1 Contorl minoxidil, Sample-1 is a natural product complex extract before fermentation, Sample-2 is a natural product complex fermentation extract and Sample-3 means a mixture of Sample-1 and Sample-2.

Experimental Example 2. Check the scalp state (1)

After shampooing once a day for 23 people with severe inflammatory alopecia and towel dry, the natural product complex fermentation extract prepared in Example 1 by applying a 9 to 15 ㏄ evenly to the scalp with inflammatory hair loss and massage the first 1 The results were observed after 3 months of use.

As a result, as shown in Figure 2, before using the natural complex fermentation extract of the present invention, the scalp was inflamed and there was a hair loss, but after one month using the natural complex fermented extract, the inflammation of the scalp disappeared cleanly. After 3 months, new hair became thicker and new hair became thicker and normal hair was recovered to improve scalp inflammation and hair growth. There was no skin irritation or side effects during the experiment.

Experimental Example 2. Check the scalp state (2)

Shampoo and towel dry on 19 male patients with alopecia, and apply the natural product fermentation extract prepared in the above example to the scalp with hair loss in an amount of 3㏄ once 3 ~ 5 times a day, 9 ~ 15㏄ evenly and massage. The results were observed after using at least 4 months.

As a result, as shown in Figure 3, compared to before using the natural product complex fermentation extract of the present invention, hair loss is significantly reduced and returned to the level of almost normal people after 4 months of use.

Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific descriptions are only for the preferred embodiment and that the scope of the present invention is not limited thereby. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Jeuncell, Co., Ltd. <120> COMPOSITION FOR PROMOTING HAIR GROWTH CONTAINING FERMENTED          EXTRACTS OF HERB MIXTURE <130> P11-E504 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 1 tggaaggcac agcagtttac c 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 2 tcatggccca cacgattcac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 3 gacatggatc ctgccaactt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 4 aattccaact gccactgtcc 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 5 atcctcatgg accctggtg 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 6 ggcctggcaa gcttcatta 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 7 tcaacaagcc cacagggtat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 8 actcgtgcag agcaaaggat 20 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 9 tggaatcctg tggcatccat gaaac 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 10 taaaacgcag ctcagtaaca gtccg 25

Claims (8)

After extracting any one or more selected from 칡, garlic, walnut, mulberry, paprika, leaflet, black sesame, rat's eye, seaweed, bamboo leaf, salmon, and pine needles, the extract is inoculated with one or more of lactic acid bacteria and yeast Natural product complex fermentation extract having hair loss prevention, hair growth and hair growth effect, characterized in that it is prepared by.
The method of claim 1,
The extract is 칡, garlic, walnut, Audi, paprika, lobule, black sesame, rat eye, seaweed, bamboo leaves, salmon, and pine needles, respectively 1-10: 1-5: 1-10: 1-10: 1-10 : 1 ~ 5: 1 ~ 10: 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 5: A natural product complex fermentation extract, characterized in that consisting of 1 to 10 by weight.
The method of claim 1,
The lactobacillus is Lactobacillus sp., Lactobacillus sp., Streptococcus sp., Pediococcus sp., Pediococcus sp., Leuconostoc sp. Natural product complex fermentation extract, characterized in that at least one strain selected from the group consisting of Bifidobacterium sp.
Hair repellent composition comprising the natural complex fermentation extract of any one of claims 1 to 3.
5. The method of claim 4,
The composition is a hair loss composition, characterized in that is formulated as a hair loss preventing agent, hair growth promoter, hair growth agent, scalp cleaner or dandruff treatment agent.
(1) 칡, garlic, walnut, mulberry, paprika, lobule, black sesame, rat eye, seaweed, bamboo leaves, salmon, and pine needles 1 ~ 10: 1 ~ 5: 1 ~ 10: 1 ~ 10: 1 ~ 10 1 to 5: 1 to 10: 1 to 10: 1 to 5: 1 to 10: 1 to 5: 1 to 10: mixing at a weight ratio of 1 to 10;
(2) powdering the mixture and extracting it with water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof;
(3) inoculating one or more of lactic acid bacteria and yeast after filtering the extract;
The method according to claim 6,
The lactic acid bacteria Lactobacillus paracasei ( Lactobacillus paracasei KW3110) characterized in that the natural product complex fermentation extract manufacturing method.
The method according to claim 6,
The fermentation is a natural product complex fermentation extract manufacturing method, characterized in that the fermentation for 30 to 50 hours at 30 ~ 50 ℃.

Images