KR20100039934A - Specific primers for detection of onion yellow dwarf virus, and uses thereof - Google Patents

Abstract

PURPOSE: A specific primer for diagnosing onion yellow dwarf virus(OYDV) is provided to simply and economically diagnose OYDV and produce normal garlic. CONSTITUTION: A primer set for diagnosing onion yellow dwarf virus(OYDV) comprise a forward primer of sequence number 1, 3 or 4 and reverse primer of sequence number 2 or 5. A primer set for diagnosing OYDV comprises a primer set of sequence numbers 1 and 2, primer set of sequence numbers 3 and 2, or primer set of sequence numbers 4 and 5. A method for OYDV-specific diagnosis comprises: a step of isolating total RNA from a garlic sample; a step of amplifying target sequence through RT-PCR using the primer set and RNA template; and a step of detecting the amplified product.

Description

Specific primers for detection of Onion yellow dwarf virus, and uses approximately}

The present invention relates to a species-specific primer and its use for diagnosing virus OYDV occurring in garlic, and more specifically, to a species-specific onion onion dwarf virus (OYDV). It relates to a primer set consisting of a primer and a combination thereof that can be diagnosed.

For the diagnosis of garlic virus, electron microscopy and serological methods (ELISA) were used in the past. However, because filamentous viruses present in garlic exist in many species that are hard to distinguish from each other, species cannot be diagnosed by electron microscopy.

On the other hand, serological methods have been useful for the diagnosis of garlic virus, but garlic is naturally infected with many viruses, so it is difficult to accurately diagnose garlic virus with one or several antisera. In addition, the anti-serum production of the virus has a problem that is very difficult to secure the pure garlic virus and garlic not infected with the virus. In addition, some viruses occurring in garlic have a non-specific reaction due to taxonomic similarity, which makes it difficult to distinguish species by serological methods.

The most commonly used RT-PCR method among molecular biological diagnostics is the use of species specific primers. However, many of the primers published in the paper are difficult to use for the diagnosis of all onion sulfotrophic strains because they are selected without a taxonomic system (Tsuneyoshi et al., 1998. Arch Virol 143: 1093-). 1107; Chen et al., 2001. Arch Virol 146: 1841-1853; Chen et al. 2004. Arch Virol 149: 435-445).

Korean Patent Registration No. 10-0578000 discloses a primer set for diagnosing onion yellow atrophy virus of garlic and a method for diagnosing onion yellow atrophy virus using the same, but different from the primer set of the present invention.

The present invention has been made according to the above requirements, and since most garlics in the natural state are complexly infected with filamentous viruses that are difficult to distinguish from each other, electron microscopy and serological methods can be used to diagnose all infected viruses. Is impossible. In addition, since the virus occurring in garlic has a lot of tinnitus in the taxonomy, it is necessary to clearly classify the species by molecular biological methods. On the other hand, since there are significant variations between species (isolate) within the species (isolate) to develop a diagnostic primer that can overcome these variations.

In order to solve the above problems, the present invention provides a primer set for diagnosis of OYDV comprising at least one primer set selected from the primers represented by SEQ ID NOs: 1 to 5.

The present invention also provides an OYDV diagnostic kit comprising the primer set.

The present invention also provides a method for species-specific diagnosis of OYDV using the primer set.

According to the present invention, RT-PCR diagnosis using a specific primer for diagnosing onion sulfidation virus (OYDV) can react with all strains of onion sulfation atrophy virus (OYDV) known to date, and is 1,000 times or more than the conventional method using antiserum. It has a detection limit. In addition, the new garlic market could be pioneered by industrializing the plant virus RT-PCR diagnostic kit and producing differentiated quality garlic through the production of garlic-free bottles.

In order to achieve the object of the present invention, the present invention provides a primer set for diagnosis of OYDV comprising at least one primer set selected from the primers represented by SEQ ID NO: 1 to 5.

In the OYDV diagnostic primer set of the present invention, the forward primer is selected from the group consisting of the primers of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 4, the reverse primer is selected from the group consisting of the primers of SEQ ID NO: 2 and SEQ ID NO: 5 Can be. However, in the primer set of the present invention, the forward primer should be located on the 5 'side rather than the reverse primer.

OYDV diagnostic primer set of the present invention is preferably a primer set of SEQ ID NO: 1 and 2; Primer sets of SEQ ID NOs: 3 and 2; And a set of primers of SEQ ID NOs: 4 and 5.

OYDV diagnostic primer set of the present invention is more preferably a primer set of SEQ ID NO: 1 and 2; Primer sets of SEQ ID NOs: 3 and 2; And primer sets of SEQ ID NOs: 4 and 5.

The simultaneous use of three primer sets allows for more accurate diagnosis of OYDV.

The primers may be at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 in the sequence of SEQ ID NO: 1 to SEQ ID NO: 5, depending on the sequence length of each primer. Oligonucleotides consisting of at least 24, segments of at least 24 contiguous nucleotides. For example, the primers of SEQ ID NO: 1 (25 oligonucleotides) may comprise at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, May comprise oligonucleotides consisting of at least 23, 24 or more consecutive nucleotide segments, wherein the primers of SEQ ID NO: 2 (25 oligonucleotides) are at least 16, at least 17, at least 18 in the sequence of SEQ ID NO: 2 , Oligonucleotides consisting of at least 19, at least 20, at least 21, at least 22, at least 23, at least 24 consecutive nucleotide segments.

In the present invention, all genetic information about viruses occurring in garlic was collected and the classification system was established using the nucleotide sequence of the envelope protein gene. Based on this classification system, we have developed a primer for the specific diagnosis of onion sulfonic atrophy virus species occurring in domestic garlic.

Although many studies have been conducted on plant viruses occurring in garlic, it is difficult to diagnose them because the taxonomic system of these viruses is not established. To this end, they were systematically analyzed through their coat protein sequencing (FIG. 1) to establish the classification system of major viruses occurring in garlic, and to establish a diagnosis system for these viruses.

Within virus species, there are lines or isolates with slightly different sequences. Thus, if isolate-specific primers are used for diagnosis, there is a risk of failure. In other words, the virus diagnostic primer should be species specific for each virus. Primers in the present invention are designed to work species specific. In other words, the nucleotide sequences known to date are collected within the species to search for common nucleotide sequences of all strains and isolates. Then, species-specific sequences were selected by excluding base sequences possessed by other viruses with a flexible relationship among the common sequences. From these species-specific sequences, sequences having optimal conditions as primers were designed as species-specific primers. The designed primers were subjected to the actual reverse transcriptase-polymerase chain reaction (RT-PCR) for each combination and did not have a nonspecific reaction with nucleic acids other than the target virus, and finally selected a combination having excellent sensitivity to the target virus.

Garlic is cultivated in Korea, four kinds of genus 1 virus (GLV, LYSV, GCLV, OYDV and Allexivirus) cause most of the disease. Among them, a species specific diagnostic primer was developed for onion sulfonic atrophy virus (OYDV).

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

At least one primer set according to the present invention; And it provides an OYDV diagnostic kit, comprising a reagent required for RT-PCR. In the kit of the present invention, the reagents required for the RT-PCR may be, for example, but not limited to, a forward primer and a reverse primer, a reverse transcriptase, a ribonuclease inhibitor, a heat resistant polymerase, a reaction buffer, and the like, and a reaction buffer Silver includes both reverse transcriptase and PCR buffer, and heat resistant polymerase may be EF Taq polymerase and the like, and reverse transcriptase is a reverse transcriptase originating from various sources, for example, avian myeloblastosis virus-derived reverse transcriptase. (avian myeloblastosis virus-derived virus reverse transcriptase (AMV RTase)), mouse leukemia virus-derived virus reverse transcriptase (MuLV RTase) and Rouse-associated virus 2 reverse transcriptase 2 reverse transcriptase (RAV-2 RTase).

The kit may also include instructions. The guide is a printed document that explains how to use the kit, such as how to prepare reverse transcription buffer and PCR buffer, and the reaction conditions presented. The instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

In order to achieve another object of the present invention, the present invention

Separating total RNA from garlic samples;

Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using at least one primer set according to the present invention; And

It provides a method for species-specific diagnosis of OYDV, comprising detecting the amplification product.

As a method for separating total RNA from garlic samples, a method known in the art may be used, for example, a phenol extraction method may be used. Using the isolated whole RNA as a template, one or more primer sets according to an embodiment of the present invention may be used as a primer to amplify a target sequence by performing RT-PCR. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, so that the target sequence can be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more sets of oligonucleotide primers used to amplify the target sequence are as described above.

The method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, gel electrophoresis can be performed. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example

Example 1: Design, Selection and Specificity of OYDV Diagnostic Primer

The OYDV consensus sequence search was performed by multiple comparisons of the nucleotide sequences of 25 OYDV isolates known to date (Table 1).

Table 1. OYDV isolate sequences used for consensus sequencing

Separation Gene source Gene size (bp) Yuhang NC005029 10538 Nanjing AJ510224 1570 Dali AJ510225 1570 wakenegi AB000472 1198 shimonitanegi AB000473 1198 rakkyo AB000474 1199 - AB000839 1215 - AB000843 1211 - AB000843 1210 - AB000841 1215 - AB000840 1215 - AB000838 1215 - AB000837 1213 - AB000836 1207 YH1 AJ292231 1623 YH2 AJ292223 1625 YH3 AJ292224 1625 YH2-Yunnan AJ409313 1625 YH1-Yunnan AJ409312 1618 sd-jinxiang AJ409311 1619 js2-Nanjing AJ409310 1625 hub-Wuhan AJ409309 1625 Xixia AJ307033 1625 Nanjing AJ293278 1625 AC41 Y11826 1016

This common sequence was searched for species-specific sequences compared to five viral sequences of Potyviridae (Table 2), which are taxonomically similar to OYDV.

Table 2. Five Fortivirus Genes Used to Find Species Specific Sequences

Fortivirus Gene source Gene size (bp)  Leek yellow stripe virus NC004011 10142  Shallot yellow stripe virus AJ488151 1609  Turnip mosaic virus NC002509 9835  Potato virus Y NC001616 9704  Soybean mosaic virus NC001524 8095

Of these species specific sequences, OYDV diagnostic primers were designed that meet the primer conditions (Table 3).

Table 3. Designed OYDV Diagnostic Primers

primer Sequence Length location ^a OYD-N10 GCTGATAAGCCCGAGCATCGATT (SEQ ID NO: 6) 23 9267-9291 OYD-N20 GGGGTTATCCAGATCTTTTACACG (SEQ ID NO: 7) 24 9322-9345 OYD-N25 CACCNTAYATAGCRGARACAGCTCT (D ^b ) (SEQ ID NO: 1) 25 9415-9439 OYD-N28 ARAAGTTRTTTACYAAYRTTGATGC (D) (SEQ ID NO: 8) 25 9442-9466 OYD-N30 TGTTTACCAATATTGATGCGAGTG (SEQ ID NO: 3) 24 9448-9471 OYD-N40 CAGGCGGGGGAAGGAGAAG (SEQ ID NO: 9) 19 9549-9567 OYD-N50 ACAATCAAGCACGTCACAACAGGT (SEQ ID NO: 10) 24 9578-9601 OYD-N60 AACAGGTCACAAAACAAAAGGATA (SEQ ID NO: 11) 24 9595-9618 OYD-N70 TGATGARCARATGAARATTTTACT (D) (SEQ ID NO: 4) 24 9836-9859 OYD-C10 ATTGTGCCGCTGCATCTTCTCCTT (SEQ ID NO: 12) 24 9559-9580 OYD-C08 TATCCTTTTGTTTTGTGACCTGTT (SEQ ID NO: 13) 24 9595-9618 OYD-C06 ACTGAAATGCGCCATTATYTGYCTA (D) (SEQ ID NO: 2) 25 9992-10016 OYD-C05 ATATAAAACTAAAGACACCAACAC (SEQ ID NO: 14) 24 10330-10353 OYD-C04 AAACGAAATGAAGAGAATTAC (SEQ ID NO: 5) 21 10387-10407 OYD-C03 TCGTTGCTCGAAGTCAGRTTAAACG (D) (SEQ ID NO: 15) 25 10401-10425 OYD-C02 TATCGTTCGCCACAACTAGTGGTAC (SEQ ID NO: 16) 25 10434-10458

^a Primer position based on Yuhang (NC005029)

^b D: Degenerated primer (N = A, T, C, G; Y = T, C; R = A, G)

The designed primer is shown in FIG. 2. Designed OYDV primers in combination of 50 (Table 4), RT-PCR was performed (Fig. 3).

Table 4. OYDV Primer Combinations and RT-PCR Products

Combination primer Product size (bp) One OYD-N10 OYD-C10 314 2 OYD-N10 OYD-C08 352 3 OYD-N10 OYD-C06 750 4 OYD-N10 OYD-C05 1087 5 OYD-N10 OYD-C04 1141 6 OYD-N10 OYD-C03 1159 7 OYD-N10 OYD-C02 1192 8 OYD-N20 OYD-C10 259 9 OYD-N20 OYD-C08 297 10 OYD-N20 OYD-C06 695 11 OYD-N20 OYD-C05 1032 12 OYD-N20 OYD-C04 1086 13 OYD-N20 OYD-C03 1104 14 OYD-N20 OYD-C02 1137 15 OYD-N25 OYD-C08 204 16 OYD-N25 OYD-C06 602 17 OYD-N25 OYD-C05 939 18 OYD-N25 OYD-C04 993 19 OYD-N25 OYD-C03 1011 20 OYD-N25 OYD-C02 1044 21 OYD-N28 OYD-C06 575 22 OYD-N28 OYD-C05 912 23 OYD-N28 OYD-C04 966 24 OYD-N28 OYD-C03 984 25 OYD-N28 OYD-C02 1017 26 OYD-N30 OYD-C06 569 27 OYD-N30 OYD-C05 906 28 OYD-N30 OYD-C04 960 29 OYD-N30 OYD-C03 978 30 OYD-N30 OYD-C02 1011 31 OYD-N40 OYD-C06 468 32 OYD-N40 OYD-C05 805 33 OYD-N40 OYD-C04 859 34 OYD-N40 OYD-C03 877 35 OYD-N40 OYD-C02 910 36 OYD-N50 OYD-C06 439 37 OYD-N50 OYD-C05 776 38 OYD-N50 OYD-C04 830 39 OYD-N50 OYD-C03 848 40 OYD-N50 OYD-C02 881 41 OYD-N60 OYD-C06 422 42 OYD-N60 OYD-C05 559 43 OYD-N60 OYD-C04 813 44 OYD-N60 OYD-C03 831 45 OYD-N60 OYD-C02 864 46 OYD-N70 OYD-C06 181 47 OYD-N70 OYD-C05 518 48 OYD-N70 OYD-C04 572 49 OYD-N70 OYD-C03 590 50 OYD-N70 OYD-C02 623

OYDV, which was used for species-specific primer selection, was used as RT-PCR template by separating the whole RNA by collecting leaves showing mosaic symptoms from naturally infected garlic. Total RNA isolation and RT-PCR methods used in the present invention are as follows.

Total RNA Isolation: Total RNA was isolated from 50 mg of virus infected leaf tissue using phenol. The isolated total RNA was finally washed three times with 75% ethanol, dried, dissolved in 50 μl of distilled water and used for RT-PCR analysis.

RT-PCR: Reverse transcription reaction consists of 0.5 μl total RNA isolated, 12.5 pmole reverse primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM DTT) , pH 8.5) 1 μl, 0.5 μl of 10 mM dNTP, 10 U RNase inhibitor, and 5 μl of the reaction solution containing 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out in 5 μl of reverse transcription reaction with 12.5 pmole forward primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 2 μl of 15 mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds, and finally treated at 72 ° C for 7 minutes. RT-PCR products were identified by electrophoresis using 0.5X TBE buffer and 1.5% agarose gel followed by staining with ethidium bromide.

The first selected primer pairs were subjected to RT-PCR with other Pottyviruses and viruses occurring in garlic (FIG. 4), and finally, five diagnostic primers and three primer pairs using the same were selected (FIG. 4). Table 5).

Table 5. Final Selected OYDV Species Specific Primer Combinations

Combination Forward primer Reverse primer Product size (bp) 16 OYD-N25 OYD-C06 602 26 OYD-N30 OYD-C06 569 48 OYD-N70 OYD-C04 572

As can be seen in Figure 4, it can be seen that the three primer sets of the present invention can specifically detect or diagnose OYDV.

When the diagnostic method of the present invention is carried out, industrialization of the RT-PCR diagnostic kit for garlic virus is possible first, and by using this diagnostic method, it is possible to produce disease-free garlic that is not infected with the virus. It is expected to be very large.

Figure 1 shows the establishment of the taxonomic system of viruses occurring in garlic using the envelope protein gene sequence. Isolators shown in red are domestic isolates.

Figure 2 shows the designed OYDV primer position.

3 shows the RT-PCR results of 50 primer pairs in combination with OYDV. Lanes 1 to 50 represent OYDV primer combinations 1 to 50, respectively, described in Table 4.

Figure 4 shows the RT-PCR results with the other Potiovirus, garlic generating virus of the final selected Onion Sulfation Virus (OYDV) primer combination.

A: GLV (Garlic latent virus)

B: LYSV (Leek yellow stripe virus)

C: GCLV (Garlic common latent virus)

D: Allexivurs (Alexi virus)

PepMOV (Pepper mottle virus)

TBRV (Tomato black ring virus)

PVY (Potato virus Y)

SMV (soybean mosaic virus)

TuMV (Turnip mosaic virus, turnip mosaic virus)

WMV (Watermelon mosaic virus)

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Specific primers for detection of Onion yellow dwarf virus, and          uses according <130> PN08151D <160> 16 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OYD-N25 primer <400> 1 caccntayat agcrgaraca gctct 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OYD-C06 primer <400> 2 actgaaatgc gccattatyt gycta 25 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-N30 primer <400> 3 tgtttaccaa tattgatgcg agtg 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-N70 primer <400> 4 tgatgarcar atgaarattt tact 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OYD-C04 primer <400> 5 aaacgaaatg aagagaatta c 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OYD-N10 primer <400> 6 gctgataagc ccgagcatcg att 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-N20 primer <400> 7 ggggttatcc agatctttta cacg 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OYD-N28 primer <400> 8 araagttrtt tacyaayrtt gatgc 25 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OYD-N40 primer <400> 9 caggcggggg aaggagaag 19 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-N50 primer <400> 10 acaatcaagc acgtcacaac aggt 24 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-N60 primer <400> 11 aacaggtcac aaaacaaaag gata 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> 223 OYD-C10 primer <400> 12 attgtgccgc tgcatcttct cctt 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-C08 primer <400> 13 tatccttttg ttttgtgacc tgtt 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OYD-C05 primer <400> 14 atataaaact aaagacacca acac 24 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OYD-C03 primer <400> 15 tcgttgctcg aagtcagrtt aaacg 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OYD-C02 primer <400> 16 tatcgttcgc cacaactagt ggtac 25  

Claims (6)

OYDV diagnostic primer set, characterized in that the forward primer is selected from the group consisting of the primers of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 4, the reverse primer is selected from the group consisting of the primers of SEQ ID NO: 2 and SEQ ID NO: 5. The method of claim 1, further comprising: a primer set of SEQ ID NOs: 1 and 2; Primer sets of SEQ ID NOs: 3 and 2; And OYDV diagnostic primer set, characterized in that selected from the group consisting of primer sets of SEQ ID NO: 4 and 5. The method of claim 2, further comprising: a primer set of SEQ ID NOs: 1 and 2; Primer sets of SEQ ID NOs: 3 and 2; And OYDV diagnostic primer set comprising the primer set of SEQ ID NO: 4 and 5. A primer set according to any one of claims 1 to 3; And reagents required for RT-PCR. Separating total RNA from garlic samples; Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using the primer set according to any one of claims 1 to 3; And Detecting species of the amplification product. The method of claim 5, wherein the detection of the amplification product is carried out by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images