KR20200072425A - Primer set for multiple detection of SPCFV, SPV2 and SwPLV and uses thereof - Google Patents

Abstract

The present invention relates to a multiplex reverse transcription polymerase chain reaction (RT-PCT) primer set for multiple detections of sweet potato chlorotic fleck virus (SPCFV), sweet potato virus 2 (SPV2), and sweet potato latent virus (SwPLV) and uses thereof. According to the present invention, when the primer set of the present invention is used, SPCFV, SPV2, and SwPLV can be correctly and quickly detected at the same time and costs and time can be reduced, thereby being economically beneficial and being effectively used for development of production of virus-free sweet potato stocks.

Description

Primer set for multiple detection of SPCFV, SPV2 and SwPLV and uses thereof}

The present invention relates to a primer set for multiple diagnosis of sweet potato chlorotic fleck virus (SPCFV), sweet potato virus 2 (SPV2) and sweet potato latent virus (SwPLV), and uses thereof.

In general, sweet potato virus disease (SPVD) shows signs of atrophy, thin leaves, and malformations due to overlapping infections of the sweet potato feathery mottle virus (SPFMV) and the sweet potato chlorotic stunt virus (SPCSV). It has been reported that the damage such as 20~80% decrease in quantity and deterioration of product quality is largely caused by virus disease. In addition, there is also a report that the quality is deteriorated by 20 to 78% decrease in quantity by SPFMV if it is not renewed from time to time with a good seed tuber or seedling.

There are more than 14 viruses worldwide, including SPFMV, SwPLV, and SPMMV. Among them, there are problems with sweet potatoes, and the clearly identified virus is SPFMV (Sweet potato feathery mottle virus), SPGV (Sweet potato G virus). ), SPMSV (Sweet potato mild specklin virus), SwPLV (Sweet potato latent virus). In addition, in addition to SPFMV, SwPLV, SPGV and SPLCV reported in Korea, four additional viruses SPVC, SPV2, SPSMV-1 and SPCFV were newly tested.

Sweet potato chlorotic fleck virus (SPCFV) is a virus belonging to the genus Carlavirus sp. of the Betaflexiviridae family, and is a filamentous virus of 750-800 nm. It was reported for the first time in a sweet potato with degenerate spots in Peru. The entire sequence was reported to be 9,104 nucleotides and has a typical genetic structure of the color virus.

Sweet potato virus 2 (SPV2) is a virus belonging to the genus Potyvirus sp., the virus size is 850 nm, and is non-persistently transmitted by aphids. It was reported for the first time in Taiwan, and it is serologically separated from Sweet potato feathery mottle virus (SPFMV).Based on the sequence analysis of CP (coat protein) and 3'-non-coding region, 75% of SPFMV, 62% of SwPLV, and SPMSV It was classified as a heterogeneous virus with a low homology of 58%. The two names are Sweet potato virus Y (SPVY), Ipomoea vein mosaic virus (IVVV) and Sweet potato vein mosaic virus (SPVMV).

Another virus belonging to the genus Fortivirus and the genus Fortivirus, SwPLV (Sweet potato latent virus), is a pseudo-virus having a particle size of 700 to 750 nm. SwPLV has only reported the results of sequencing of the coat protein (CP) and 3'-noncoding region, and other virus characteristics have not yet been punctured.

On the other hand, the reverse transcription-polymerase chain reaction (RT-PCR) method, which is commonly used for precise diagnosis in plant viruses, determines the specificity and precision of diagnosis. In general, primers used are designed for the purpose of gene cloning of viruses, and are often not species specific. In addition, there are cases in which non-specific products produced by plants or other viruses are often unsuitable for diagnostic use. In addition, in order to diagnose several types of viruses in the same sample, a reverse transcription-polymerase chain reaction is performed by using various types of primers, respectively, and thus, a high diagnostic cost and labor are required.

On the other hand, Korean Registered Patent No. 14225725 discloses'a primer composition for isothermal amplification reaction for detecting sweet potato leaf dried virus and its use', but the'SPCFV, SPV2 and SwPLV multiple diagnostic primer sets and uses thereof' of the present invention No description has been made.

The present invention has been derived by the above-mentioned needs, the inventors of the oligonucleotide primers of SEQ ID NO: 1 and 2; Oligonucleotide primer set of SEQ ID NOs: 3 and 4; And when using the primer set for detecting the SPCFV (Sweet potato chlorotic fleck virus), SPV2 (Sweet potato virus 2) and SwPLV (Sweet potato latent virus) consisting of the oligonucleotide primer set of SEQ ID NO: 5 and 6, three sweet potato viruses The present invention was completed by confirming that it was possible to detect simultaneously with one RT-PCR reaction.

In order to solve the above problems, the present invention is an oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer set of SEQ ID NOs: 3 and 4; And a set of oligonucleotide primers of SEQ ID NOs: 5 and 6; multiplex RT for multiple diagnosis of Sweet potato chlorotic fleck virus (SPCFV), Sweet potato virus 2 (SPV2) and Sweet potato latent virus (SwPLV) -Provide primer set for PCR.

In addition, the present invention is the primer set; And SPCFV, SPV2 and SwPLV multiple diagnostic kits including reagents for performing an amplification reaction.

In addition, the present invention comprises the steps of isolating total RNA from a sweet potato sample; Amplifying the target sequence by performing the RT-PCR using the primer set as a template and using the isolated total RNA as a template; And detecting a product of the amplification step, multiple methods of diagnosing SPCFV, SPV2 and SwPLV.

Using the primer set of the present invention, sweet potato viruses of SPCFV (Sweet potato chlorotic fleck virus), SPV2 (Sweet potato virus 2) and SwPLV (Sweet potato latent virus) can be accurately and quickly detected simultaneously, and cost and time can be detected. It is economical because it can be reduced, and it can be effectively used in the development and development of disease-free sweet potato virus.

1 shows the results of amplification patterns of SPCFV, SPV2 and SwPLV using the three primer sets (Table 1) of the present invention. M: 100 bp loading molecular marker; 1 to 7: Molds diluted 5 times in a row.

In order to achieve the object of the present invention, the present invention is an oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer set of SEQ ID NOs: 3 and 4; And a set of oligonucleotide primers of SEQ ID NOs: 5 and 6; multiplex RT for multiple diagnosis of Sweet potato chlorotic fleck virus (SPCFV), Sweet potato virus 2 (SPV2) and Sweet potato latent virus (SwPLV) -Provide primer set for PCR.

The primers according to the sequence length of each primer, SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; And oligonucleotides consisting of fragments of 19 or more, 20 or more, 21 or more, 22 or more, or 23 or more consecutive nucleotides in the oligonucleotide primer sequences of SEQ ID NOs: 5 and 6. In addition, the primers SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; And addition, deletion or substituted sequences of base sequences in the oligonucleotide primer sequences of SEQ ID NOs: 5 and 6.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of primer extension products. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the desired DNA or RNA target complexity, as well as the conditions of primer use, such as temperature and ionic strength.

As used herein, oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids, or And an intercalating agent.

In the primer set of the present invention, when using the oligonucleotide primer set of SEQ ID NO: 1 and 2, SPCFV (Sweet potato chlorotic fleck virus) can be detected, and when using the oligonucleotide primer set of SEQ ID NO: 3 and 4, SPV2 (Sweet potato virus 2) can be detected, and using the oligonucleotide primer set of SEQ ID NOs: 5 and 6, SwPLV (Sweet potato latent virus) can be detected, and SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; And using both the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, SPCFV, SPV2 and SwPLV can be detected simultaneously.

Since the primer set of the present invention generates RT-PCR products without interference with each other, it is possible to perform multiplex RT-PCR reaction by adding three sets of primers to one reaction tube.

The present invention also provides the primer set; And SPCFV, SPV2 and SwPLV multiple diagnostic kits including reagents for performing an amplification reaction.

In the kit of the present invention, the reagent for performing the amplification reaction may include reverse transcriptase, DNA polymerase, dNTPs, buffer, and the like. In addition, the kit of the present invention may further include a user guide describing optimal conditions for performing the reaction. The guide is a printout that explains how to use the kit, for example, how to make PCR buffers, and the reaction conditions presented. The handbook includes a brochure in the form of a brochure or leaflet, a label attached to the kit and a description on the surface of the package containing the kit. In addition, the handbook includes information that is disclosed or provided through electronic media, such as the Internet.

The present invention also

Isolating total RNA from the sweet potato sample;

Amplifying the target sequence by performing the RT-PCR using the primer set as a template and using the isolated total RNA as a template; And

It provides a method for multiple diagnosis of SPCFV, SPV2 and SwPLV, comprising detecting the product of the amplification step.

The method of the invention comprises isolating total RNA from a plant sample. The method for separating total RNA from the sample may use any method known in the art, for example, a phenol extraction method. Using the isolated total RNA as a template, RT-PCR may be performed using one or more oligonucleotide primer sets according to an embodiment of the present invention as a primer to amplify a target sequence. Such PCR methods are well known in the art, and commercially available kits may be used.

The method of the present invention includes detecting the product of the amplification step. Detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification product, gel electrophoresis may be performed, and gel electrophoresis may use acrylamide gel electrophoresis or agarose gel electrophoresis depending on the size of the amplification product. In addition, capillary electrophoresis can be performed. For capillary electrophoresis, for example, an ABi Sequencer can be used. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the fluorescence thus labeled is measured using a fluorescence meter. can do. In addition, in the radioactive measurement method, when performing PCR, a radioactive isotope such as ³² P is added to the PCR reaction solution to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or a liquid scintillation counter (liquid). Radioactivity can be measured using a scintillation counter.

Hereinafter, it will be described in detail by examples of the present invention. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Example 1.Development of multiple diagnostic methods for three viruses occurring in sweet potatoes

The primer for discriminating the sweet potato chlorotic fleck virus (SPCFV) was designed for the coat protein (CP) and the nucleic acid binding protein (NaBP), and the primer for discriminating the sweet potato latent virus (SwPLV) is the global sequence of SwPLV. Since there were not many analysis results, the previously reported virus was designed for CP and RNA 3'end regions because only the CP and RNA 3'end regions were sequenced, and the primer for discriminating Sweet potato virus 2 (SPV2) was NIb. (RNA-dependent RNA polymerase encoding region) and CP regions were designed. For discrimination of SPCFV, SPV2 and SwPLV sweet potato viruses, primers selected as described in Table 1 below were used. In the sweet potato sample, the petiole and lower stem epidermis of the diseased leaf were ground with liquid nitrogen, and then the whole genome was extracted using a viral genome extraction kit.

As a reverse transcription (RT) process, 1 μl of genome template, 0.5 μl of 10 pmol of forward and reverse primers, and 10 μl of BCS PCR 2X master mix (Biocube Systems, Korea) were added to prepare a final 20 μl reaction solution to produce RT-PCR. Was performed. In the RT-PCR reaction of the present invention, each tube was constructed to contain all three primer sets, and experiments were conducted. The initial DNA denaturation process was repeated 35 times at 95°C for 5 minutes, for DNA denaturation at 20°C for 20 seconds, for primer annealing at 60°C for 20 seconds, and for DNA chain elongation at 72°C for 45 seconds. Then, finally, the product amplified SPCFV, SPV2, and SwPLV sequences at 72°C for 5 minutes for DNA chain extension were confirmed by electrophoresis for 1 hour and 30 minutes at 100 mV in 1.2% agarose gel. As a result, in the complex infection of SPCFV, SPV2, and SwPLV, there was no contention between primers, and the exact reaction product was identified, and the size of the amplification product also showed a distinct difference. It was confirmed (Fig. 1).

Primer information for multiple detection of SPCFV, SPV2 and SwPLV used in the present invention virus primer Throne Base sequence (5'-3') Estimated size Sequence number SPCFV 417 8526-8547 AGCTGCTCAAACAAGCAAGAGG 579bp One 418 9104-9081 GCTCAAAAGTACTTTAAAACATGC 2 SPV2 421 9414-9435 ATGTGTTGAACCATCAGCTGAA 369bp 3 422 9782-9763 GTAACTTGCCTTGGGCTACG 4 SwPLV 415 335-356 GGAGTCAGTTCAATCAATGGTA 183bp 5 416 518-498 AGTGGCTTTATTGGGTATGAT 6

<110> University of Seoul Industry Cooperation Foundation <120> Primer set for multiple detection of SPCFV, SPV2 and SwPLV and uses thereof <130> PN19360 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 agctgctcaa acaagcaaga gg 22 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gctcaaaagt actttaaaac atgc 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 atgtgttgaa ccatcagctg aa 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gtaacttgcc ttgggctacg 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggagtcagtt caatcaatgg ta 22 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agtggcttta ttgggtatga t 21

Claims (5)

Oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer set of SEQ ID NOs: 3 and 4; And a set of oligonucleotide primers of SEQ ID NOs: 5 and 6; multiplex RT for multiple diagnosis of Sweet potato chlorotic fleck virus (SPCFV), Sweet potato virus 2 (SPV2) and Sweet potato latent virus (SwPLV) -Primer set for PCR. The primer set according to claim 1; And SPCFV, SPV2 and SwPLV multiple diagnostic kits comprising reagents for performing an amplification reaction. The kit for SPCFV, SPV2 and SwPLV multiple diagnostics according to claim 2, wherein the reagent for performing the amplification reaction comprises reverse transcriptase, DNA polymerase, dNTPs and buffer. Isolating total RNA from the sweet potato sample;
Amplifying a target sequence by using the isolated total RNA as a template and performing RT-PCR (Reverse transcription polymerase chain reaction) using the primer set of claim 1; And
A method of multi-diagnosing SPCFV, SPV2 and SwPLV, comprising detecting the product of the amplification step. The method of claim 4, wherein the detection of the amplification product is performed through DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, to multi-diagnose SPCFV, SPV2, and SwPLV.

Images