KR102526287B1 - Composition for anti-inflammation and anti-wrinkle comprising fermentative product of Gryllus bimaculatus extract as effective component - Google Patents

Abstract

The present invention relates to an anti-inflammatory and anti-wrinkle composition containing a fermented product of a cricket extract of the present invention as an active ingredient. Since it is excellent, it will be very useful as an anti-inflammatory and anti-wrinkle composition.

Description

Composition for anti-inflammation and anti-wrinkle comprising fermentative product of Gryllus bimaculatus extract as effective component}

The present invention relates to an anti-inflammatory and anti-wrinkle composition containing a fermented product of Ssangbyeol cricket extract as an active ingredient.

Skin aging refers to both tangible and intangible changes that appear in the skin with age, and can be divided into endogenous physiological aging, which is naturally induced as age increases, and extrinsic photoaging, which is progressed by long-term exposure to ultraviolet rays. . The clinical features of endogenous skin aging are thinning of the skin and a decrease in elasticity, and histological findings include thinning of the epidermis and dermis, reduction of blood vessels, and a decrease in the number of fibroblasts in the dermis. In addition, the clinical features of extrinsic skin aging, photoaging, are rough skin, loss of elasticity, irregular pigmentation, and an increase in deep wrinkles.

Various causes of wrinkles have been reported. First, when the skin is exposed to excessive ultraviolet rays, the decomposition of collagen, which is a component of the skin, is promoted, and the skin loses elasticity and wrinkles may be generated. In addition, when the skin becomes excessively dry due to excessive temperature changes, low humidity, or wind, the function of the skin as a barrier against the outside is deteriorated, resulting in wrinkles. In addition, when the skin is exposed to reactive oxygen species or free radicals, lipid peroxide is produced by oxidation, and as a result, skin constituent proteins such as collagen are transformed, resulting in wrinkles. In order to suppress the occurrence of wrinkles caused by these external and internal factors, research on various cosmetic compositions has been conducted. However, in the case of functional cosmetics containing chemical components, there is a problem that causes skin irritation and is not suitable for sensitive skin, so attention is focused on functional cosmetics derived from natural plants that are less irritating to the skin and are eco-friendly.

The twin cricket ( Gryllus bimaculatus ) is an insect of the grasshopper order Cricketidae, and its growing period is as short as 90 days, so it can be reared in large quantities indoors throughout the year. Like mealworms, the larvae of brown mealworms, it is used for pet food or pet insects, and has recently been recognized as a temporary food ingredient by the Ministry of Food and Drug Safety.

Meanwhile, Korean Patent No. 2085577 discloses 'a composition for preventing, improving or treating fatty liver disease containing Ssangbyeol cricket extract as an active ingredient', and Korean Patent Publication No. 2020-0069250 discloses 'Ssangbyeol cricket extract as an effective ingredient'. A composition for protecting against liver damage caused by alcohol' is disclosed, but nothing is described about the 'composition for anti-inflammatory and wrinkle improvement containing fermented extract of Ssangbyeol cricket extract as an active ingredient' of the present invention.

The present invention was derived from the above needs, and the inventors confirmed the anti-inflammatory effect of the fermented product of Ssangbyeol cricket extract, and confirmed the excellent skin wrinkle improvement effect through the analysis of collagenase and elastase inhibitory activities. The invention was completed.

In order to solve the above problems, the present invention provides a cosmetic composition for anti-inflammatory and wrinkle improvement containing fermented product of Gryllus bimaculatus extract as an active ingredient.

In addition, the present invention provides a health functional food composition for anti-inflammatory and wrinkle improvement containing fermented product of Gryllus bimaculatus extract as an active ingredient.

The fermented product of the Ssangbyeol cricket extract of the present invention has anti-inflammatory activity and excellent collagenase and elastase inhibitory activity, so it can be usefully used as a material for cosmetic or health functional food compositions for anti-inflammatory and skin wrinkle improvement It is expected that

Figure 1 shows the results of confirming the number of viable cells (A) and pH (B) during fermentation for 96 hours by inoculating B. subtilis JB PMB-18 strain in the extract of Ssangbyeol cricket.
Figure 2 is the result of confirming the cytotoxicity in RAW 264.7 cells of the fermented product of the cricket pair extract.
Figure 3 is the result of confirming the NO production inhibition ability of the fermented product of the pair-byeol cricket extract in RAW 264.7 cells in which inflammation was induced by LPS.
Figure 4 shows the relative expression level for β-actin as a result of confirming the ability to inhibit COX-2 (A) and iNOS (B) expression of fermented cricket extracts in RAW 264.7 cells in which inflammation was induced by LPS.
Figure 5 is a result of confirming the inflammatory cytokine production inhibition ability of the fermented product of the cricket extract in RAW 264.7 cells in which inflammation was induced by LPS, A is the amount of TNF-α, B is the amount of IL-1β, and C is the amount of IL-1β. It is the production amount of IL-6.
6 is a result of confirming the anti-wrinkle effect of fermented cricket extract, A indicates collagenase inhibitory activity, and B indicates elastase inhibitory activity.

In order to achieve the object of the present invention, the present invention provides a cosmetic composition for anti-inflammatory and wrinkle improvement containing fermented product of Gryllus bimaculatus extract as an active ingredient.

In the cosmetic composition for improving skin wrinkles of the present invention, the fermented product of the extract of the cricket pair is prepared by inoculating the extract of the cricket pair with a strain of the genus Bacillus and fermenting it. The strain of the genus Bacillus is preferably Bacillus subtilis. ( Bacillus subtilis ) It may be a strain, and most preferably, it may be a Bacillus subtilis JB PMB-18 strain possessed by Jeonju Agricultural Biomaterials Research Institute, but is not limited thereto.

In addition, the fermented product of the twin cricket extract is preferably fermented at 30 to 40 ° C for 1 to 3 days by inoculating the Bacillus subtilis JB PMB-18 strain into the twin star cricket extract, and fermented at 37 ° C for 2 days is the most Preferred, but not limited thereto.

In addition, as the extraction solvent of the Ssangbyeol cricket extract, a conventional extraction solvent known in the art may be used. A preferred extraction solvent may be a C ₁ ~ C ₄ lower alcohol, water, or a mixture thereof, and the most preferred extraction solvent may be water, but is not limited thereto.

The extraction method of the twin cricket extract can be extracted using all conventional methods known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction and ultrasonic extraction, and a preferred extraction method is hot water extraction, Not limited.

In addition, the Ssangbyeol cricket extract is an extract obtained by extraction treatment; Dilutions or concentrates of extracts; dried product obtained by drying the extract; adjusted offerings; Or it may include any one of the purified water.

In the present invention, 'wrinkle improvement' refers to suppressing or inhibiting the formation of wrinkles on the skin, or alleviating already generated wrinkles.

The fermented product of the cricket extract of the present invention can suppress the production of NO, COX-2, iNOS and various inflammatory cytokines, and is characterized by excellent activity of inhibiting the activities of collagenase and elastase.

The cosmetic composition for improving wrinkles of the present invention is cream, softening lotion, nutrient lotion, pack, essence, hair tonic, shampoo, rinse, hair conditioner, hair treatment, gel, skin lotion, skin softener, skin toner, astringent, milk lotion , Moisture lotion, nutrient lotion, massage cream, nutrient cream, moisture cream, hand cream, foundation, nutrient essence, sunscreen, soap, cleansing foam, cleansing lotion, cleansing cream, any one selected from the group consisting of body lotion and body cleanser It may have a formulation of, but is not limited thereto. The cosmetic composition composed of each of these formulations may contain various bases and additives necessary and appropriate for formulation of the formulation, and the types and amounts of these components can be easily selected by those skilled in the art.

When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide as a carrier component etc. can be used.

When the formulation of the cosmetic composition of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydro propellants such as carbon, propane butane or dimethyl ether.

When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene fatty acid esters of glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan.

When the formulation of the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.

When the formulation of the cosmetic composition of the present invention is surfactant-containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, Fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives, or ethoxylated glycerol fatty acid esters may be used.

In addition, the present invention provides a health functional food composition for anti-inflammatory and wrinkle improvement containing fermented product of Gryllus bimaculatus extract as an active ingredient.

When using the health functional food composition of the present invention as a food additive, the health functional food composition may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods. Active ingredients can be appropriately used depending on their purpose of use (prevention or improvement). In general, when preparing food or beverage, the health functional food composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term intake for health purposes, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

There is no particular limitation on the type of health functional food. Examples of foods to which the health functional food composition can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea There are drinks, alcoholic beverages, and vitamin complexes, and includes all health foods in a conventional sense.

In addition, the health functional food composition of the present invention can be made into food, particularly functional food. The functional food of the present invention may contain ingredients that are commonly added. Examples include proteins, carbohydrates, fats, nutrients and seasonings. For example, when prepared as a drink, natural carbohydrates or flavors may be included as additional ingredients in addition to active ingredients. The natural carbohydrates are monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.), oligosaccharides, polysaccharides (eg, dextrins, cyclodextrins, etc.) or sugar alcohols (eg, maltose, sucrose, etc.) , xylitol, sorbitol, erythritol, etc.) are preferred. As the flavoring agent, natural flavoring agents (eg, thaumatin, stevia extract, etc.) and synthetic flavoring agents (eg, saccharin, aspartame, etc.) may be used.

In addition to the health functional food composition, various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonic acid It may further contain a carbonation agent used in beverages and the like. The ratio of the components to be added is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food composition of the present invention.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited thereto.

Preparation Example 1. Preparation of Ssangbyeol cricket extract

Paired crickets were purchased from MG Natural and used in the experiment. 500 g of crushed crickets were mixed with 5 L of tertiary sterilized distilled water, followed by hot water extraction at 80°C for 3 hours. Thereafter, centrifugation was performed at 8,000 rpm for 15 minutes, and the supernatant was filtered using filter paper (Adventec, No. 2), followed by lyophilization to obtain a total of 59.09 g of extract.

Preparation Example 2. Preparation of fermented product of Ssangbyeol cricket extract

Bacillus subtilis was inoculated into the cricket extract prepared by the above method and fermented to prepare a fermented product of the cricket extract. The strain used for fermentation is the B. subtilis JB PMB-18 strain owned by Jeonju Agricultural Biomaterials Research Institute, inoculated into 100 ml of NB (Nutrient Broth) medium, and pre-cultured for 24 hours at 37 ° C and 200 rpm After removing the supernatant by centrifugation at 5,000 rpm for 10 minutes, the strain was prepared for fermentation by washing once with PBS. 0.5 g of the cricket extract of Preparation Example 1 was added to 100 ml of distilled water, and the prepared strain was inoculated at a concentration of 2% (v/v) and fermented at 37° C. and 200 rpm for 48 hours. Thereafter, the supernatant was collected by centrifugation at 8,000 rpm for 20 minutes, filtered through a 0.45 μm filter, and lyophilized to obtain a fermented product of the extract of the cricket pair.

Example 1. Measurement of viable cell count and pH change

The B. subtilis JB PMB-18 strain was inoculated into the cricket extract of Preparation Example 1, and the viable cell count and pH were measured during fermentation for 96 hours. The viable cell count was diluted stepwise by 10 times with sterile saline in 1 ml of the sample, and then 100 μl was spread on NB solid medium and cultured at 37° C. for 24 hours, and the number of colonies produced was counted. pH was measured using a pH meter by taking a sample of 1 ml.

As a result, it was confirmed that the number of viable cells in the initial stage of fermentation was 5.42 log CFU/ml, and the highest number of viable cells was 9.88 log CFU/ml after 48 hours of fermentation. In addition, the pH of the Ssangbyeol cricket extract before fermentation was 6.5, and it was confirmed that it gradually increased during fermentation and reached pH 8.2 at the end of fermentation (FIG. 1).

Therefore, it was confirmed that fermentation for 48 hours was the most active growth of bacteria, and then the experiment was conducted.

Example 2. Cytotoxicity assay

RAW 264.7 cells, a mouse macrophage cell line, were purchased and used from the Korea Cell Line Bank (Korea Cell Line Bank, KCLB, No. 40071) and DMEM (Dulbecco Modified Eagle Medium, Korea) containing 10% FBS (fetal bovine serum, USA). ) culture medium at 37° C., 5% CO ₂ in an incubator, and subculture was performed once every 3 days. RAW 264.7 cells were seeded in a 96-well plate at 5×10 ⁴ cells/well and cultured for 24 hours to stabilize. 100 μl of the fermentation product was added to each well and incubated for 24 hours. Remove the culture medium, add 5 mg/mL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) to each well, incubate for 4 hours, remove the supernatant, and DMSO ( dimethyl sulfoxide) was dispensed by 100 μl to dissolve all crystals generated in each well, and absorbance was measured at 570 nm using a microplate reader (Multiskan Go, Thermo Scientific, USA), and cell viability was calculated using the following formula. analyzed.

Cell viability (%) = [absorbance of sample treatment group / absorbance of control group] X 100

As a result, it was confirmed that the fermented products of 50, 100, 500, and 1,000 μg/ml of cricket extracts showed a viability of 90% or more in RAW 264.7 cells, and did not exhibit cytotoxicity (FIG. 2).

Example 3. Anti-inflammatory activity assay

The anti-inflammatory activity of the fermented product of the cricket extract was analyzed in RAW 264.7 cells, a mouse macrophage cell line in which inflammation was induced by LPS (lipopolysaccharide).

(1) Measurement of NO production inhibition ability

NO (nitric oxide) plays an important role as a defense molecule in the immune system, but if it is excessively increased, it causes damage to the NO-producing cells themselves and surrounding cells, tissues, and organs, leading to diseases such as arthritis, bronchitis, multiple sclerosis, and autoimmune diseases. cause the same pathological reaction. Therefore, in order to analyze the anti-inflammatory activity of the fermented product of the Ssangbyeol cricket extract, the NO production inhibitory ability was measured. RAW 264.7 cells were seeded in a 96-well plate at 5×10 ⁴ cells/well, cultured for 24 hours to stabilize, and then 50, 100, 500, and 1,000 μg/ml of D. cricket extract diluted in serum-free DMEM medium. The fermentation product was pretreated for 2 hours and then treated with LPS (1 μg/ml) and cultured for 24 hours. The amount of NO produced was measured in the form of NO ₂ ^- present in the cell culture medium using a grease reagent (Griess Reagent System, Promega, USA). 50 μl of the cell culture supernatant was treated with 100 μl of grease reagent, and absorbance was measured at a wavelength of 540 nm within 30 minutes.

As a result, the amount of NO production in the LPS-only treatment group was significantly increased compared to the control group, and the amount of NO production in the fermented product treatment group of the cricket extract of 1,000 μg/ml was decreased. It was confirmed that the inhibition of NO production was about 79.1% compared to the treated group and about 67% compared to the 1,000 μg/ml twin-byeol cricket extract treated group (FIG. 3).

(2) Measurement of COX-2 and iNOS production inhibitory ability

Cyclooxygenase-2 (COX-2) and inducible nitric oxide synthases (iNOS) are proteins involved in the production pathway of NO and PGE2 (Prostaglandin 2) produced by inflammatory responses in macrophages. COX-2 is not expressed under normal physiological conditions, but is known to be expressed by tumor promoters, growth factors, and cytokines. iNOS is expressed by stimuli such as LPS, IFN-γ, IL-1 and TNF-α and is known to be involved in NO production. RAW 264.7 cells were seeded in a 6-well plate at 1×10 ⁶ cells/well, cultured for 24 hours to stabilize, and fermented products of 100, 500, and 1,000 μg/ml of D. cricket extract diluted in serum-free DMEM medium. was pre-treated for 2 hours and then treated with LPS (1 μg/ml) and cultured for 24 hours. Thereafter, the medium was centrifuged at 12,000 rpm for 3 minutes, and RNA was extracted and quantified from the resulting pellet. PCR was performed with a total of 20 μl of reaction solution by synthesizing cDNA with 1 μg of RNA and mixing with primers, sterile water and a master mix, and the primers used are shown in Table 1 below.

Primer information used in the present invention gene Sequence (5'-3') sequence number COX-2 (F)CTCTACAACAACTCCATCCT One (R)ATTCTGCAGCCATTTCCTTC 2 iNOS (F)CGAAACGCTTCACTTCCAA 3 (R) TGAGCCTATATTGCTGTGGCT 4 β-actin (F)CGGTTCCGATGCCCTGAGGCTCTT 5 (R)CGTCACACTTCATGATGGAATTGA 6

As a result, the expression levels of COX-2 and iNOS in the LPS-only treated group were significantly increased compared to the control group, and the expression levels in the fermented cricket extract-treated group were decreased. In particular, 100 μg/ml fermented cricket extract treatment group decreased COX-2 expression by about 55% and iNOS expression decreased by about 46.1% compared to the fermented cricket extract treatment group. It was confirmed that the COX-2 and iNOS production inhibitory ability was superior to that of this paired cricket extract (FIG. 4).

(3) Measurement of the ability to inhibit the production of inflammatory cytokines

RAW 264.7 cells were seeded in a 24-well plate at 5×10 ⁵ cells/well and cultured for 24 hours to stabilize. The fermentation product was pretreated for 2 hours and then treated with LPS (1 μg/ml) and cultured for 24 hours. Thereafter, the amount of inflammatory cytokines TNF-α (tumor necrosis factor alpha), IL-1β (Interleukin 1 beta) and IL-6 (Interleukin 6) produced in the supernatant obtained by centrifugation at 12,000 rpm for 3 minutes was measured. Each cytokine was quantified using an ELISA kit (R&D systems Inc., USA), and the standard curve R ² value for the standard was 0.9 or more.

As a result, it was confirmed that the production of TNF-α, IL-1β, and IL-6 cytokines in the LPS-only treatment group was significantly increased compared to the control group, and the production of inflammatory cytokines in the fermented product treatment group of the paired cricket extract was decreased. In addition, it was confirmed that cytokine production at a level similar to that of the untreated control was detected when fermented products of 500 and 1,000 μg/ml of cricket extract were treated. In particular, it was confirmed that the inflammatory cytokine production inhibition ability of the fermented product of the twin-byeol cricket extract was remarkably superior to that of the twin-byeol cricket extract (FIG. 5).

Example 4. Analysis of anti-wrinkle effect

Since collagenase and elastase are enzymes that degrade extracellular matrix proteins to promote skin wrinkles, the collagenase and elastase inhibitory activities of the fermented extract of the cricket cricket of the present invention were measured.

(1) Measurement of collagenase inhibitory activity

Collagenase inhibitory activity was analyzed using the ^EnzChek® Gelatinase/Collagenase Assay Kit (ThermoFisher Scientific). Fermented products of 100 and 500 μg/ml of cricket extract were prepared, and the substrate and collagenase enzyme in the kit were placed in a 96-well plate and reacted at 25° C. for 1 hour. Using a fluorescence plate analyzer, the fluorescence intensity was measured under the condition that the absorption wavelength was 495 nm and the emission wavelength was 515 nm, and the collagenase inhibitory activity was calculated through the following formula.

Collagenase inhibitory activity (%) = {1- (S-B) / C} × 100

(S: absorbance of sample, B: absorbance of blank, C: absorbance of control)

As a result, it was confirmed that the fermented cricket extract had very good collagenase inhibitory activity (FIG. 6A).

(2) Measurement of elastase inhibitory activity

Elastase inhibitory activity was analyzed using EnzChek ^® Elastase Assay Kit (ThermoFisher Scientific). Fermented products of 50, 100, and 500 μg/ml of cricket extract were prepared, and then the substrate and elastase enzyme in the kit were placed in a 96-well plate and reacted at 25° C. for 50 minutes. The fluorescence intensity was measured using a fluorescence plate analyzer under the condition that the absorption wavelength was 505 nm and the emission wavelength was 515 nm, and the elastase inhibitory activity was calculated through the following formula.

Elastase inhibitory activity (%) = {1-(S-B)/C}×100

(S: absorbance of sample, B: absorbance of blank, C: absorbance of control)

As a result, it was confirmed that the elastase inhibitory activity of the fermented product of the cricket extract was increased in a concentration-dependent manner (Fig. 6B).

Through the above results, it was found that the fermented product of the extract of the cricket twine had an excellent anti-wrinkle effect, while the extract of the cricket twine had almost no effect on wrinkles.

<110> JEONJU BIOMATERIALS INSTITUTE <120> Composition for anti-inflammation and anti-wrinkle comprising fermentative product of Gryllus bimaculatus extract as effective component <130> PN20305 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 1 ctctacaaca actccatcct 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 attctgcagc catttccttc 20 <210> 3 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 cgaaacgctt cacttccaa 19 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 tgacctata ttgctgtggc t 21 <210> 5 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 cggttccgat gccctgaggc tctt 24 <210> 6 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 cgtcacactt catgatggaa ttga 24

Claims (6)

A cosmetic composition for anti-inflammatory and anti-wrinkle improvement containing a fermented product prepared by inoculating and fermenting Bacillus subtilis in hot water extract of Gryllus bimaculatus as an active ingredient. delete The cosmetic composition for anti-inflammatory and anti-wrinkle improvement according to claim 1, wherein the fermentation is performed at 30 to 40° C. for 1 to 3 days. delete The cosmetic composition for anti-inflammatory and anti-wrinkle improvement according to claim 1, wherein the anti-wrinkle is reduced in activity of collagenase and elastase. A health functional food composition for anti-inflammatory and anti-wrinkle improvement containing a fermented product prepared by inoculating and fermenting Bacillus subtilis in hot water extract of Gryllus bimaculatus as an active ingredient.

Images