KR102337346B1 - Cosmetic composition containing extract of Pinus rigida Mill. for antioxidative or anti-aging - Google Patents

Abstract

The present invention relates to an antioxidant or anti-aging composition comprising a Rigida pine bark extract or fraction.
When the Rigida pine bark extract of the present invention, or a fraction thereof, is used as an active ingredient, there is an effect of increasing the expression levels of procollagen and TIMP-1 in a concentration-dependent manner. In addition, by promoting TIMP-1 expression, it inhibits the activity of matrix-metalloproteinase (MMPs) and reduces the decomposition of extracellular matrix proteins, so it has the effect of suppressing wrinkle formation and has an antioxidant effect by inhibiting the generation of reactive oxygen species (ROS) .
Therefore, since it has anti-aging and antioxidant effects that improve wrinkles and elasticity due to light conditions, it can be usefully used in various fields such as antioxidant or anti-aging cosmetics, health functional food compositions, and the like.

Description

An antioxidant or anti-aging composition comprising an extract of Rigida pine bark as an active ingredient {Cosmetic composition containing extract of Pinus rigida Mill. for antioxidative or anti-aging}

The present invention relates to an antioxidant or anti-aging composition comprising a Rigida pine bark extract or fraction.

Aging is a physiological phenomenon that cannot be avoided by anyone, and the human body structure and function undergo unavoidable changes over time, which can be called aging. Natural skin aging is also called intrinsic skin aging (chronological skin aging) as a skin aging phenomenon observed in skin that is not exposed to sunlight. Intrinsic aging is caused by reactive oxygen species (ROS) generated during cell metabolism in cells present in the skin, and extrinsic aging is caused by external factors such as ultraviolet (UV) and pollution ( Myungsu Son et al., 2013), and photoaging accounts for the majority of extrinsic aging.

The skin is mainly composed of the epidermis, dermis, and subcutaneous fat layer. In particular, the dermis is a connective tissue between the epidermis and the subcutaneous fat layer, which provides flexibility, elasticity and tension to the skin and structurally supports the epidermis. The fibroblasts of the dermal layer are responsible for the expression of collagen and elastin, which are fibrous proteins of the dermal layer. The synthesis of structural proteins of the back is reduced, moisture in the skin cells is lost, and the structure of the stratum corneum is changed (Kim et al., 2008).

Repeated UV exposure increases the matrix metalloproteinases (MMPs) of the skin, and the increased MMPs degrade the collagen fibers of the skin. Repetition of this phenomenon leads to the formation of skin folds (Fisher et al., 2002). In particular, in the dermis, the MAP kinase pathway is activated by UV light to induce the expression of activator protein-1 (AP-1) and the expression of MMPs. increase to promote wrinkle formation (So et al., 2008).

Collagen is a major matrix protein produced by fibroblasts of the skin and exists in the extracellular matrix, and important functions are known as mechanical firmness of the skin, resistance of connective tissue and binding force of tissues, and support of cell adhesion. This collagen decreases with age and external stimuli such as ultraviolet rays, which is known to be closely related to the formation of wrinkles on the skin. With aging, not only the synthesis of collagen itself decreases, but also the activity of MMPs (matrix metalloproteinase) that decomposes connective tissue including collagen increases, which promotes collagen breakdown in skin tissue, causing the content of collagen to decrease It is known that this can happen. Tissue Inhibitors of Matrix Metalloproteinase (TIMP), an intrinsic inhibitor that inhibits these MMPs, exists. When the activities of MMPs and TIMPs are balanced and properly regulated, physiological tissue reorganization and homeostasis are well maintained.

Four types of TIMP are known: TIMP-1, TIMP-2, TIMP-3, and TIMP-4. Among them, TIMP-1 is particularly MMPs such as MMP-1 and gelatinase (MMP-2, MMP-9). It binds to the active site of , and inhibits their degradation almost irreversibly. In other words, collagen in the skin, which is an important cause of skin wrinkles due to aging, is not only reduced in synthesis but also accelerated, and MMPs and TIMPs are responsible for the main function of this homeostasis. This accelerates skin aging and TIMP-1 inhibits it.

On the other hand, Rigida pine ( Pinus rigida Mill.) is also called trifoliate, American trifolium, and three-leaf pine. It grows well in dry places or wetlands. It is native to North America and reaches a height of about 25 m and a diameter of about 1 m in its origin. It is easily distinguished from other pines because its branches spread widely and the budding power is strong, so short branches appear from the main stem and the leaves are hanging. Pine bark is derived in large quantities as a by-product in the wood industry and is mainly used as a heat source by incineration or discarded. However, pine bark is a major source of proanthocyanidins (PAs), and bark extract is used as a dietary supplement for the prevention and treatment of skin aging and cardiovascular diseases in Europe and other countries (Rohdewald, P., Int. J. Clin. Pharmacol. Ther., 40: 158 (2002).

Accordingly, the present inventors studied to develop a composition for antioxidation and anti-wrinkle improvement using pine bark, and developed a Rigida pine bark extract that can be used as a functional cosmetic material.

It is an object of the present invention to provide a cosmetic composition for antioxidant or anti-aging comprising Rigida pine bark extract or a fraction thereof as an active ingredient.

It is also an object of the present invention to provide a health functional food composition for antioxidant or anti-aging comprising Rigida pine bark extract, or a fraction thereof.

As one aspect for achieving the above object, the present invention provides a cosmetic composition for antioxidant or anti-aging comprising Rigida pine bark extract, or a fraction thereof, as an active ingredient.

In addition, the present invention provides a health functional food composition for antioxidant or anti-aging comprising Rigida pine bark extract, or a fraction thereof.

When the Rigida pine bark extract of the present invention, or a fraction thereof, is used as an active ingredient, there is an effect of increasing the expression levels of procollagen and TIMP-1 in a concentration-dependent manner.

In addition, by promoting TIMP-1 expression, it inhibits the activity of matrix-metalloproteinase (MMPs), thereby reducing the degradation of extracellular matrix proteins, thereby suppressing the generation of wrinkles and inhibiting the generation of reactive oxygen species (ROS).

Therefore, since it has anti-aging and antioxidant effects that improve wrinkles and elasticity due to light conditions, it can be usefully used in various fields such as antioxidant or anti-aging cosmetics, health functional food compositions, and the like.

1 is a diagram showing the cytotoxicity evaluation results for CCD-986sk human fibroblasts of the ethyl acetate fraction of Rigida pine bark through MTT assay.
Figure 2 (A) is a diagram measuring the expression rate of pro-collagen after treating the ethyl acetate fraction of Rigida pine bark in CCD-986sk human fibroblasts.
Figure 2 (B) is a diagram measuring the expression rate of TIMP-1 after treating the ethyl acetate fraction of Rigida pine bark in CCD-986sk human fibroblasts.
3 is a diagram showing the results of MMP-1, MMP-2, and MMP-3 protein expression levels measured by Western blot after treatment with CCD-986sk human fibroblasts with an ethyl acetate fraction of Rigida pine bark.
4 is a diagram showing the results of MMP-1, MMP-2, and MMP-3 mRNA expression levels measured through RT-PCR after treatment with CCD-986sk human fibroblasts with an ethyl acetate fraction of Rigida pine bark.
5 is a diagram showing the results of measuring the active oxygen (ROS) production inhibitory ability by the treatment of the ethyl acetate fraction of Rigida pine bark in an animal model (zebrafish).

Hereinafter, the present invention will be described in more detail through examples. These Examples are for explaining the present invention in more detail, the scope of the present invention is not limited by these Examples.

The present invention provides a cosmetic composition for antioxidant or anti-aging comprising Rigida pine (Pinus rigida Mill.) bark extract, or a fraction thereof, as an active ingredient.

As used herein, the term "Rigida pine ( Pinus rigida Mill.)" is native to North America and is also called trifolium, American trifolium, and three-leaf pine, and grows well in dry places or wetlands.

In the present invention, the term “comprising as an active ingredient” refers to a degree to which a skin improvement effect can be exhibited, for example, collagen synthesis related to wrinkle improvement effect, elasticity improvement or skin whitening, skin irritation relief, skin soothing effect, etc. It may mean containing an effective amount of

As used herein, the term "Rigida pine bark extract" is a generic term for preparations concentrated by squeezing Rigida pine bark with an appropriate leaching solution and evaporating the leachate. It can be obtained by an extraction process using a mixed solvent thereof, and may include an extract, a diluted or concentrated solution thereof, or a dry powder of the extract, or any form formulated using the same. In addition, in the extraction method, methods such as hot water extraction, hot water extraction, cold-chim extraction, warm-chim extraction, pressure extraction, reflux cooling extraction, or ultrasonic extraction may be used, but are not limited thereto.

In obtaining the Rigida pine bark extract, it may be preferably extracted using water, an organic solvent, or a mixed solvent thereof. In case of extraction using an organic solvent, methanol, ethanol, isopropanol, butanol, ethylene, acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, dichloromethane, N, N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol or an organic solvent that is a mixed solvent thereof can be used, and the active ingredient of the herbal medicine is not destroyed or extracted by heating at room temperature or under conditions in which it is minimized. Depending on the organic solvent to be extracted, the degree of extraction and loss of the active ingredient of the drug may be different, so an appropriate organic solvent should be selected and used.

The solvent extract may further include filtering the extract to remove suspended solid particles. It is possible to filter the particles using cotton, nylon, etc., or to use ultrafiltration, cryofiltration, centrifugation, and the like.

Methods such as reduced pressure concentration, reverse osmosis concentration, etc. may be used for concentration of the extract.

The drying step after concentration includes freeze drying, vacuum drying, hot air drying, spray drying, reduced pressure drying, foam drying, high frequency drying, or infrared drying. In some cases, it may further include a process of pulverizing the final dried extract.

In addition, the extract may be subjected to an additional fractionation process. For example, the extract is suspended in distilled water to extract and separate the non-polar solvent soluble layer with a non-polar organic solvent, for example, hexane, ether, dichloromethane, chloroform, ethyl acetate, or a mixed solvent thereof to obtain, It can be used after concentration and/or drying.

Also in one embodiment, the Rigida pine bark fraction (PRE) of the present invention is obtained by extracting the Rigida pine bark after harvesting with ethanol to obtain an ethanol extract, and then adding 10 times the amount of acetone and water to the ethanol extract 7: After adding at a ratio of 3 (v/v), extraction for 3 days, filtration using filter paper (Whatman No. 2, Tokyo, Japan), and concentration under reduced pressure to obtain a crude acetone extract, and the obtained crude extract It can be obtained by suspending in water and _{fractionating with the same amount of CHCl 3} three times, and then extracting the water layer three times with the same amount of ethyl acetate (EtOAc) to obtain an ethyl acetate fraction.

In the present invention, "functional cosmetics (cosmedical, cosmeceutical)" is a product that has a professional treatment function of pharmaceuticals introduced into cosmetics and emphasizes physiologically active efficacy and effect, unlike general cosmetics, and is used for skin whitening. It refers to cosmetics prescribed by Ordinance of the Ministry of Health and Welfare among products that help, products that help improve skin wrinkles, and products that burn skin finely or protect the skin from UV rays. For the purpose of the present invention, the functional cosmetic refers to a product that helps to improve skin wrinkles.

In the present invention, the cosmetic composition may be prepared in any conventionally prepared formulation, for example, a solution, emulsion, suspension, paste, cream, lotion, gel, powder, spray, surfactant-containing cleansing, oil , soap, liquid detergent, bath agent, foundation, makeup base, essence, lotion, foam, pack, soft water, sunscreen cream or sun oil, etc., but is not limited thereto.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Adult cellulose, aluminum metahydroxide, bentonite, or tracanth may be used.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used.

The cosmetic composition of the present invention may further include conventional adjuvants and carriers such as commonly used antioxidants, stabilizers, solubilizers, vitamins, pigments, fragrances, and the like. For example, the cosmetic composition may further include auxiliary components such as glycerin, butylene glycol, polyoxyethylene hydrogenated castor oil, tocopheryl acetate, citric acid, panthenol, squalane, sodium citrate, and allantoin.

In another aspect, the present invention provides a health functional food composition for antioxidant or anti-aging comprising Rigida pine bark extract, or a fraction thereof.

In the present invention, "health functional food" refers to a food group or food composition that has added value to act and express the function of the food for a specific purpose by using physical, biochemical, bioengineering methods, etc. It refers to food that has been designed and processed to sufficiently express the body control functions related to disease prevention and recovery. For the purpose of the present invention, the health functional food is intended to promote antioxidant activity, for example, refers to a health functional food for preventing and improving diseases caused by free radicals.

In the present invention, the food composition can be prepared by a method commonly used in the art, and during the preparation, it can be prepared by adding raw materials and components commonly added in the art. In addition, the formulation of the food composition may be prepared without limitation as long as it is a formulation recognized as a food composition.

Foods according to the present invention include, for example, various foods, beverages, gum, tea, vitamin complexes, functional foods, and the like. In addition, food includes special nutritional food (eg formula, infant formula, baby food, etc.), processed meat products, fish meat products, tofu, jelly, noodles (eg ramen, noodles, etc.), breads, health supplements, seasoned foods (eg soy sauce). , soybean paste, red pepper paste, mixed paste, etc.), sauces, sweets (eg snacks), candy, chocolate, gum, ice cream, dairy products (eg fermented milk, cheese, etc.), other processed foods, kimchi, pickles (various kimchi) , pickles, etc.), beverages (eg, fruit beverages, vegetable beverages, soy milk, fermented beverages, etc.), natural seasonings (eg, ramen soup, etc.), food additives, etc., but are not limited thereto. The food, beverage or food additive may be prepared by a conventional manufacturing method.

When the composition of the present invention is used as a health functional food additive, the composition may be added as it is or used together with other health functional food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be suitably determined according to the purpose of use. In general, in the production of food or beverage, the composition of the present invention may be added in an amount of preferably 50 parts by weight or less, more preferably 25 parts by weight or less, based on the raw material. However, in the case of long-term intake for the purpose of health control and hygiene, the amount may be less than the above range, and since there is no problem in terms of stability, the active ingredient may be used in an amount above the above range.

The food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional food composition, in addition to containing the Rigida pine bark extract or fraction as an active ingredient. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, erythritol and the like. The above-mentioned flavoring agents can advantageously use natural flavoring agents (Taumatin), stevia extract (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).

In addition, the food composition includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, the food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice beverages and vegetable beverages.

Those skilled in the art to which the present invention pertains will be able to apply by changing the type, introduction ratio, etc. of each configuration based on the description of the present invention, and if equivalent technical effects are realized despite the above modifications, the present invention It will be said to be included in the technical thought of

Through the following examples, the present invention will be described in more detail, but it is obvious that the present invention is not limited by the following examples.

Example 1: Preparation of Rigida pine extracts and fractions

The inner bark of Rigida pine (Pinus rigida Mill.) used in this experiment was collected by removing the outer bark by cutting the test material in November 2016 from the Rigida pine stand in Gyeongsan, Gyeongsangbuk-do.

After extracting the collected Rigida pine bark with ethanol to obtain an ethanol extract, a 10-fold amount of acetone and water was added to the ethanol extract at a ratio of 7: 3 (v/v), and after extraction for 3 days, filter paper (Whatman No. 2, Tokyo, Japan) and concentrated under reduced pressure to make a crude acetone extract, then the crude extract was suspended in water and _{fractionated three times with the same amount of CHCl 3} , and the water layer was again washed with the same amount of ethyl acetate (EtOAc) was extracted three times _{to obtain an ethyl acetate extract and an H 2} O extract.

In the present invention, an ethyl acetate fraction (PRE) from Rigida pine bark obtained by the above process was used.

Example 2: 　 fibroblast CCD-986sk cell line culture

Fibroblast CCD-986sk used for cytotoxicity measurement was purchased from American Culture Collection (ATCC; Manassas, VA, USA). For cytotoxicity measurement and culture medium composition, dulbecco’s modified eagle medium (DMEM), fetal bovine serum (FBS), penicillin/streptomycin, and 0.4% trypan blue stain were obtained from Gibco BRL Co. (Rockville, NE, USA) was purchased and used, and 3-[4,5-dimethylthiazol]-2-yl]-2,5-diphenyl-tetrazoliumbromide (MTT) was obtained from Sigma Chemical Co., Ltd. (St. Louis, MO, USA).

Primary and secondary antibodies of MMP-1, MMP-2, MMP-3, and β-actin were purchased from Santa Cruz (Santa Cruz, CA, USA).

Cultures of each cell used for this experiment was done using DMEM media supplemented with 10% FBS and 1% penicillin / streptomycin (penicillin / streptomycin) (100U / mL), to adjust to _{37 ° C, 5% CO 2} incubator subcultured.

Experimental Example 1: Measurement of cytotoxicity of Rigida pine bark extract or fractions

MTT assay was performed to measure the cytotoxicity of Rigida pine bark ethyl acetate fraction (PRE).

First, 0.18 mL of CCD-986sk cells were aliquoted to 5×10 ³ cells/well in a 96-well plate, and 5, 10, 20, 40, 60, 80, and 100 μg/mL of Rigida pine bark ethyl acetate fraction, respectively. After adding 0.02 mL to the concentration, incubated for 24 hours at _{37°C, 5% CO 2 in an incubator.} Add 0.02 mL of MTT solution prepared at a concentration of 5 mg/mL to this, incubate for 4 hours, remove the culture medium, add 0.15 mL of DMSO to each well, react at room temperature for 15 minutes, and then measure the absorbance at 540 nm with an ELISA reader did The cytotoxicity measurement was expressed as the absorbance reduction rate of the group with and without the addition of the sample solution.

As a result, as shown in FIG. 1, the cell viability was more than 90% at a concentration of 20 μg/mL or less, and the ethyl acetate fraction of Rigida pine bark was found to be non-toxic to CCD-986sk cells. In addition, even at a concentration of 40 μg/mL, it showed more than 80% cell viability, and even at a concentration of 60 μg/mL, it showed about 80% cell viability, so it was confirmed that there was no toxicity to CCD-986sk cells even at a relatively high concentration.

Experimental Example 2: Measurement of Expression Levels of Type-I Procollagen and TIMP-1 Proteins by Treatment of Rigida Pine Bark with Ethyl Acetate Fraction

Experimental Example 2-1: Measurement of Type-I Procollagen Expression Level

Procollagen is a precursor of collagen, has a peptide sequence called propeptide, and is involved in collagen production. Therefore, in order to measure the efficacy of promoting collagen synthesis in CCD-986sk cells irradiated with light according to treatment with the ethyl acetate fraction of Rigida pine bark, the following experiment was conducted to measure procollagen biosynthesis performance.

To measure the amount of procollagen Type-I synthesized by treatment with the ethyl acetate fraction of Rigida pine bark in CCD-986sk cells, the ^{cells were planted in a 24-well plate at 1×10 4} cells/well per well and then stabilized for 24 hours. . Thereafter, the culture medium was removed, 1 mL of PBS was added, UVB (20 mJ/cm ₂ ) was irradiated, and the ethyl acetate fractions of Rigida pine bark were treated by concentration and cultured for 48 hours. After recovering the supernatant from each well, add the pro-collagen Type-I C-Peptide EIA kit (Takara-Bio Inc., Shiga, Japan) to each well, and then follow the manufacturer's method for total pro-collagen Type-I The amount was measured.

As a result, as shown in FIG. 2(A), the expression level of pro-collagen Type-I was 100.0 ± 4.5% in the control group not treated with anything, and 38 ± in the group treated only with ^{UVB (20 mJ/cm 2 ), which is the stimulation group.} 2.9%, 48 ± 2.8 in the group treated with 10 ppm of Rigida pine bark ethyl acetate fraction, 59 ± 1.9% in the group treated with 20 ppm of Rigida pine bark ethyl acetate fraction, and 72 ± 3.5% EGCG in the control group.

Therefore, it was confirmed that the ethyl acetate fraction of Rigida pine bark increased the expression level of pro-collagen Type-I in a concentration-dependent manner despite the light irradiation conditions.

Experimental Example 2-2: TIMP-1 expression level measurement

TIMP-1 acts as an inhibitor of MMPs that decompose collagen by strong non-covalent binding with MMP (matrix-metalloproteinase). Accordingly, when the expression level of TIMP-1 is increased, collagen degradation is inhibited, and the expression level of TIMP-1 by treatment with the ethyl acetate fraction of Rigida pine bark under light irradiation conditions was measured as follows.

After culturing CCD-986sk cells, 1 × 10 ⁵ cells/well were inoculated in a 6 well plate and cultured for 24 hours. After 24 hours, remove the medium and add 1 mL of PBS _{to irradiate with UVB (20 mJ/cm 2} ), remove PBS and replace with DMEM medium that does not contain 10% FBS and 1% penicillin streptomycin Then, the ethyl acetate fraction of Rigida pine bark was diluted with 5, 10, and 20 μg/mL, and then treated and cultured for 48 hours. After taking the supernatant, TIMP-1 (R&D system Inc., MN, USA) was tested according to the kit's protocol, and absorbance was measured at 450 nm with a microplate reader.

As a result, as shown in FIG. 2(B), the expression level of TIMP-1 was 100.0 ± 1.9% in the untreated control group, 43 ± 1.1% in the UVB (20 mJ/cm2) treatment group, which is the stimulation group, and Rigida pine bark In the group treated with 10 ppm of the ethyl acetate fraction, 49 ± 2.3%, Rigida pine bark ethyl acetate fraction was 51 ± 2.7% in the group treated with 20 ppm, and EGCG 62 ± 2.9% in the control group, despite the light irradiation conditions, the ethyl acetate fraction of Rigida pine bark It was confirmed that this TIMP-1 expression level was increased, and in particular, the group treated with 20 ppm of the ethyl acetate fraction of Rigida pine bark showed a significant result.

Experimental Example 3: Measurement of MMP-1, MMP-2, MMP-3 protein synthesis amount by treatment with ethyl acetate fraction of Rigida pine bark

MMPs (matrix-metalloproteinase) is an enzyme that decomposes extracellular matrix, and when the production of MMPs is increased, total collagen production in the skin is reduced. Whether or not was confirmed as follows.

Western blot was performed to measure the amount of MMP-1, MMP-2, and MMP-3 protein synthesis by treatment with the ethyl acetate fraction of Rigida pine bark.

CCD-986sk cells were aliquoted at 1×10 ⁵ cells/wells in a 6 well plate and cultured for 24 hours. After stimulation with UVB of 20 mJ/cm2, ethyl acetate fractions from Rigida pine bark were added by concentration (5, 10, 20 μg). /mL) and treated with 25 μg/mL of control Epigallocatechin gallate (EGCG) and incubated for 48 hours. Cells were lysed with RIPA buffer (Pierce, IL, USA) and centrifuged (12,000 rpm, 4°C, 30 min) to remove cell membrane components to obtain a supernatant. Protein was quantified by Bradford assay, and 20 μL of protein was electrophoresed using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). was transferred over 2 hours. After blocking with tris buffer solution containing 5% skim milk for 1 hour, it was reacted with primary and secondary antibodies of MMP-1, MMP-2, MMP-3, and β-actin, respectively. After reaction, the reaction was carried out for 60 minutes using Immobilon Western Chemiluminescent HRP substrate (Millipore, MA, USA), and then the band density was confirmed by EZ-Capture MG (ATTO corporation, Tokyo, Japan).

As a result, as shown in FIG. 3 , the expression level of MMP-1 protein was measured to be 16 ± 2.5% and 35 ± 1.9% at 10 and 20 μg/mL concentrations, respectively, in spite of the light irradiation condition, and the control group In the case of phosphorus EGCG, it was confirmed that it significantly decreased to 28 ± 1.8% at a concentration of 25 μg/mL. In addition, MMP-2 protein expression levels were 31 ± 2.9% and 58 ± 2.4% at 10 and 20 μg/mL concentrations, respectively, and the control group EGCG was 58 ± 2.2% at 25 μg/mL concentrations. MMP-3 expression levels were 50 ± 2.9% and 49 ± 2.4% at 10 and 20 μg/mL concentrations, respectively, and the control group EGCG was 58 ± 2.2% at 25 μg/mL, confirming excellent MMPs inhibitory ability. .

Experimental Example 4: Measurement of MMPs mRNA expression level by treatment with Rigida pine bark ethyl acetate fraction

In order to observe the effect of UVB stimulation in CCD-986sk cells of the ethyl acetate fraction of Rigida pine bark on MMP-1, MMP-2, and MMP-3 gene expression, mRNA isolation and RT-PCR were performed.

CCD-986sk cells were aliquoted to 1×10 ⁵ cells/well in 6 wells and cultured for 48 hours. After removing the medium, after stimulation with 20 mJ/cm2 of UVB, the ethyl acetate fraction of Rigida pine bark was treated with each concentration (5, 10, 20 μg/mL) and the control EGCG was treated with 25 μg/mL and cultured for 48 hours. did After washing 3 times with PBS, cells were harvested, and total RNA was isolated using the trizol reagent Invitrogen (Carlsbad, CA, USA). 2 μg of Total RNA and PCR primer oligonucleotides were mixed with an RT-PCR mixer and RT-PCR was performed. The primers used are shown in Table 1 below.

Gene Primer Sequence (5' → 3') MMP-1 Forward AGC GTG TGA CAG TAA GCT AA Reverse GTT TTC CTC AGA AAG AGC AGC AT MMP-2 Forward TTG CCA TCC TTC TCA AAG TTG TAG G Reverse CAC TGT CCA CCC CTC AGA GC MMP-3 Forward TTG TTC TTT GAT GCA GTC AGC Reverse GAT TTG CGC CAA AAG TGC GAPDH Forward CCACCCAGTACAGCGTCAAC Reverse CATGGTGCTTCTGTCGCTCT

CCD-986sk cells were lysed using Lysis buffer, and centrifuged at 4°C and 12,000 rpm for 20 minutes. The RT condition was left at 42°C for 1 hour to prepare cDNA, and left at 94°C for 5 minutes to inactivate reverse transcriptase. Subsequent PCR conditions are based on repeating the reaction 30 times at 94°C for 30 seconds (denaturation), at 50°C for 30 seconds (annealing), and at 72°C for 90 seconds (extension). adjusted. The amplified cDNA was separated by electrophoresis using 1.2% agarose gel and confirmed by EZ-Capture MG.

As a result, as shown in FIG. 4 , it was confirmed that the mRNA expression levels of MMPs were all increased in the UVB-irradiated groups. In addition, in the group treated with the ethyl acetate fraction of Rigida pine bark, the expression levels of MMP-1 and MMP-2 mRNA were reduced in a concentration-dependent manner despite the light irradiation conditions. showed a negative rate of decrease.

Experimental Example 5: Measurement of active oxygen (ROS) production inhibitory ability by treatment with ethyl acetate fraction of Rigida pine bark

In order to measure the ability to suppress reactive oxygen species, zebrafish, a vertebrate animal with similar genetic information system and organ system to humans, was selected as an animal model.

The spawned zebrafish embryos (embryo) were each dispensed in a 60mm Petri dish, and then cultured in an incubator (TempMini H2200-H, China) for 2 days and hatched into fry. Rigida pine bark ethyl acetate fraction was dissolved in egg water at a concentration of 5, 10, and 20 μg/mL and treated with 5 ml each, and the negative control group was treated with egg water 5 ml each. After pretreatment of the sample, it was washed with egg water and irradiated for 1 minute under UVB 50 mJ/cm 2 conditions using a UV irradiator (UV-X000, LAB24, Korea). After UVB irradiation, 2′,7′-dichlorofluoroescein diacetate (DCFH-DA, Sigma-Aldrich, USA) was treated with 20 μg/mL and cultured in an incubator for 1 hour. Thereafter, the zebrafish fry were washed with egg water and observed with a fluorescence microscope (Dino-Lite, Taipei).

Measurement of UVB-induced reactive oxygen production ability of zebrafish is the property of generating fluorescent substances by reacting with active oxygen in the form of 2′,7′-dichlorofluoroescein diacetate (DCFH) in which acetyl groups are released after DCFH-DA is penetrated into cells. was used [Kim and Ba, 2015]. After pretreatment with ethyl acetate fraction of Rigida pine bark at concentrations of 5, 10, and 20 μg/mL, the level of reactive oxygen species produced in zebrafish embryos induced with UVB damage was observed with fluorescence. Compared to the positive control group irradiated with only UVB, It was confirmed that the intensity of fluorescence was reduced in a concentration-dependent manner in the group treated with the ethyl acetate fraction of pine bark. In particular, the group treated with 20 μg/mL showed a significant result in that the active oxygen level was reduced by 19.6% compared to the positive control group.

Claims (8)

It contains the bark fraction of Rigida pine ( Pinus rigida Mill.) as an active ingredient,
The fraction was extracted by adding a 10-fold amount of acetone and water to an ethanol extract of Rigida pine bark in a ratio (v/v) of 7: 3, and then concentrated under reduced pressure to obtain a crude acetone extract, and the crude extract was suspended in water. After fractionation with the same amount of CHCl ₃ three times, the water layer is again extracted three times with the same amount of ethyl acetate (EtOAc), which is an ethyl acetate fraction obtained, an antioxidant or anti-aging cosmetic composition. delete delete According to claim 1,
The aging is an antioxidant or anti-aging cosmetic composition, characterized in that due to light. According to claim 1,
The fraction promotes the expression of Type-I Procollagen and TIMP-1 to reduce the degradation of extracellular matrix proteins by MMPs, thereby having an anti-aging effect. According to claim 1,
The fraction is an antioxidant or anti-aging cosmetic composition, characterized in that it has an antioxidant effect by inhibiting the production of active oxygen (ROS). According to claim 1,
The anti-aging cosmetic composition for anti-oxidation or anti-aging, characterized in that it exhibits an anti-aging effect by improving wrinkles and elasticity of the skin. Rigida pine bark fraction,
The fraction was extracted by adding a 10-fold amount of acetone and water to an ethanol extract of Rigida pine bark in a ratio (v/v) of 7: 3, and then concentrated under reduced pressure to obtain a crude acetone extract, and the crude extract was suspended in water. After fractionation with the same amount of CHCl ₃ three times, the water layer is again extracted three times with the same amount of ethyl acetate (EtOAc), which is an ethyl acetate fraction obtained, antioxidant or anti-aging health functional food composition.

Images