JP6908265B2 - Apoptosis inhibitor - Google Patents

Description

The present invention relates to an apoptosis inhibitor and a Bcl-2 production promoter.

There are two types of cell death in the body: apoptosis and necrosis. Apoptosis is active and functional cell death, and is active cell death controlled and regulated as a growth control mechanism in cells. It is "programmed cell death" that is caused by a gene-predetermined program inside the cell, rather than being damaged from the outside and causing the cell to die. On the other hand, necrosis is passive cell death caused by external environmental factors such as malnutrition, toxic substances, and trauma.

When the apoptosis signal is transmitted to the mitochondria existing in the cell, cytochrome c (an essential factor for respiration in living cells) existing in the outer membrane / intimal intermembrane space is released to the cytoplasm. Cytochrome c released into the cytoplasm then acts with various factors to promote apoptosis-specific morphological and biochemical changes. The release of cytochrome c is important for apoptosis, and there is a factor that influences this, that is, the Bcl-2 family protein. There are two contradictory types of promoters and suppressors in this family. Bad, Bid, and the like are known as promoters, and although they are present in the cytoplasm, they migrate to mitochondria by a signal of cell death, where they induce apoptosis by promoting the release of cytochrome c. On the other hand, Bcl-2, Bcl-xL and the like are known as inhibitory factors, and these are present on the outer wall of mitochondria and suppress apoptosis by inhibiting the release of cytochrome c.

Among the Bcl-2 family proteins, Bcl-2 has a function as a negative regulator of cell death and plays an important role in apoptosis. Diseases associated with increased apoptosis include acquired immunodeficiency syndrome (AIDS), Alzheimer's disease, muscle atrophic lateral sclerosis, pigmented retinopathy, cerebral degeneration, aplastic anemia, myocardial infarction, and alcohol-induced liver disease. Periodontal disease and the like are known (Non-Patent Document 1). In addition, in mice lacking the Bcl-2 gene, symptoms such as graying of body hair, dysplasia of bones, and dysplasia of neurites are observed, indicating that Bcl-2 is essential in these tissues.

So far, as substances that enhance the function of Bcl-2 and suppress apoptosis, proteins belonging to the midkine (MK) family (Patent Document 1), ursodeoxycholic acid (Patent Document 2), and licorice extract (Patent Document 2) have been used. 3) and the like are known, but they are not sufficiently satisfactory in practical use in terms of effectiveness, stability, safety and the like.

Panax ginseng (Araliaceae, scientific name Panax ginseng CA May) is a plant cultivated in various parts of Japan, South Korea, North Korea, and northern China. It has been known that Panax ginseng has a hair-growth effect (Patent Document 4), a gray hair improving effect (Patent Document 5), an aromatase promoting effect (Patent Document 6), a DNA synthesis promoting effect (Patent Document 7), and the like. ing. Further, it is already known that Panax ginseng has an apoptosis reaction inhibitory action (Patent Document 8) and a Bcl-2 increase inducing action (Patent Document 9). Furthermore, it is already known that Panax ginseng treated at high temperature and high pressure has an apoptosis-inducing effect on abnormal cancer cells (Patent Document 10 and Non-Patent Document 2). However, until now, it has not been known at all that heat treatment of Panax ginseng further enhances the apoptosis-suppressing effect on normal cells.

WO00 / 02578 JP-A-2005-132800 Japanese Patent Application Laid-Open No. 2008-239573 Japanese Patent Application Laid-Open No. 2003-238365 JP 2001-288098 Japanese Patent Application Laid-Open No. 2003-104848 JP-A-2004-107232 JP-A-2007-22923 JP-A-2002-80382 Special table 2004-537565

Thompson. C. B. , Science, 267, p1456-1462 (1995) Kim. Y. J. et al, Biol. Pharm. Bull. , 31, p826-830 (2008)

Therefore, the problem to be solved by the present invention is to find an effect of enhancing Bcl-2 production in the heat-treated extract of Panax ginseng, and to use this as an active ingredient, an excellent anti-apoptosis agent having a clear point of action. And to provide a Bcl-2 production promoter.

As a result of diligent studies to solve the above problems, the present inventors have excellent anti-apoptosis effect and promotion of Bcl-2 production in the heat-treated ginseng extract as compared with the untreated ginseng. It has been found to have an action, and the present invention has been completed.

That is, the present invention includes the following inventions.
(1) An apoptosis inhibitor comprising an extract of Panax ginseng that has been heat-treated at 100 to 130 ° C.
(2) A Bcl-2 production promoter containing an extract of Panax ginseng that has been heat-treated at 100 to 130 ° C.

The heat-treated extract of Panax ginseng of the present invention was excellent in the effect of suppressing apoptosis and the effect of promoting Bcl-2 production. Antiproliferative agents and Bcl-2 production promoters characterized by containing this extract include maintenance of normal cells and tissues, acquired immunodeficiency syndrome (AIDS), Alzheimer's disease, and myocardial atrophic lateral sclerosis. , Pigmented retinopathy, cerebral degeneration, aplastic anemia, myocardial infarction, liver disease due to alcohol, delay in progression of disease symptoms such as periodontal disease, etc. can be exhibited. Moreover, since the apoptosis inhibitor and the Bcl-2 production promoter of the present invention contain a plant extract having a mild action as an active ingredient, they have no side effects and are highly safe. Therefore, it can be safely used in cosmetics, quasi-drugs, pharmaceuticals and foods.

The heat treatment in the present invention means steaming at 100 to 130 ° C. Preferably, it is steamed at 115-125 ° C. The heating time is not particularly limited, but is preferably 2 to 10 hours, more preferably 2 to 6 hours.

Panax ginseng used in the present invention is also called ginseng, Korean ginseng, and Korean ginseng, and is widely used as a crude drug or a health food material in Japan, South Korea, and China. Mainly, dried roots are treated as crude drugs, and are used as Chinese prescription drugs for gastric digestive and health tonics. Depending on the manufacturing method, the roots can be roughly divided into white ginseng, which has been dried or blanched and then dried, and red ginseng, which has been steamed with steam and heat-treated and then dried.

The ginseng extract used in the present invention is extracted from a part or whole plant of the plant such as leaves, stems, flowers, fruits, seeds and roots of the plant. Preferably, it is obtained by extracting from the root of Panax ginseng. These are commercially available as crude drugs under the name of Hakusan, so you can use them. For Panax ginseng, it is preferable to use the lateral root portion of the root.

Examples of the solvent to be extracted include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol, propylene). Glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl, etc.) Ether, etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used alone or in admixture of two or more.

The above extract may be used as it is in the extracted solution, or may be used after concentration, dilution, filtration treatment, decolorization with activated carbon or the like, deodorization treatment, etc., if necessary. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze drying and the like, and used as a dried product. Panax ginseng used in the present invention is a naturally occurring plant, and the component extracted from Panax ginseng is a mixture in which a large number of compounds having various structures are present at the same time. Therefore, it is difficult to clarify all the structures or properties of the contained components, and it is preferable to treat them as an extract.

The anti-apoptosis agent in the present invention means an agent that inhibits programmed cell death, prolongs the life span of normal cells, and delays the progression of disease symptoms such as acquired immunodeficiency syndrome (AIDS). Apoptosis may be a phenomenon that occurs in mammalian cells, preferably skin cells that make up the epidermis or dermis, and particularly preferably melanocytes that make up the hair. The cells are preferably of human origin, but may be of any mammalian origin such as mice, rats, guinea pigs, rabbits, pigs and the like.

The Bcl-2 production promoter in the present invention means an agent that promotes the production of Bcl-2 protein, which is one of the most important apoptosis suppressors that suppressively regulates signal transduction upstream of the apoptosis signal. The Bcl-2 protein may be a protein produced in mammalian cells, preferably skin cells constituting the epidermis or dermis, and particularly preferably melanocytes constituting hair. The cells are preferably of human origin, but may be of any mammalian origin such as mice, rats, guinea pigs, rabbits, pigs and the like.

In order to use the apoptosis inhibitor and the Bcl-2 production promoter, which are characterized by containing the heat-treated ginseng extract used in the present invention, they are usually administered systemically or locally by external or internal use. NS. The dose varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. The amount is not particularly limited as long as it can exert an apoptosis inhibitory effect and a Bcl-2 production promoting effect, but the weight of the dry solid is preferably 0.00001 to 10% by weight, more preferably 0.0001 to 1% by weight. Since the dose varies depending on various conditions, an amount smaller than the above-mentioned administration range may be sufficient, or it may be necessary to administer beyond the above range.

When administered by external use, it can be used for any of cosmetics, quasi-drugs and pharmaceuticals. Examples of the dosage form include those applied to the scalp and body such as external preparations for skin (insect repellent, etc.), cleaning agents, lotions, milky lotions, shampoos, rinses, and body lotions. The above extract may be used as it is, and oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, and surfactants, which are components used for external preparations as long as the effects of the present invention are not impaired. It can also contain agents, metal soaps, pH regulators, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, chelating agents and the like.

When administered by internal use, it can be used for any of quasi-drugs, pharmaceuticals and foods. Various forms of the formulation can be selected, and examples thereof include a toothpaste, a liquid toothpaste, a mouthwash, an ointment, a cream, an oral gel, a mouth spray, a mouth rinse, and a troche. Furthermore, the forms of ordinary pharmaceuticals such as powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids and emulsions, and the forms of foods such as candy, gum, tablets, capsules and beverages. Can also be adopted.

When the apoptosis inhibitor and Bcl-2 production promoter of the present invention are contained in cosmetics or non-pharmaceutical products, their dosage forms are aqueous solution type, solubilization type, emulsification type, powder type, powder dispersion system, oil solution. It may be any of a system, a gel system, an ointment system, an aerosol system, a water-oil two-layer system, a water-oil-powder three-layer system, and the like. For the quasi-drugs and cosmetics, various components, additives, bases and the like usually used in the external composition for skin are selected according to the type, together with the apoptosis inhibitor and the Bcl-2 production promoter. , Can be appropriately contained and produced according to a method known in the art. The form may be any of liquid, emulsion, cream, gel, paste, spray and the like. Examples of the contained components include fats and oils (olive oil, palm oil, evening primrose oil, jojoba oil, castor oil, hardened castor oil, etc.), waxes (lanolin, beeswax, carnauba wax, etc.), hydrocarbons (liquid paraffin, squalane, etc.). Squalane, Vaseline, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol, etc.), esters (myristin) Isopropyl acid, isopropyl palmitate, cetyl octanate, glycerin trioctate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), organic acids (citrate, lactic acid, α-hydroxyacetic acid, pyrrolidonecarboxylic acid, etc.), sugars (Martitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and hydrolyzates of proteins, amino acids and their salts, vitamins, plant / animal extracts, various surfactants, moisturizers, Examples thereof include ultraviolet absorbers, antioxidants, stabilizers, preservatives, bactericides, and fragrances.

When the apoptosis inhibitor and Bcl-2 production promoter of the present invention are contained in a pharmaceutical product, they are mixed with pharmacologically and pharmaceutically acceptable additives and various pharmaceutical forms suitable for application to the affected area. It can be formulated into a formulation. Pharmacologically and pharmaceutically acceptable additives include excipients, thickeners, tonicity agents, pH regulators, stabilizers, preservatives, and preservatives, depending on the dosage form and application. , Dispersants, emulsifiers, gelling agents, pigments, fragrances and the like can be used. A form suitable for the pharmaceutical product of the present invention is an external preparation, and examples thereof include an ointment, a cream, a gel, a liquid, and a patch. The ointment refers to a homogeneous semi-solid external preparation, and includes an oily ointment, an emulsion ointment, and a water-soluble ointment. A gel agent refers to an external preparation in which a water-holding compound, which is a water-insoluble component, is suspended in an aqueous solution. The liquid agent refers to a liquid external preparation, and includes a lotion agent, a suspension agent, an emulsion, a liniment agent, and the like.

When the apoptosis inhibitor and Bcl-2 production promoter of the present invention are contained in foods, additives usually used depending on the type may be appropriately contained. As the additive, any additive that is acceptable under the Food Sanitation Law can be used, and for example, sweeteners (dextrin, sucrose, fructose, isomerized liquid sugar, aspartame, stevia, etc.) and acidulants (citric acid). Acids, malic acid, tartaric acid, etc.), excipients (dextrin, starch, etc.), binders, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersions Examples include agents, suspending agents, preservatives and the like.

Next, in order to explain the present invention in detail, specific examples will be given and described. These examples specifically explain the effect and do not limit the scope of the invention. The content in the examples is% by weight.

[Example 1]
A heat-treated extract of Panax ginseng was produced as follows.

(Production Example 1) Hot water extract of Panax ginseng heat-treated at 121 ° C. The roots of Panax ginseng were steamed at 121 ° C. for 4 hours and then dried at 50 to 70 ° C. 800 mL of purified water was added to 40 g of this heat-treated otane carrot, extracted at 95 to 100 ° C. for 2 hours, filtered, the filtrate was concentrated, freeze-dried, and heat-treated at 121 ° C. for hot water extraction. 16.2 g of the product was obtained.

(Production Example 2) Hot water extract of Panax ginseng heat-treated at 100 ° C. The roots of Panax ginseng were steamed at 100 ° C. for 4 hours and then dried at 50 to 70 ° C. 800 mL of purified water was added to 40 g of this heat-treated otane carrot, extracted at 95 to 100 ° C. for 2 hours, filtered, the filtrate was concentrated, freeze-dried, and heat-treated at 100 ° C. for hot water extraction. 18.7 g of the product was obtained.

(Production Example 3) 50% ethanol extract of Panax ginseng heat-treated at 121 ° C. The roots of Panax ginseng were steamed at 121 ° C. for 4 hours and then dried at 50 to 70 ° C. 500 mL of purified water and 500 mL of ethanol were added to 100 g of this heat-treated ginseng, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to extract 50% ethanol of ginseng heat-treated at 121 ° C. I got 40g of things.

(Production Example 4) 50% ethanol extract of Panax ginseng heat-treated at 100 ° C. The roots of Panax ginseng were steamed at 100 ° C. for 4 hours and then dried at 50 to 70 ° C. 500 mL of purified water and 500 mL of ethanol were added to 100 g of this heat-treated ginseng, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to extract 50% ethanol of ginseng heat-treated at 100 ° C. I got 43g of ginseng.

(Production Example 5) 1,3-butylene glycol extract of Panax ginseng heat-treated at 121 ° C. The leaves and stems of Panax ginseng were steamed at 121 ° C. for 4 hours and then dried at 50 to 70 ° C. 200 mL of 1,3-butylene glycol was added to 20 g of this heat-treated ginseng, extracted at room temperature for 7 days, and then filtered to obtain 160 g of 1,3-butylene glycol extract of ginseng heat-treated at 121 ° C. ..

(Production Example 6) 1,3-butylene glycol extract of Panax ginseng heat-treated at 100 ° C. Leaves and stems of Panax ginseng were steamed at 100 ° C. for 4 hours and then dried at 50 to 70 ° C. 200 mL of 1,3-butylene glycol was added to 20 g of this heat-treated ginseng, extracted at room temperature for 7 days, and then filtered to obtain 141 g of 1,3-butylene glycol extract of ginseng heat-treated at 100 ° C. ..

(Comparative Production Example 1) Hot water extract of Panax ginseng 800 mL of purified water was added to 40 g of dried ginseng root, extracted at 95 to 100 ° C. for 2 hours, filtered, the filtrate concentrated, and freeze-dried. 12.5 g of a hot water extract of Panax ginseng was obtained.

(Comparative Production Example 2) 50% Ethanol Extract of Otaneninjin To 100 g of dried otaneninjin root, 500 mL of purified water and 500 mL of ethanol were added, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness. 15.1 g of a 50% ethanol extract of otane carrot was obtained.

(Comparative Production Example 3) Extract of 1,3-butylene glycol of Panax ginseng 200 mL of 1,3-butylene glycol was added to 20 g of leaves and stems of Panax ginseng, extracted for 7 days at room temperature, filtered, and 1,3- of Panax ginseng. 157 g of ginseng glycol extract was obtained.

[Example 2]
A comparative evaluation experiment of the effect of Panax ginseng extract was carried out as follows.

(Test Example 1) Effect of Otaneninjin Extract on Bcl-2 Production in Human Melanocytes In the test, human epidermal melanocytes expressing Bcl-2 (Human Epidermal Melanocytes, normal neonatal forestin, Cell Applications) were used. ^{The cells were seeded in 1 × 10 5} cells on a 6-well plate and cultured in Medium 254 at 37 ° C. _{under 5% CO 2} conditions for 1 week. Heat-treated ginseng extract (Production Examples 1 to 6) and untreated ginseng extract (Comparative Production Examples 1 to 6) prepared so that the final concentration of each confluent cell was 500 μg / mL. After adding 3) and culturing for 24 hours, total RNA was extracted. Extraction of total RNA from cells was performed using RNAiso plus (TAKARA). The total amount of RNA was determined by the absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, SYBR Select Master Mix (Life Technologies) was used. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C.: 15 seconds, 60 ° C.: 30 seconds, 40 cycles) was performed. For other operations, the expression level of Bcl-2 mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The Bcl-2 expression level was calculated as the ratio of the Bcl-2 mRNA expression level of the sample addition group to the Bcl-2 mRNA expression level of the control. As the primers for Bcl-2 and β-actin, those shown below were used.

Primer set for Bcl-2 CTGGGATGCCTTTGGAACT (SEQ ID NO: 1)
CAGCCAGGAGAAAATCAAACAGA (SEQ ID NO: 2)

Primer set for β-actin CACTTTCCAGCCTTCCTTCC (SEQ ID NO: 3)
GTGTTGGGCGTACAGGTCTTG (SEQ ID NO: 4)

The results of these tests are shown in Table 1. The effect of increasing the expression level of Bcl-2 mRNA was observed in all the extracts, but the effect was higher in the heat-treated extracts.

(Test Example 2) Effect of Panax ginseng extract on apoptosis in human keranosite Human keranosite (HaCaT) was used in the test. HaCaT was inoculated on a 96-well plate in an amount of 1,000 per _{well, and DMEM medium containing 0.5% FBS supplemented with H 2} O ₂ having a final concentration of 300 μM and a sample of 500 μg / mL was used at 37 ° C. and 5% CO. _The cells were cultured under 2 conditions for 4 days. The number of cells was measured by the staining method. That is, after the culture was completed, the medium was removed and the cells were fixed with methanol for 10 minutes. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and stirred well, and the absorbance at 650 nm was measured using a microplate reader. Generally, the active oxygen such as H ₂ O _2, it is known that apoptosis is induced. The apoptosis inhibition rate of the sample was calculated by the following formula.

The results of these tests are shown in Table 2. H ₂ O ₂ results apoptosis was induced by the addition, cell number was decreased. On the other hand, when the extract was added at the same time, apoptosis was suppressed and the decrease in the number of cells was suppressed, but the effect was higher in the heat-treated extract.

[Example 3] Product formulation example The formulation example of the product containing the heat-treated ginseng extract produced in Production Examples 1 to 6 is shown below.

(Prescription example 1) Lotion prescription content (% by weight)
1. Hot water extract of Panax ginseng heat-treated at 121 ° C (Production Example 1) 0.1
2.1,3-butylene glycol 8.0
3. 3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Fragrance 0.1
11. Remaining amount of purified water [Manufacturing method] After the components 1 to 6 and 11 and the components 7 to 10 are uniformly dissolved, both are mixed and filtered to obtain a product.

(Prescription example 2) Pack prescription content (% by weight)
1. 50% ethanol extract of Panax ginseng heat-treated at 121 ° C (Production Example 3) 0.1
2. Polyvinyl alcohol 12.0
3. 3. Ethanol 5.0
4.1,3-butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
7. Citric acid 0.1
8. Sodium citrate 0.3
9. Appropriate amount of fragrance 10. Remaining amount of purified water [Manufacturing method] Ingredients 1 to 10 are uniformly dissolved to prepare a product.

(Prescription example 3) Hair tonic prescription content (% by weight)
1. 3-butylene glycol extract of Panax ginseng heat-treated at 121 ° C (Production Example 5) 2.0
2.95% ethanol 60.0
3. 3. Glycerin 2.0
4. Remaining amount of purified water [Manufacturing method] Dissolve component 1 in component 2, add components 3 and 4, and mix well with stirring to obtain a product.

(Prescription example 4) Hair lotion Prescription content (% by weight)
1. 50% ethanol extract of Panax ginseng heat-treated at 121 ° C (Production Example 3) 0.2
2. Stearic acid 5.0
3. 3. Cetyl alcohol 5.0
4. Liquid paraffin 2.0
5. Glycerin monostearate 1.3
6. Sorbitan Monooleate 1.5
7. Polyoxyethylene sorbitan monooleate (10E.О.) 0.8
8. Glycerin 6.0
9. Preservatives Appropriate amount 10. Remaining amount of purified water [Manufacturing method] Ingredients 2 to 7 are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 8 to 10 are heated and dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the product is cooled while stirring to obtain a product.

(Prescription example 5) Shampoo prescription content (% by weight)
1. Hot water extract of Panax ginseng heat-treated at 121 ° C (Production Example 1) 0.1
2. Alkyl Sulfate Triethanolamine 18.0
3. 3. Lauric acid diethanolamide 3.0
4. Methyl cellulose 0.5
5. Appropriate amount of fragrance 6. Remaining amount of purified water [Manufacturing method] After uniformly dissolving component 4 in component 6, add components 1 and 2, heat-dissolve at 70 to 75 ° C., add component 3, add component 5 during cooling, and add component 5. Cool to 30 ° C to make a product.

(Prescription example 6) Body shampoo Prescription content (% by weight)
1. 3-butylene glycol extract of Panax ginseng heat-treated at 121 ° C (Production Example 5) 0.2
2. Stearic acid 10.0
3. 3. Palmitic acid 8.0
4. Myristic acid 12.0
5. Lauric acid 4.0
6. Oleyl alcohol 1.5
7. Purified lanolin 1.0
8. Coconut oil fatty acid diethanolamide 1.0
9. Glycerin 10.0
10. Potassium hydroxide 6.0
11. Appropriate amount of fragrance 12. Preservatives Appropriate amount 13. Sequestrant Appropriate amount 14. Remaining amount of purified water [Manufacturing method] Ingredients 2 to 5 are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Component 10 is dissolved in an appropriate amount of component 14 and added to the oil phase for saponification. Subsequently, components 6 to 9 are added to the saponified product, and component 1, components 11 to 13 and the remaining component 14 are further added at room temperature to prepare a product.

(Prescription example 7) Bath agent Prescription content (% by weight)
1. 1,3-butylene glycol extract of Panax ginseng heat-treated at 100 ° C. (Production Example 6) 5.0
2. Sodium bicarbonate 50.0
3. 3. Yellow No. 202 Appropriate amount 4. Appropriate amount of fragrance 5. Anhydrous sodium sulfate Remaining amount [Manufacturing method] Ingredients 1 to 5 are uniformly mixed to prepare a product.

(Prescription example 8) Toothpaste Prescription content (% by weight)
1. 1. Calcium hydrogen phosphate 22.0
2. Sodium lauryl sulfate 1.5
3. 3. Tranexamic acid 0.01
4. β-Glycyrrhetinic acid 0.2
5. Isopropylmethylphenol 0.1
6. Cetylpyridinium chloride 0.05
7. 50% ethanol extract of Panax ginseng heat-treated at 100 ° C (Production Example 4) 0.001
8. Glycerin 20.0
9. Carrageenan 0.9
10. Saccharin sodium 0.001
11. Fragrance 1.0
12. Sodium benzoate 0.5
13. Remaining amount of purified water [Manufacturing method] Ingredients 3 to 13 are mixed well, then ingredients 1 and 2 are added and kneaded, and after defoaming, the product is filled in a tube. Use 1g at a time, 3 times a day.

(Prescription example 9) Mouthwash prescription content (% by weight)
1. 1. Ethanol 20.0
2. Hot water extract of Panax ginseng heat-treated at 100 ° C (Production Example 2) 0.01
3. 3. Glycerin 10.0
4. Saccharin sodium 0.1
5. Fragrance 0.1
6. Polyoxyethylene hydrogenated castor oil (60EO) 1.5
7. Ethyl paraoxybenzoate 0.1
8. Remaining amount of purified water [Manufacturing method] Ingredient 2 is dissolved in ingredient 1 (composition A). Then, the components 3 to 7 are dissolved in the component 8 (composition B). The composition A and the composition B are well mixed to obtain a product. Use 10 mL at a time, 3 times a day.

(Prescription example 10) Tablet prescription content (% by weight)
1. Hot water extract of Panax ginseng heat-treated at 121 ° C (Production Example 1) 0.005
2. Erythritol 60.4
3. 3. Citric acid 5.0
4. Sucrose fatty acid ester 3.0
5. Fragrance 0.1
6. Maltitol Remaining amount [Manufacturing method] Ingredients 1 to 3 and 6 are mixed, and 10% water is added as a binder to granulate the fluidized bed. Ingredients 4 and 5 are added to the molded granules, mixed, and tableted to obtain a product. Ingest 2 g of 1 tablet and 6 tablets daily so as to dissolve in the oral cavity.

The anti-apoptosis agent and the Bcl-2 production promoter, which are characterized by containing an extract of the heat-treated retinopathy according to the present invention, have an excellent Bcl-2 increasing action, thereby causing normal cells and tissues. Disease symptoms such as maintenance, acquired immunodeficiency syndrome (AIDS), Alzheimer's disease, muscle atrophic lateral sclerosis, pigmented retinopathy, cerebral degeneration, aplastic anemia, myocardial infarction, alcohol-induced liver disease, periodontal disease, etc. It exerts effects such as delaying progress. Therefore, heat-treated Panax ginseng is effective and stable against various diseases associated with an increase in apoptosis or a decrease in Bcl-2 occurring in skin, hair, etc. by promoting Bcl-2 production. It can be a highly safe cosmetic, quasi-drug, drug and food.

Claims (2)

An apoptosis inhibitor comprising a water extract of Panax ginseng, wherein the Panax ginseng is heat-treated at 100 to 130 ° C. A Bcl-2 production-promoting agent containing a water extract of Panax ginseng, wherein the Panax ginseng is heat-treated at 100 to 130 ° C.