JP7389465B2 - Melanin production inhibitor, collagen production promoter and antioxidant - Google Patents

Description

The present invention relates to melanin production inhibitors, collagen production promoters, antioxidants, and food compositions.

Skin pigmentation, which is generally seen as spots, freckles, sunburn, etc., is caused by hormonal abnormalities or stimulation by ultraviolet rays, causing melanin pigment-producing cells in the skin to produce excessive melanin pigment, which is deposited in the skin. is thought to be the cause. One known method for preventing such pigmentation is to suppress excessive production of melanin. Conventionally, pigmentation has been treated by externally applying hydroquinone, ascorbic acid (vitamin C), and the like.

Collagen is a major structural protein that accounts for approximately one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendon, and skin. Therefore, it is known that collagen production decreases due to aging, etc., which causes osteoporosis, arthritis, tendonitis, etc. Furthermore, it is known that collagen production increases during the wound healing process, promoting wound healing. Therefore, promoting collagen production is also effective in promoting skin wound healing and improving osteoporosis, arthritis, tendonitis, and the like.

The skin is located in the outermost layer of the living body, and is an organ where active oxygen is likely to be generated due to the influence of ultraviolet rays, etc., and is constantly exposed to oxygen stress. On the other hand, active oxygen scavenging enzymes exist within skin cells and protect skin cells from damage caused by active oxygen unless active oxygen exceeding its capacity is generated. However, it is known that the activity of active oxygen scavenging enzymes in skin cells decreases with age, and when the damage caused by active oxygen exceeds the protective response, the skin becomes oxidized, cell function deteriorates, and aging occurs. It is thought that this will continue. Furthermore, when organs other than the skin are exposed to active oxygen that exceeds their ability to scavenge active oxygen, it is thought that functional decline occurs, leading to aging, and the development of various lifestyle-related diseases such as cancer and myocardial infarction. Therefore, active oxygen scavengers and antioxidants have been investigated for the purpose of protecting against damage caused by active oxygen, and contain active oxygen scavengers and antioxidants such as active oxygen scavenging enzymes such as SOD and catalase, and SOD-like active substances. Foods, cosmetics, quasi-drugs, pharmaceuticals, and the like have been developed (Patent Document 1).

Plants of the genus Artemisia are distributed all over the world, and there are 250 known types. As for the medicinal effects of plants belonging to the Artemisia genus, it is known that a hydrous ethanol extract of a fermented product of Artemisia princeps has a type I collagen production promoting effect (Patent Document 2).

JP2015-212233A JP2009-242263A

Although materials with excellent melanin production inhibiting effects, collagen production promoting effects, and antioxidative effects have been desired, at present no material that is fully satisfactory has been provided.

As a result of intensive studies aimed at solving the above problems, the present inventors discovered that an extract of Artemisia montana has excellent melanin production inhibiting action, collagen production promoting action, and antioxidant action, and has developed the present invention. It was completed.

That is, the present invention includes the following inventions.
(1) A melanin production inhibitor characterized by containing an extract of Artemisia montana.
(2) A collagen production promoter characterized by containing an extract of Artemisia montana.
(3) An antioxidant characterized by containing an extract of Artemisia montana.
(4) A food composition for improving and preventing diseases caused by melanin pigmentation, osteoporosis, arthritis, tenosynovitis, wounds, oxidative stress, and skin aging, characterized by containing an extract of Artemisia montana. .

The melanin production inhibitor of the present invention is used to treat, improve and prevent pigmentation, the collagen production promoter is used to treat, improve and prevent osteoporosis, arthritis, tendonitis and wounds, and the antioxidant is used to treat diseases caused by oxidative stress. and for the treatment, improvement and prevention of skin aging.

Artemisia montana used in the present invention is a perennial plant of the family Asteraceae, genus Artemisia, and grows naturally in Honshu (north of the Kinki region) and Hokkaido. On the other hand, Artemisia princeps or Artemisia indica is mainly distributed in Honshu to Kyushu and Ogasawara, and the plant size (e.g., stem height, flower head diameter, leaf length, etc.) is different from that of the present invention. It is smaller than the Japanese mugwort, and is a different species of plant from the Japanese mugwort. Note that Artemisia princeps and Artemisia indica have a synonymous relationship.

The mugwort used in the present invention can be obtained from the above-mentioned growing regions, or can be purchased commercially. The part of Mugwort used as an extraction raw material may be the whole plant or a part thereof, but from the viewpoint of effectiveness, the leaf part is preferable. Further, for extraction, the plant body may be used raw, or may be subjected to treatments such as drying, pulverization, and shredding.

Extraction solvents used in the extract of the present invention include, for example, water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1, 3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers ( ethyl ether, tetrahydrofuran, propyl ether, etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used alone or in combination of two or more. Moreover, it is also possible to use a solvent whose pH is adjusted by adding an acid or an alkali to these solvents. Moreover, the extraction method is not particularly limited, and examples thereof include continuous extraction and immersion extraction. The extraction temperature may be heated extraction, room temperature extraction, or cold temperature extraction, and can be appropriately selected depending on the intended use of the extract, the extraction solvent, and the like.

The extract of the present invention may be used as an extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, activated carbon, etc. It may be used after being subjected to treatments such as decolorization and deodorization. Furthermore, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

The melanin production inhibitor, collagen production promoter, antioxidant, and food composition of the present invention may be used in cosmetics, quasi-drugs, etc., as long as the above-mentioned extracts may be used as they are, and the effects of the extracts are not impaired. , oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders used in pharmaceuticals or foods, etc. The composition may contain components such as a UV absorber, a thickener, a pigment, an antioxidant, a whitening agent, a chelating agent, an excipient, a coating agent, a sweetener, and an acidulant.

Dosage forms of the melanin production inhibitor, collagen production promoter, antioxidant, and food composition of the present invention include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleaning agents, and bath preparations. , foundation, powder, lipstick, ointment, poultice, tablet, capsule, chocolate, gum, candy, beverage, powder, granule, tablet, sugar-coated tablet, capsule, syrup, pill, suspension, liquid , emulsions, suppositories, solutions for injection, etc.

For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, in terms of solid matter. Furthermore, 0.01 to 5% by weight is most preferred. If it is less than 0.0001% by weight, it is difficult to expect sufficient effects. If it exceeds 10% by weight, it is difficult to notice any enhancement of the effect and it is uneconomical.

For internal use, the intake amount varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Usually, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Furthermore, 20 mg to 2 g is most preferred.

Next, the present invention will be explained in more detail with reference to Examples, but the present invention is not limited thereto. In addition, unless otherwise specified, % shown in Examples indicates weight %.

(Production Example 1) Preparation of Hot Water Extract 1 of Artemisia montana 200 mL of water was added to 10 g of dried leaves of Artemisia montana and extracted at 95 to 100°C for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.7 g of hot water extract 1 of Mugwort trifoliata.

(Production Example 2) Preparation of 50% ethanol extract of Artemisia montana 10 g of dried leaves of Artemisia montana was extracted by immersing it in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days. After filtering the obtained extract, it was concentrated to dryness using an evaporator to obtain 2.1 g of a 50% ethanol extract of Artemisia annua.

(Production Example 3) Preparation of Ethanol Extract of Artemisia montana 10 g of dried Artemisia montana leaves was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After filtering the obtained extract, it was concentrated to dryness using an evaporator to obtain 0.5 g of an ethanol extract of Mugwort trifoliata.

(Production Example 4) Preparation of 1,3-butylene glycol extract of Artemisia montana 10 g of dried leaves of Artemisia montana was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The obtained extract was filtered to obtain 192 g of a 1,3-butylene glycol extract of Artemisia annua.

(Production Example 5) Preparation of Hot Water Extract 2 of Artemisia montana 200 mL of water was added to 10 g of dried whole plant of Artemisia montana and extracted at 95 to 100°C for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.8 g of Hot Water Extract 2 of Mugwort.

(Comparative Production Example 1) Preparation of hot water extract of Artemisia princeps 200 mL of water was added to 10 g of dried Artemisia princeps, and extracted at 95 to 100° C. for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.7 g of a hot water extract of mugwort.

(Comparative Production Example 2) Preparation of 50% ethanol extract of Artemisia princeps 10 g of dried Artemisia princeps was immersed in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days for extraction. After filtering the obtained extract, it was concentrated to dryness using an evaporator to obtain 1.4 g of a 50% ethanol extract of Artemisia annua.

(Comparative Production Example 3) Preparation of Ethanol Extract of Artemisia princeps 10 g of dried Artemisia princeps was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After filtering the obtained extract, it was concentrated to dryness using an evaporator to obtain 0.4 g of an ethanolic extract of mugwort.

(Prescription example 1) Lotion 1
Prescription Content (%)
1. Hot water extract of mugwort 1 (manufacturing example 1) 2.0
2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance: Appropriate amount 11. Make the total amount 100% with purified water. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are each uniformly dissolved, mixed and filtered to obtain a product.

(Prescription example 2) Lotion 2
Formulation Example 2 was prepared by replacing Hot Water Extract 1 of Artemisia mugwort in Formulation Example 1 with Hot Water Extract 2 of Artemisia mugwort (Manufacturing Example 5).

(Prescription example 3) Cream prescription Content (%)
1. 50% ethanol extract of mugwort (manufacturing example 2) 1.0
2. Squalane 5.5
3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20E.O.) 3.0
8. Behenyl alcohol 1.5
9. Glyceryl monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-butylene glycol 8.5
13. Make the total amount 100% with purified water. [Manufacturing method] Components 2 to 9 are dissolved and mixed by heating, and kept at 70°C to form an oil phase. Components 1 and 11 to 13 are heated and dissolved, mixed, and kept at 75°C to form an aqueous phase. Add the aqueous phase to the oil phase and emulsify, cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain a product.

(Formulation example 4) Emulsion Prescription Content (%)
1. Ethanol extract of mugwort (manufacturing example 3) 0.01
2. Squalane 5.0
3. Olive oil 5.0
4. Jojoba oil 5.0
5. Setanol 1.5
6. Glyceryl monostearate 2.0
7. Polyoxyethylene cetyl ether (20E.O.) 3.0
8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. Make the total amount 100% with purified water. [Manufacturing method] Components 1 to 8 are dissolved and mixed by heating, and kept at 70°C to form an oil phase. Components 10 to 13 are dissolved and mixed by heating, and the mixture is kept at 75°C to form an aqueous phase. Add the aqueous phase to the oil phase and emulsify, cool while stirring, add component 9 at 45°C, and further cool to 30°C to obtain a product.

(Formulation example 5) Gel formulation Content (%)
1. 1,3-butylene glycol extract of mugwort (manufacturing example 4) 1.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1
5. Fragrance Appropriate amount 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. Make the total amount 100% with purified water. [Manufacturing method] Components 2 to 5 and components 1 and 6 to 11 are each uniformly dissolved and mixed to form a product.

(Formulation example 6) Pack prescription Content (%)
1. Hot water extract of mugwort 1 (manufacturing example 1) 1.0
2. 1,3-butylene glycol extract of mugwort (manufacturing example 4) 5.0
3. Polyvinyl alcohol 12.0
4. Ethanol 5.0
5.1,3-butylene glycol 8.0
6. Methyl paraoxybenzoate 0.2
7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5
8. Citric acid 0.1
9. Sodium citrate 0.3
10. Fragrance: Appropriate amount 11. Make the total amount 100% with purified water. [Manufacturing method] Components 1 to 11 are uniformly dissolved to form a product.

(Prescription Example 7) Foundation Prescription Content (%)
1. 50% ethanol extract of mugwort (manufacturing example 2) 1.0
2. Stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
4. Polyoxyethylene cetyl ether (20E.O.) 2.0
5. Setanol 1.0
6. liquid lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Carboxymethyl cellulose sodium 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Fragrance: Appropriate amount 19. Make the total amount 100% with purified water. [Production method] Dissolve components 2 to 8 by heating and keep at 80°C to form an oil phase. Component 9 is sufficiently swollen in component 19, and then components 1 and 10 to 13 are added and mixed uniformly. Add components 14 to 17 that have been ground and mixed using a grinder, stir with a homomixer, and keep at 75°C to form an aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Thereafter, it is cooled, and component 18 is added at 45°C, and the mixture is cooled to 30°C while stirring to form a product.

(Prescription example 8) Bath additive Prescription Content (%)
1. Ethanol extract of mugwort (manufacturing example 3) 1.0
2. Sodium hydrogen carbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Fragrance (appropriate amount) 5. Adjust the total amount to 100% with sodium sulfate. [Manufacturing method] Mix components 1 to 5 uniformly to make a product.

(Prescription example 9) Ointment Prescription Content (%)
1. 1,3-butylene glycol extract of mugwort (manufacturing example 4) 1.0
2. Hot water extract of mugwort 2 (manufacturing example 5) 5.0
3. Polyoxyethylene cetyl ether (30E.O.) 2.0
4. Glyceryl monostearate 10.0
5. Liquid paraffin 5.0
6. Setanol 6.0
7. Methyl paraoxybenzoate 0.1
8. Propylene glycol 10.0
9. Make the total amount 100% with purified water. [Manufacturing method] Components 3 to 6 are dissolved and mixed by heating, and kept at 70°C to form an oil phase. Components 1, 2, and 7 to 9 are mixed by heating and kept at 75°C to form an aqueous phase. Add the aqueous phase to the oil phase, emulsify, and cool to 30°C while stirring to obtain a product.

(Prescription example 10) Powder 1
Prescription Content (%)
1. Hot water extract of mugwort 1 (manufacturing example 1) 1.0
2. Dried cornstarch 39.0
3. Microcrystalline cellulose 60.0
[Manufacturing method] Components 1 to 3 are mixed to form a product.

(Prescription example 11) Powder 2
In Formulation Example 10, Powder 2 was prepared by replacing hot water extract 1 of Mugwort grandiflorum (Production Example 1) with hot water extract 2 of Artemisia grandiflora (Production Example 5).

(Prescription example 12) Powder 3
In Formulation Example 10, Powder 3 was prepared by replacing the hot water extract 1 (Manufacturing Example 1) of Artemisia mugwort with 50% ethanol extract (Manufacturing Example 2).

(Prescription Example 13) Tablet Prescription Content (%)
1. Ethanol extract of mugwort (manufacturing example 3) 5.0
2. Dried cornstarch 25.0
3. Carboxymethyl cellulose calcium 20.0
4. Microcrystalline cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Components 1 to 4 are mixed, then an aqueous solution of component 5 is added as a binder, and granules are formed. Add ingredient 6 to the molded granules and tablet. One tablet weighs 0.52 g.

(Prescription example 14) Tablet confectionery 1
Prescription Content (%)
1. Ethanol extract of mugwort (manufacturing example 3) 2.0
2. Dried cornstarch 49.8
3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Fragrance 0.1
7. Purified water 0.1
[Production method] Components 1 to 4 and 7 are mixed and formed into granules. Components 5 and 6 are added to the molded granules and compressed into tablets. One grain is 1.0g.

(Prescription example 15) Tablet confectionery 2
Tablet confectionery 2 was prepared by replacing the ethanol extract of Mugwort artemis (Manufacturing example 3) with the hot water extract of Artemisia artemis 2 (Manufacturing example 5) in Formulation example 14.

(Prescription example 16) Tablet confectionery 3
Tablet confectionery 3 was prepared by replacing the ethanol extract of mugwort (Manufacturing Example 3) with the 50% ethanol extract of mugwort (manufacturing example 2) in Formulation Example 14.

(Formulation example 17) Beverage prescription Content (%)
1. Hot water extract of mugwort 1 (manufacturing example 1) 0.05
2. Stevia 0.05
3. Malic acid 5.0
4. Fragrance 0.1
5. Purified water 94.8
[Manufacturing method] Components 2 and 3 are dissolved in a small amount of water. Then add and mix ingredients 1, 4 and 5.

Experimental Example 1 Melanin Production Suppression Test 3 x ¹⁰⁴ B16 mouse melanomas in the logarithmic growth phase were seeded in a 60 mm dish, and Eagle's MEM (containing 10% FBS) medium containing each sample (the final concentration is listed in Table 1) was used. The cells were cultured for 5 days at 37° C. and 5% CO ₂ . Next, the cells were detached from the dish and disrupted by ultrasonication, then treated with 4N NaOH at 60° C. for 2 hours, and melanin was quantified by measuring absorbance at 475 nm using a spectrophotometer. In addition, protein was quantified using the method of Lowry (J. Biol. Chem., 193, 265-275, 1951) for the cell homogenate after ultrasonic treatment, and the amount of melanin per amount of protein was calculated. The melanin amount at the time of sample addition was used as a control, and the melanin production inhibition rate was calculated from the value of the melanin amount at the time of sample addition relative to the control.

The test results are shown in Table 1. It was found that the extract of Artemisia annua of the present invention has a melanin production inhibiting effect that is significantly superior to that of the extract of Artemisia annua. It should be noted that cytotoxicity was observed at 10 μg/mL of the ethanolic extract of Mugwort. On the other hand, the ethanol extract of Mugwort albicans showed no cytotoxicity even at the same concentration and exhibited excellent melanin production inhibiting effects, confirming its superior safety.

Experimental Example 2 Collagen Production Promotion Test COL1A1 mRNA expression level was measured. 1 x 10 ⁵ human skin fibroblasts were seeded in a 60 mm dish and cultured in a DMEM culture medium containing 10% FBS at 37°C and 5% CO ₂ . When a confluent state was reached, the cells were cultured for 24 hours in a DMEM (-) culture medium supplemented with each sample (final concentration listed in Table 2), and then total RNA was extracted. Total RNA was extracted from cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by real-time RT-PCR based on total RNA extracted from cells. For the real-time RT-PCR method, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after reverse transcription reaction of 500 ng of total RNA, PCR reaction (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles) was performed. Other operations were performed in accordance with established methods, and the expression level of COL1A1 mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard. The COL1A1 expression promotion rate was calculated as the ratio of the expression level of COL1A1 mRNA in the sample added group to the expression level of COL1A1 mRNA in the control (no sample added) group. The primers used to measure the expression level of each gene are as follows.

Primer set AGGACAAGAGGCATGTCTGGTT for COL1A1 (SEQ ID NO: 1)
TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 2)
Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 3)
GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 4)

The results of this experiment are shown in Table 2. As a result, it was found that the extract of Mugwort of the present invention had a significantly superior collagen production promoting effect than the extract of Mugwort.

Experimental example 3 DPPH radical scavenging test (antioxidant test)
α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), which is a stable free radical, is used as the active oxygen species, and is reacted with the sample at a certain rate for a certain period of time, and the amount of DPPH that decreases is determined by The amount of decrease in absorbance at 517 nm was measured using a spectrophotometer.

Method for measuring DPPH radical scavenging effect Add 0.4 mL of 0.1 M acetate buffer (pH 5.5) to which each sample (final concentration is listed in Table 3) was added with 0.4 mL of absolute ethanol and 0.5 mM DPPH absolute ethanol solution. .2 mL was added to prepare a reaction solution. In addition, in the case of an oil-soluble sample, the sample was added to 0.4 mL of absolute ethanol to prepare a reaction solution. Thereafter, the mixture was reacted at 37° C. for 30 minutes, and the absorbance (A) at 517 nm was measured using water as a control. Furthermore, as a control, absorbance (B) was measured using purified water instead of the sample. The DPPH radical scavenging rate was calculated using the formula shown below.
DPPH radical scavenging rate (%) = (1-A/B) x 100

The results of these tests are shown in Table 3. It was found that the extract of Artemisia annua of the present invention has a significantly superior DPPH radical scavenging effect than the extract of Artemisia annua.

From the above, the extract of Mugwort of the present invention has excellent melanin production inhibiting effects, collagen production promoting effects, and antioxidant effects, and therefore the extract of Mugwort of the present invention is useful not only in the beauty field. It can also be used in the medical field, and is expected to be applied to foods, cosmetics, quasi-drugs, pharmaceuticals, etc.

Claims (2)

A melanin production inhibitor characterized by containing 0.001 to 10% by weight of an ethanol extract of Artemisia montana. A food composition for improving and preventing pigmentation due to melanin, which contains 0.001 to 10% by weight of an ethanol extract of Artemisia montana.