JP2022191664A - Collagen production promoter, mmp-2 inhibitor, cell growth promoter and internal agent - Google Patents

Abstract

To provide a novel external/internal agent having excellent actions of promoting collagen production, inhibiting MMP-2 and promoting cell growth.SOLUTION: The present invention provides a collagen production promoter, an MMP-2 inhibitor, a cell growth promoter, or a wrinkle improver each containing Schizonepeta spike extract. There is also provided a food composition that contains Schizonepeta spike extract and is used for preventing or improving various diseases caused by enhanced MMP.SELECTED DRAWING: None

Description

TECHNICAL FIELD The present invention relates to collagen production promoters, MMP-2 inhibitors, cell proliferation promoters and internal preparations.

Fibroblasts and collagen are present in the dermis, and type I collagen accounts for 80% of the total. Besides type I collagen, the existence of type III, V, XII and XIV collagens is known. One of the causes of wrinkles and sagging is a decrease in type I collagen. Therefore, promoting the production of type I collagen is considered to be effective in preventing and improving wrinkles and sagging. In addition, promoting the production of type I collagen is also effective in improving skin wound healing.

In addition to UV rays, the skin is exposed to various physical and chemical stresses such as dryness, cold, heat and drugs on a daily basis. As a result, functional deterioration of the skin is caused, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles, and are wrinkles that are temporarily caused by a decrease in the water content in the stratum corneum due to dryness of the skin. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in sunlight and aging. The mechanism of its formation includes a decrease in the ability to synthesize collagen in dermal fibroblasts due to ultraviolet rays and aging.

Epidermal wrinkles caused by dryness and dermal wrinkles differ in histological morphology, onset mechanisms, and treatment methods. Dermal wrinkles caused by UV rays and aging can be improved by using cosmetics with moisturizing effects. is difficult.

So far, for the purpose of improving dermal wrinkles caused by ultraviolet rays, a skin wrinkle formation preventive/improving agent containing hydrolyzed almonds as an active ingredient (Patent Document 1), extracts of mulberry, tenki and marigold has been reported as an active ingredient for improving wrinkles caused by ultraviolet irradiation (Patent Document 2).

Gelatinase (MMP-2), which belongs to matrix metalloprotease (MMP), is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and is an enzyme produced by collagen, gelatin, and elastin (arteries, tendons, skin, and other elastic tissues). It decomposes substrates such as structural proteins that make up the components. Therefore, a substance having an inhibitory activity against gelatinase is expected to have an effect of suppressing angiogenesis in cancer tissue and metastasis of cancer, and is considered useful for the prevention and treatment of cancer diseases. Furthermore, inhibition of MMPs is useful not only for cancer diseases, but also for the prevention, treatment and improvement of various diseases such as ulceration, rheumatoid arthritis, osteoporosis and periodontitis caused by MMP enhancement.

In general, with aging, the ability of epidermal cells to proliferate and divide decreases, and the epidermal layer itself becomes thinner (Non-Patent Document 1). Biological factors such as epidermal growth factor (EGF/epidermal growth factor) and female hormones (estrogen) act on epidermal cell proliferation in the skin, but their secretion decreases with aging. Such deterioration in epidermal cell metabolic function due to aging delays the turnover rate of the skin and causes rough skin and aging of the skin. In addition, the retention of stratum corneum cells that peel off from the surface of the stratum corneum hinders the smooth excretion of melanin in the epidermis, causing pigmentation and dullness of the skin. Furthermore, it is also known that wound healing of the epidermis is delayed. In order to prevent or improve the progression of these phenomena, many attempts have been made to search for components that promote the proliferation of epidermal cells and to propose topical skin preparations.

Keigai (scientific name: Schizonepeta tenuifolia) is an annual plant belonging to the genus Catnip of the Labiatae family. The herbal medicine, keigaisui, is the dried flower spikes of the mussel. It is used in Kampo medicines such as Jingkairenkyoto and Jumihaidokuto. So far, mussel extracts have a testosterone 5α-reductase inhibitory effect and can be used as a hair tonic (Patent Document 3), have a tyrosinase inhibitory effect and an active oxygen scavenging effect, and can be used as a whitening agent (Patent Document 4). It has an effect of promoting the production of cathepsin D and can be used as a hair loss promoting agent (Patent Document 5), and has an effect of promoting the production of involucrin and transglutaminase and the formation of a cornified envelope (Patent Document 6). Are known. However, it was not known that the mussel extract has collagen production-promoting action, MMP-2 inhibitory action and cell proliferation-promoting action.

JP-A-2000-119125 JP 2006-199611 A JP-A-1985-146829 JP-A-1992-247010 JP-A-2003-95903 JP 2018-127407 A

Varani J et al. , J Invest Dermatol, Vol. 3, pp 57-60, 1998

There is a demand for materials that are safe, have excellent stability, and have excellent collagen production-promoting action, MMP-2 inhibitory action, and cell proliferation-promoting action.

Under such circumstances, the present inventors have made extensive studies and found that the extract of the mussel has excellent collagen production-promoting action, MMP-2 inhibitory action and cell proliferation-promoting action, and is also excellent in stability. Found it. Furthermore, the external preparation or internal preparation containing the extract is safe and stable, and has excellent collagen production promoting action, MMP-2 inhibitory action and cell proliferation promoting action, and is a multifunctional beauty and health material. , found that it can be used as a pharmaceutical product, and completed the present invention.

That is, the present invention includes the following inventions.
(1) A collagen production promoter characterized by containing an extract of a mussel.
(2) An MMP-2 inhibitor characterized by containing an extract of mussels.
(3) A cell growth promoter characterized by containing an extract of mussels.
(4) A wrinkle-improving agent characterized by containing an extract of mussels.
(5) A food composition for preventing and improving various diseases caused by MMP enhancement, characterized by containing a mussel extract.

INDUSTRIAL APPLICABILITY According to the present invention, there are provided collagen production promoters, MMP-2 inhibitors and cell proliferation promoters containing a mussel extract as an active ingredient.

The mussel (scientific name: Schizonepeta tenuifolia) used in the present invention is an annual plant belonging to the genus Catnip of the Labiatae family. It grows wild in various parts of China, is cultivated in Hebei Province and Zhejiang Province, etc., and is widely distributed in the Chinese and Japanese markets. In the present invention, the extract of mussels refers to an extract of a part of the plant body such as spikes, fruits, seeds, leaves, stems, roots, etc., or the whole plant, or a mixture thereof. The part to be used is preferably the spike that is used as a crude drug (pill). For extraction, the plant body may be used as it is, or may be subjected to treatments such as drying, pulverization, and shredding.

The extraction method is not particularly limited, but it can be carried out by using water, hot water, or a mixed solvent of water and an organic solvent, and stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, , glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used singly or in combination of two or more. Particularly preferred extraction solvents include water, a mixed polar solvent of water-ethanol, or a mixed polar solvent of water-1,3-butylene glycol. The amount of the solvent to be used is not particularly limited. For example, it may be 10 times or more, preferably 20 times or more, relative to the flower spike (dry weight) of the mussel. However, when concentrating or isolating after extraction, is preferably 100 times or less for convenience of operation. Also, the extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, and the like.

The above extract may be used as an extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization by activated carbon, etc., within the range where the effect of the present invention is exhibited. , deodorization, ethanol precipitation, or the like may be performed before use. Furthermore, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

In the present invention, the above extract may be used as it is, and oils and fats, waxes, hydrocarbons, etc., which are ingredients used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., as long as the effects of the extract are not impaired. fatty acids, alcohols, esters, surfactants, metallic soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, Components such as chelating agents, excipients, film-forming agents, sweeteners and acidulants may be contained.

The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods. , bath agents, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids , emulsions, suppositories, injection solutions and the like.

For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight in terms of solid matter. Furthermore, 0.01 to 5% by weight is most preferred. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to recognize the enhancement of the effect and it is uneconomical.

In the case of internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Furthermore, 20 mg to 2 g is most preferred.

Next, in order to explain the present invention in detail, production examples, experimental examples and formulation examples of the extract used in the present invention will be given as examples, but the present invention is not limited to these. % shown in Production Examples means % by weight, and parts of content shown in Formulation Examples means parts by weight.

Example of preparation of extract of mussels An extract of mussels was prepared as follows. In Production Examples 1 to 4, spikes of mussels were used as an extraction material.

(Production Example 1) Preparation of hot water extract of mussels 200 mL of water was added to 10 g of dried mussels and extracted at 95 to 100°C for 2 hours. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 3.0 g of hot water extract of mussels.

(Production Example 2) Preparation of 50% ethanol extract of mussel Extracted by immersing 10 g of dried mussel in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days. The resulting extract was filtered and concentrated to dryness using an evaporator to obtain 1.6 g of a 50% ethanol extract of mussels.

(Production Example 3) Preparation of ethanol extract of mussel 10 g of dried mussel was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.8 g of an ethanol extract of mussels.

(Production Example 4) Preparation of 1,3-butylene glycol extract of mussel 10 g of dried mussel was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The resulting extract was filtered to obtain 191 g of a 1,3-butylene glycol extract of mussels.

(Prescription example 1) Lotion Prescription Content (parts)
1. Hot water extract of mussel (Production Example 1) 2.0
2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance Appropriate amount 11. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, mixed and filtered to obtain a product.

(Comparative Formulation Example 1) Conventional Lotion A conventional lotion was prepared by replacing the hot water extract of mussels with purified water in Formulation Example 1.

(Prescription example 2) Cream Prescription Content (parts)
1. 50% ethanol extract of mussel (manufacturing example 2) 1.0
2. Squalane 5.5
3. Olive oil 3.0
4. stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20 E.O.) 3.0
8. behenyl alcohol 1.5
9. Glyceryl monostearate 2.5
10. Perfume 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-butylene glycol 8.5
13. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 9 are dissolved by heating, mixed, and maintained at 70°C to form an oil phase. Ingredients 1 and 11 to 13 are heated, melted and mixed, and kept at 75°C to form an aqueous phase. Add the water phase to the oil phase to emulsify, cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain the product.

(Comparative Formulation Example 2) Conventional Cream In Formulation Example 2, a conventional cream was obtained by replacing the 50% ethanol extract of mussels with purified water.

(Prescription example 3) Milky lotion Prescription Content (parts)
1. Ethanol extract of mussel (Production Example 3) 0.01
2. Squalane 5.0
3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glyceryl monostearate 2.0
7. Polyoxyethylene cetyl ether (20 E.O.) 3.0
8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Perfume 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 8 are dissolved by heating, mixed, and kept at 70°C to form an oil phase. Ingredients 10 to 13 are dissolved by heating, mixed, and kept at 75° C. to form an aqueous phase. Add the water phase to the oil phase to emulsify, cool while stirring, add component 9 at 45°C, and further cool to 30°C to obtain the product.

(Prescription example 4) Gel Formulation Content (parts)
1. 1,3-butylene glycol extract of mussel (manufacturing example 4) 1.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxy vinyl polymer 0.2
10. Potassium hydroxide 0.2
11. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 5 and components 1 and 6 to 11 are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 5) Pack Prescription Content (parts)
1. Hot water extract of mussel (Production Example 1) 1.0
2. 1,3-butylene glycol extract of mussel (manufacturing example 4) 5.0
3. Polyvinyl alcohol 12.0
4. Ethanol 5.0
5.1,3-butylene glycol 8.0
6. Methyl paraoxybenzoate 0.2
7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5
8. Citric acid 0.1
9. Sodium citrate 0.3
10. Fragrance Appropriate amount 11. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 11 are uniformly dissolved to obtain a product.

(Prescription example 6) Foundation Prescription Content (parts)
1. 50% ethanol extract of mussel (manufacturing example 2) 1.0
2. stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
4. Polyoxyethylene cetyl ether (20 E.O.) 2.0
5. Cetanol 1.0
6. Liquid Lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Carboxymethylcellulose sodium 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengara 1.0
17. Yellow iron oxide 2.0
18. Perfume Appropriate amount 19. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 8 are dissolved by heating and maintained at 80°C to form an oil phase. Ingredient 19 is sufficiently swelled with ingredient 9, then ingredients 1 and 10 to 13 are added and mixed uniformly. Ingredients 14 to 17 pulverized and mixed with a pulverizer are added to this, stirred with a homomixer and kept at 75° C. to form an aqueous phase. Add the water phase to the oil phase with stirring to emulsify. After cooling, add component 18 at 45°C and cool to 30°C with stirring to obtain the product.

(Prescription example 7) Bath agent Prescription Content (parts)
1. Ethanol extract of mussel (Production Example 3) 1.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume Appropriate amount 5. [Manufacturing method] Components 1 to 5 are uniformly mixed to obtain a product.

(Prescription example 8) Ointment Prescription Content (parts)
1. Hot water extract of mussel (Production Example 1) 5.0
2. 1,3-butylene glycol extract of mussel (manufacturing example 4) 1.0
3. Polyoxyethylene cetyl ether (30 E.O.) 2.0
4. Glyceryl monostearate 10.0
5. Liquid paraffin 5.0
6. Cetanol 6.0
7. Methyl paraoxybenzoate 0.1
8. Propylene glycol 10.0
9. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 3 to 6 are dissolved by heating, mixed, and kept at 70°C to form an oil phase. Ingredients 1, 2 and 7 to 9 are dissolved by heating, mixed, and maintained at 75°C to form an aqueous phase. The water phase is added to the oil phase to emulsify, and the mixture is cooled to 30°C while stirring to obtain a product.

(Prescription example 9) Powder Formulation Content (parts)
1. Hot water extract of mussel (Production Example 1) 1.0
2. Dry cornstarch 39.0
3. Microcrystalline cellulose 60.0
[Manufacturing method] Components 1 to 3 are mixed to form a powder.

(Prescription example 10) Tablet Prescription Content (parts)
1. Ethanol extract of mussel (Production Example 3) 5.0
2. Dry cornstarch 25.0
3. Carboxymethylcellulose calcium 20.0
4. Microcrystalline cellulose 40.0
5. polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and tableted. One tablet is 0.52 g.

(Prescription example 11) Tablet prescription Content (parts)
1. Ethanol extract of mussel (Production Example 3) 2.0
2. Dry cornstarch 49.8
3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Perfume 0.1
7. Purified water 0.1
[Manufacturing method] Components 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and compressed into tablets. 1 grain is 1.0 g.

(Prescription example 12) Beverage Prescription Content (parts)
1. Hot water extract of mussel (Production Example 1) 0.05
2. Stevia 0.05
3. Malic acid 5.0
4. Perfume 0.1
5. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 3 are dissolved in a small amount of water. Ingredients 4 and 5 are then added and mixed.

Next, experimental examples will be given in order to describe the effects of the present invention in detail.

Experimental Example 1 Measurement of Type I Collagen (COL1A1) and MMP-2 mRNA Expression Levels COL1A1 and MMP-2 mRNA expression levels were measured. 1×10 ⁵ human dermal fibroblasts were seeded in a 60 mm dish and cultured in a DMEM culture solution containing 10% FBS under conditions of 37° C. and 5% CO ₂ . When the cells became confluent, each sample was cultured for 24 hours in DMEM(−) culture medium added to final concentrations of 1 and 10 μg/mL, and then total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The mRNA expression level was measured by real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, PrimeScript RT Master Mix (Takara Bio) and SYBR Select Master Mix (Life Technologies) were used. That is, after reverse transcription of 500 ng of total RNA, PCR reaction (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the prescribed method, and the expression levels of COL1A1 and MMP-2 mRNA were determined as a ratio to the expression level of GAPDH mRNA, which is an internal standard. The COL1A1 expression promotion rate was calculated as the ratio of the COL1A1 mRNA expression level in the sample-added group to the COL1A1 mRNA expression level in the control (sample-free) group. The MMP-2 expression suppression rate was also calculated in the same manner. The primers used for measuring the expression level of each gene are as follows.

Primer set AGGACAAGAGGGCATGTCTGGTT for COL1A1 (SEQ ID NO: 1)
TTGCAGTGGGTAGGTGATGTTCTG (SEQ ID NO: 2)
Primer set CCGTCGCCCATCATCAA for MMP-2 (SEQ ID NO: 3)
CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 4)
Primer set TGCACCACCAACTGCTTAGC for GAPDH (SEQ ID NO: 5)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 6)

The results of these experiments are shown in Tables 1 and 2. As a result, the mussel extract of the present invention was found to have an excellent COL1A1 expression promoting effect (collagen production promoting effect) and MMP-2 expression suppressing effect (MMP-2 inhibitory effect). Incidentally, Production Example 4 also showed the same effect. In particular, the COL1A1 expression-promoting effect of the mussel 50% ethanol extract (Production Example 2) and the MMP-2 expression-suppressing effect of the mussel ethanol extract (Production Example 3) were remarkably high.

Experimental Example 2 Cell Proliferation Promotion Test Human-derived keratinocytes were seeded at 1×10 ³ per well in a DMEM culture medium containing 0.5% FBS, and the final concentrations of each sample were 0.01 and 0.01. After adding to 1 μg/mL, the cells were cultured for 5 days under conditions of 37° C. and 5% CO ₂ . Cell count was measured by staining method. That is, after the culture was completed, the culture medium was removed, and the cells were fixed using methanol. Subsequently, 0.1% methylene blue was added to stain the cells for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and well stirred, and the absorbance at 650 nm was measured using a microplate reader. The cell growth rate was calculated as the ratio of the cell amount of the sample-added group to the cell amount of the control (no sample-added) group.

These experimental results are shown in Table 3. As a result, the mussel extract of the present invention exhibited an excellent cell growth-promoting effect. Incidentally, Production Example 4 also showed the same effect.

Experimental Example 3 Use Test Using the cream of Formulation Example 2 and the conventional cream of Comparative Formulation Example 2, a one-month use test was conducted on 7 subjects (25 to 66 years old) with wrinkles and sagging. After use, the degree of wrinkles and sagging was determined by a questionnaire.

As a result, the cream containing the extract of the present invention reduced wrinkles and sagging. During the test period, no skin trouble occurred, and there was no problem in terms of safety. Moreover, there was no problem with deterioration of prescription components.

Further, using the lotion of Formulation Example 1 and the conventional lotion of Comparative Formulation Example 1, a use test was conducted in the same manner. As a result, wrinkles and sagging were reduced by the lotion containing the extract of the present invention.

As described above, the mussel extract of the present invention has excellent collagen production-promoting action, MMP-2 inhibitory action and cell proliferation-promoting action, and is also excellent in stability. Therefore, the mussel extract of the present invention can be used not only in the cosmetic field such as skin aging, but also in the medical field such as suppression of functional deterioration due to aging, prevention and treatment of cancer, etc. And application to pharmaceuticals is expected.

Claims (5)

A collagen production promoter comprising an extract of a mussel. An MMP-2 inhibitor characterized by containing an extract of mussels. A cell growth promoter characterized by containing an extract of a mussel. A wrinkle-improving agent characterized by containing an extract of a mussel. A food composition for preventing and improving various diseases caused by MMP enhancement, characterized by containing a mussel extract.