JP2022010923A - Collagen production promoter, cell growth promoter, and melanin production inhibitor - Google Patents

Abstract

To provide external or internal agents with an excellent collagen production-promoting action, cell growth-promoting action, and melanin production-inhibiting action.SOLUTION: The extract of Portulaca oleracea has an excellent collagen production-promoting action, cell growth-promoting action, and melanin production-inhibiting action, and is also excellent in stability. The extract of Portulaca oleracea can be used not only in the beauty field such as skin aging prevention, but also in the medical field such as suppression of functional deterioration due to aging, and cancer prevention and treatment, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals, and the like.SELECTED DRAWING: None

Description

The present invention relates to a collagen production promoter, a cell proliferation promoter and a melanin production inhibitor.

The skin is exposed daily to various physical and chemical stresses such as UV, dry, cold, heat and drugs. As a result, functional deterioration of the skin is caused, and various skin aging phenomena become apparent. Wrinkles are one of the skin aging phenomena. It is known that there are two types of wrinkles, epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles, which are temporary wrinkles caused by a decrease in the amount of water in the epidermal keratin due to dry skin. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in the sun's rays and aging. The formation mechanism includes a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays and aging, and an increase in matrix metalloproteinase (MMP) to promote collagen degradation.

Epidermal wrinkles caused by dryness and dermal wrinkles have different histological morphology, onset mechanism, and treatment method, and dermal wrinkles caused by ultraviolet rays and aging are improved by using cosmetics having a moisturizing effect. That is difficult.

So far, for the purpose of improving dermal wrinkles caused by ultraviolet rays, an agent for preventing / improving skin wrinkles containing hydrolyzed almond as an active ingredient (Patent Document 1), extracts of Jochokei, Tenki and Kisensou. (Patent Document 2) has been reported as an agent for improving wrinkles caused by irradiation with ultraviolet rays containing the active ingredient.

In addition, fibroblasts and collagen are present in the dermis, and type I collagen accounts for 80% of the total. In addition to type I collagen, the presence of type III, V, XII and XIV collagen is known. One of the causes of wrinkles and sagging is a decrease in type I collagen. Therefore, promoting the production of type I collagen is effective in preventing and improving wrinkles and sagging.

In general, the proliferation and division ability of epidermal cells decreases with aging, and the epidermal layer itself becomes thin (Non-Patent Document 1). The biological factors Epidermal Growth Factor (EGF / epidermal growth factor) and female hormone (estrogen) act on the proliferation of epidermal cells of the skin, but their secretion decreases with aging. Such a decrease in epidermal cell metabolic function due to aging slows down the turnover rate of the skin and causes rough skin and aging of the skin. In addition, the retention of corneocytes that peel off from the surface of the stratum corneum prevents smooth excretion of melanin in the epidermis, which causes pigmentation and dullness of the skin. It is also known that wound healing of the epidermis is delayed. In order to prevent or improve the progression of these phenomena, many searches have been made for components that promote the proliferation of epidermal cells and proposals for external skin preparations.

In general, skin pigmentation seen in age spots, freckles, sunburns, etc. causes melanin pigmentation cells existing in the skin to excessively produce melanin pigment due to hormonal abnormalities or UV stimulation, which causes the skin to produce excess melanin pigment. It is said to be caused by deposition. As one of the methods for preventing such pigmentation, a method for suppressing excessive production of melanin is known. Conventionally, ascorbic acid (vitamin C) and the like have been used as whitening agents for internal and external use in the treatment of pigmentation (Patent Document 3).

Portulaca oleracea (scientific name: Portulaca oleracea) is a perennial herb belonging to the genus Purslane of the order Caryophyllales. It is used in folk medicine because it has a beneficial effect. So far, the extract of Suberihiyu has a lipolysis promoting action (Patent Document 4), an antioxidant action (Patent Document 5), and an antiallergic action (Patent Document 6). It is known that it has an action of controlling the shape of hair by suppressing the expression of IGFBP-5 (Patent Document 7). However, it has not been known that the purslane extract has a collagen production promoting action, a cell proliferation promoting action and a melanin production suppressing action.

Japanese Unexamined Patent Publication No. 2000-119125 Japanese Unexamined Patent Publication No. 2006-199611 Japanese Unexamined Patent Publication No. 5-22993 Japanese Unexamined Patent Publication No. 2005-60366 Japanese Unexamined Patent Publication No. 2007-126368 Japanese Unexamined Patent Publication No. 2008-2477779 Japanese Unexamined Patent Publication No. 2010-150150

Varani J et al. , J Invest Dermatol, Vol. 3, pp 57-60, 1998

Materials that are safe, have excellent stability, and have excellent collagen production-promoting action, cell proliferation-promoting action, and melanin production-suppressing action have been desired, but at present, materials that are sufficiently satisfactory have not been provided.

Under these circumstances, the present inventors have diligently studied and found that the purslane extract has excellent collagen production promoting action, cell proliferation promoting action and melanin production suppressing action, and is also excellent in stability. rice field. Furthermore, the external or internal preparation containing the extract is safe and stable, has excellent collagen production promoting action, cell proliferation promoting action and melanin production suppressing action, and is a multifunctional beauty / health material. He found that it could be a pharmaceutical product and completed the present invention.

That is, the present invention includes the following inventions.
(1) A collagen production promoter comprising an extract of purslane.
(2) A cell proliferation promoter containing an extract of purslane.
(3) A melanin production inhibitor characterized by containing an extract of purslane.
(4) A whitening agent containing an extract of purslane.

According to the present invention, a collagen production promoter, a cell proliferation promoter and a melanin production inhibitor containing purslane extract as an active ingredient are provided. In addition, since purslane extract is a natural edible plant, it has no side effects and is highly safe. Therefore, the external or internal preparation containing the purslane extract can be used with confidence.

Portulaca oleracea (scientific name: Portulaca oleracea, Japanese name: purslane, crude drug name: purslane) used in the present invention is an annual plant belonging to the genus Purslane of the order Caryophyllales, and is known as a representative C4 plant. ing. It is resistant to drought, inhabits widely from the tropics to the temperate zone, and is found all over Japan. It is generally fleshy, with reddish-purple stems and green, oval spatula-shaped leaves. In the present invention, the extract of purslane refers to an extract of a part of a plant such as flowers, fruits, seeds, leaves, stems, roots, etc., the whole plant (whole plant), or a mixture thereof. In the invention, the site used as an extraction raw material is preferably whole plant used as a crude drug (purslane). In addition, the plant may be used as it is for extraction, or may be dried, crushed, shredded or the like.

The extraction method is not particularly limited, but can be carried out by a method of stirring or column extraction using water or hot water, or a mixed solvent of water and an organic solvent. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, etc.). , Glycerin, etc.), Ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.) Etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferable, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferable. These solvents may be used alone or in admixture of two or more. Particularly preferable extraction solvents include a mixed polar solvent of water and water-ethanol or a mixed polar solvent of water-1,3-butylene glycol. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more the whole plant of purslane (dry weight), but may be concentrated or isolated after extraction. It is preferably 100 times or less for convenience of operation in the case. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure at the time of extraction, and the like.

The above extract may be used as it is in the extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization by activated carbon, etc. is performed within the range in which the effect of the present invention is exhibited. , Deodorization, ethanol precipitation, etc. may be performed before use. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze-drying and the like, and used as a dried product.

In the present invention, the above-mentioned extract may be used as it is, and as long as the effect of the extract is not impaired, fats and oils, waxes and carbonized compounds which are components used in cosmetics, non-pharmaceutical products, pharmaceuticals or foods, etc. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH regulators, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , Chelating agents, excipients, film agents, sweeteners, acidulants and the like may be contained.

The present invention can be used in any of cosmetics, non-pharmaceutical products, pharmaceuticals, and foods, and its dosage form includes, for example, cosmetics, creams, emulsions, gels, aerosols, essences, packs, and cleaning agents. , Baths, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candy, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids , Emulsions, suppositories, injection solutions and the like.

In the case of external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight in terms of solid matter. Further, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, the enhancement of the effect is hardly recognized and it is uneconomical.

For internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Usually, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Further, 20 mg to 2 g is most preferable.

Next, in order to explain the present invention in detail, production examples, experimental examples, and formulation examples of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. The% shown in the production example means% by weight, and the content part shown in the formulation example means a weight part.

Example of production of purslane extract The purslane extract was produced as follows. In Production Examples 1 to 4, purslane whole plant was used as the extraction material.

(Production Example 1) Preparation of Hot Water Extract of Portulaca oleracea 200 mL of water was added to 10 g of dried purslane, and the mixture was extracted at 95 to 100 ° C. for 2 hours. The obtained extract was filtered, the filtrate was concentrated, and freeze-dried to obtain 2.4 g of a hot water extract of purslane.

(Production Example 2) Preparation of 50% Ethanol Extract of Portulaca oleracea 10 g of dried purslane was immersed in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days for extraction. The obtained extract was filtered and then concentrated to dryness with an evaporator to obtain 1.7 g of a 50% ethanol extract of purslane.

(Production Example 3) Preparation of ethanol extract of purslane 10 g of dried purslane was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After filtering the obtained extract, it was concentrated to dryness with an evaporator to obtain 0.2 g of an ethanol extract of purslane.

(Production Example 4) Preparation of 1,3-butylene glycol extract of purslane 10 g of dried purslane was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The obtained extract was filtered to obtain 190 g of purslane 1,3-butylene glycol extract.

(Prescription example 1) Toner prescription content (part)
1. 1. Hot water extract of purslane (Production Example 1) 2.0
2.1,3-butylene glycol 8.0
3. 3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Appropriate amount of fragrance 11. [Manufacturing method] Ingredients 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water to make the total amount 100, and both are mixed and filtered to obtain a product.

(Comparative Prescription Example 1) Conventional Toner In Formulation Example 1, the hot water extract of purslane was replaced with purified water, and the conventional lotion was used.

(Prescription example 2) Cream prescription content (part)
1. 1. Purslane 50% ethanol extract (Production Example 2) 1.0
2. 2. Squalene 5.5
3. 3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-Butylene Glycol 8.5
13. [Manufacturing method] Ingredients 2 to 9 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 11 to 13 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, the component 10 is added at 45 ° C, and the product is further cooled to 30 ° C to obtain a product.

(Comparative Formulation Example 2) Conventional Cream In Formulation Example 2, a cream obtained by replacing 50% ethanol extract of purslane with purified water was used as a conventional cream.

(Prescription example 3) Emulsion prescription content (part)
1. 1. Portulaca oleracea ethanol extract (Production Example 3) 0.01
2. 2. Squalene 5.0
3. 3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glycerin monostearate 2.0
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Polyoxyethylene sorbitan monooleate (20EO) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Ingredients 1 to 8 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 10 to 13 are heated and dissolved, mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 9 is added at 45 ° C, and the product is further cooled to 30 ° C to obtain a product.

(Prescription example 4) Gel preparation Prescription content (part)
1. 1. Purslane 1,3-butylene glycol extract (Production Example 4) 1.0
2. 2. Ethanol 5.0
3. 3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60EO) 0.1
5. Appropriate amount of fragrance 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Manufacturing method] Ingredients 2 to 5 and components 1 and 6 to 11 having a total amount of 100 in purified water are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 5) Pack prescription content (part)
1. 1. Hot water extract of purslane (Production Example 1) 1.0
2. 2. Portulaca oleracea 1,3-butylene glycol extract (Production Example 4) 5.0
3. 3. Polyvinyl alcohol 12.0
4. Ethanol 5.0
5.1,3-butylene glycol 8.0
6. Methyl paraoxybenzoate 0.2
7. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
8. Citric acid 0.1
9. Sodium citrate 0.3
10. Appropriate amount of fragrance 11. [Manufacturing method] Ingredients 1 to 11 having a total amount of 100 in purified water are uniformly dissolved to prepare a product.

(Prescription example 6) Foundation prescription content (part)
1. 1. Purslane 50% ethanol extract (Production Example 2) 1.0
2. 2. Stearic acid 2.4
3. 3. Polyoxyethylene sorbitan monostearate (20EO) 1.0
4. Polyoxyethylene cetyl ether (20EO) 2.0
5. Cetanol 1.0
6. Liquid lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Sodium Carboxymethyl Cellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Appropriate amount of fragrance 19. [Manufacturing method] Ingredients 2 to 8 having a total amount of 100 in purified water are dissolved by heating and kept at 80 ° C. to prepare an oil phase. Ingredient 9 is well swollen with ingredient 19, then ingredients 1 and 10-13 are added and mixed uniformly. Ingredients 14 to 17 pulverized and mixed by a pulverizer are added thereto, and the mixture is stirred with a homomixer and kept at 75 ° C. to prepare an aqueous phase. Add the aqueous phase to the oil phase while stirring to emulsify. Then, it is cooled, the component 18 is added at 45 ° C., and the product is cooled to 30 ° C. while stirring.

(Prescription example 7) Prescription content for bath (part)
1. 1. Portulaca oleracea ethanol extract (Production Example 3) 1.0
2. 2. Sodium bicarbonate 50.0
3. 3. Yellow No. 202 (1) Appropriate amount 4. Appropriate amount of fragrance 5. [Manufacturing method] Ingredients 1 to 5 having a total amount of 100 with sodium sulfate are uniformly mixed to prepare a product.

(Prescription example 8) Ointment prescription content (part)
1. 1. Hot water extract of purslane (Production Example 1) 5.0
2. 2. Purslane 1,3-butylene glycol extract (Production Example 4) 1.0
3. 3. Polyoxyethylene cetyl ether (30EO) 2.0
4. Glycerin monostearate 10.0
5. Liquid paraffin 5.0
6. Cetanol 6.0
7. Methyl paraoxybenzoate 0.1
8. Propylene glycol 10.0
9. [Manufacturing method] Ingredients 3 to 6 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1, 2 and 7 to 9 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C. with stirring to obtain a product.

(Prescription example 9) Powder prescription content (part)
1. 1. Hot water extract of purslane (Production Example 1) 1.0
2. 2. Dried cornstarch 39.0
3. 3. Microcrystalline Cellulose 60.0
[Manufacturing method] Ingredients 1 to 3 are mixed to prepare a powder.

(Prescription example 10) Tablet prescription content (part)
1. 1. Portulaca oleracea ethanol extract (Production Example 3) 5.0
2. 2. Dried cornstarch 25.0
3. 3. Carboxymethyl cellulose calcium 20.0
4. Microcrystalline Cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Ingredients 1 to 4 are mixed, and then an aqueous solution of ingredient 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and the mixture is locked. One tablet weighs 0.52 g.

(Prescription example 11) Tablet confectionery prescription content (part)
1. 1. Portulaca oleracea ethanol extract (Production Example 3) 2.0
2. 2. Dried cornstarch 49.8
3. 3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Fragrance 0.1
7. Purified water 0.1
[Manufacturing method] Ingredients 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and the mixture is locked. One grain is 1.0 g.

(Prescription example 12) Beverage prescription content (part)
1. 1. Hot water extract of purslane (Production Example 1) 0.05
2. 2. Stevia 0.05
3. 3. Malic acid 5.0
4. Fragrance 0.1
5. [Manufacturing method] Ingredients 1 to 3 having a total amount of 100 in purified water are dissolved in a small amount of water. Then, components 4 and 5 are added and mixed.

Next, in order to explain the effect of the present invention in detail, an experimental example will be given.

Experimental Example 1 Measurement of type I collagen (COL1A1) mRNA expression level COL1A1 mRNA expression level was measured. Human fibroblasts NB1RGB were seeded in 1 × 10 ⁵ pieces in φ60 mm dish and cultured in DMEM culture medium containing 10% FBS under 37 ° C. and 5% CO ₂ conditions. When the sample was in a confluent state, each sample was cultured in DMEM (-) culture medium added to a final concentration of 1 or 10 μg / mL for 24 hours, and then total RNA was extracted. Extraction of total RNA from cells was performed using RNAiso Plus (Takara Bio), and the total amount of RNA was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, PrimerScript RT Master Mix (Takara Bio) and SYBR Select Master Mix (Life Technologies) were used. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C: 15 seconds, 60 ° C: 60 seconds, 40 cycles) was performed. For other operations, the expression level of COL1A1 mRNA was determined as a ratio to the expression level of GAPDH mRNA, which is an internal standard, according to a predetermined method. The COL1A1 expression promotion rate was calculated as the ratio of the expression level of COL1A1 mRNA in the sample-added group to the expression level of COL1A1 mRNA in the control (non-sampled) group. The primers used to measure the expression level of each gene are as follows.

Primer set for COL1A1 AGGACAAGAGGCATGTCGGTT (SEQ ID NO: 1)
TTGCAGTGGTAGGTGATGTTCG (SEQ ID NO: 2)
Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGGGCAGTGATG (SEQ ID NO: 4)

The results of these experiments are shown in Table 1. As a result, the extract of purslane of the present invention was found to have an excellent COL1A1 expression promoting effect (collagen production promoting action).

Experimental Example 2 Cell proliferation promotion test HaCaT cells were seeded in DMEM culture medium containing 0.5% FBS in 2 × 10 ³ cells per 1 well on a 96-well plate, and after adding each sample, the temperature was 37 ° C. and 5% CO. The cells were cultured under ₂ conditions for 4 days. The cell number was measured by the staining method. That is, after the completion of the culture, the culture solution was removed and the cells were fixed using methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and stirred well, and the absorbance at 650 nm was measured using a microplate reader. The cell proliferation rate was calculated as the ratio of the cell mass of the sample-added group to the cell mass of the control (non-sampled) group.

The results of these experiments are shown in Table 2. As a result, the extract of purslane of the present invention showed an excellent cell proliferation promoting effect.

Experimental Example 3 Melanin production suppression test using B16 mouse melanoma 3 × 10 ⁴ B16 mouse melanoma cells were seeded in φ60 mm dish, and each sample was added to a final concentration of 1 or 10 μg / mL, and contained 10% FBS. The cells were cultured in MEM culture medium at 37 ° C. under 5% CO ₂ conditions for 5 days. After culturing, the cells were detached, and the pellet obtained by centrifugation was dissolved in PBS (-) by ultrasonic crushing. Protein quantification was performed using the Lowry method (J. Biol. Chem., 193,265-275,1951). When measuring the amount of melanin, add 4N NaOH to the remaining cell disruption solution taken for protein quantification, heat at 60 ° C. for 2 hours, and then use a spectrophotometer (Shimadzu Seisakusho) to absorb the absorbance at 475 nm. Was measured, the amount of melanin was determined from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the decrease in the amount of melanin in the sample-added group to the control (sample-free) group.

The results of these experiments are shown in Table 3. As a result, it was confirmed that the purslane extract of the present invention has an excellent melanin production inhibitory effect.

Regarding these Experimental Examples 1 to 3, the same effect was observed in Production Examples 3 and 4.

Experimental Example 4 Use test Using the cream of Prescription Example 2 and the conventional cream of Comparative Prescription Example 2, a one-month use test was conducted on 5 people (26-66 years old) with wrinkles and sagging. After use, the degree of wrinkles and sagging was judged by a questionnaire.

As a result, the cream containing the extract of the present invention reduced wrinkles and sagging. During the test period, there was no skin trouble and there was no problem in terms of safety. In addition, there was no problem with the deterioration of the prescription ingredients.

In addition, the use test was carried out in the same manner using the lotion of Formulation Example 1 and the conventional lotion of Comparative Formulation Example 1. As a result, it was confirmed that the lotion containing the extract of the present invention reduced wrinkles and sagging.

From the above, the purslane extract of the present invention has an excellent collagen production promoting action, a cell proliferation promoting action and a melanin production suppressing action, and is also excellent in stability. Therefore, the extract of Suberihiyu of the present invention can be used not only in the beauty field such as skin aging but also in the medical field such as suppression of functional deterioration due to aging, cancer prevention and treatment, and cosmetics, foods and quasi-drugs. And is expected to be applied to pharmaceutical products.

Claims (4)

A collagen production promoter characterized by containing an extract of purslane. A cell proliferation promoter characterized by containing an extract of purslane. A melanin production inhibitor characterized by containing an extract of purslane. A whitening agent characterized by containing an extract of purslane.