KR102631500B1 - Composition for skin whitening comprising extract of hempseed meal as effective component - Google Patents

Abstract

The present invention relates to a composition for skin whitening containing hemp seed meal extract as an active ingredient. The active ingredient has excellent tyrosinase inhibitory activity and melanin synthesis inhibitory activity, and is therefore effective in treating skin whitening composition and melanin hyperpigmentation disease. It can be usefully used as a composition for prevention, improvement or treatment.

Description

A composition for skin whitening comprising extract of hempseed meal as an effective component {Composition for skin whitening comprising extract of hempseed meal as effective component}

The present invention relates to a composition for skin whitening containing hemp seed meal extract as an active ingredient.

Melanocytes in the basal layer of the epidermis produce melanin in response to various irritating factors in the skin, and when this melanin reaches the stratum corneum and causes hyperpigmentation, the skin appears dark. Factors involved in melanin synthesis include follicular hormone, progesterone, pigment cell-stimulating hormone, ultraviolet rays, stress, and heredity.

Skin whitening refers to the process of quickly discharging unnecessary melanin pigment and restoring the original transparency of the person's skin. Substances registered as whitening ingredients with the Food and Drug Administration include mulberry extract, arbutin, ethyl ascorbyl ether, oil-soluble licorice extract, ascorbyl glucoside, niacinamide, alpha-bisabolol, and ascorbyl tetraisopalmitate. Whitening cosmetics are made into lotions, liquids, creams, mask packs, etc.

Mulberry extract, arbutin, alpha-bisabolol, and oil-soluble licorice extract inhibit the activation of the tyrosinase enzyme involved in melanin synthesis, and ascorbyl glucoside, ethyl ascorbyl ether, and ascorbyl tetraisopalmitate inhibit the tyrosinase enzyme. It inhibits the oxidation of stimulated tyrosine, and niacinamide inhibits the transition of already produced melanin from melanocytes to keratinocytes, preventing the final step of melanin entering actual skin cells.

A representative substance used for medical purposes other than cosmetics is hydroquinone, which is prescribed as a medicine and is mainly used as a skin ointment. In Korea, to purchase an ointment containing more than 4% of this substance, you must have a doctor's prescription, and 2% ointment can be purchased at a pharmacy without a prescription. Unlike whitening cosmetics, hydroquinone ointment used for medical purposes directly destroys skin cells containing melanin and helps new skin cells grow.

However, the above substances have the problem of narrow product application scope, such as the effect of inhibiting tyrosinase activity only at relatively high concentrations or the effect does not last long due to low stability, and hydroquinone has skin irritation and stability issues. Its use in cosmetics is limited.

Meanwhile, hemp seed meal is a processing by-product left after extracting oil from hempseed, and is also called defatted hempseed. Hemp seeds are the seeds of hemp, an annual herb from the hemp family. Compared to cannabis obtained from the leaves and flowers of hemp, the content of tetrahydrocannabinol (THC), an anesthetic ingredient, is lower at less than 2%. In oriental medicine, it is called ma-in (麻仁) or maja-in (麻子仁) and is prescribed as a medicine with the peel removed. The oil contained in hemp seeds is an unsaturated fatty acid, contains a large amount of high-quality protein, helps prevent cardiovascular diseases such as arteriosclerosis, and is rich in fiber, which is good for digestion and effective in preventing constipation. As interest in hemp seeds has increased, research has been conducted using the by-products remaining after extracting the fat content from hemp seeds. These defatted hemp seeds contain a lot of phenolic acid, lignans, and flavonoids. It has been reported that it has been done.

Meanwhile, Korean Patent Publication No. 2013-0113581 discloses 'Composition for preventing and treating arteriosclerosis containing hemp seed extract', and Korean Patent No. 1997166 discloses 'Anti-acne and acne scarring containing hemp seed extract'. A composition for improving wrinkles and elasticity, improving skin regeneration, and suppressing sebum' is disclosed, but there is no description of the 'composition for skin whitening containing hemp seed meal extract as an active ingredient' of the present invention.

The present invention was developed in response to the above-mentioned needs. The present invention provides a composition for skin whitening containing hemp seed meal extract as an active ingredient, and the active ingredient has tyrosinase inhibitory activity and inhibition of melanin synthesis in melanoma cells. By confirming that it is active, the present invention was completed.

In order to solve the above problems, the present invention provides a cosmetic composition for skin whitening containing hemp seed meal extract as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving melanin hyperpigmentation disease containing hemp seed meal extract as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease containing hemp seed meal extract as an active ingredient.

The present invention relates to a composition for skin whitening containing hemp seed meal extract as an active ingredient. The active ingredient has excellent tyrosinase inhibitory activity and melanin synthesis inhibitory activity, and is therefore effective in treating skin whitening composition and melanin hyperpigmentation disease. It can be usefully used as a preventive or therapeutic composition.

Figure 1 shows the results of confirming cytotoxicity in melanoma cells (B16F10) according to treatment with hemp seed meal extract. CON is the control group with no treatment.
Figure 2 is a result showing the amount of melanin synthesis in melanoma cells (B16F10) according to treatment with hemp seed meal extract. CON is the normal group without any treatment, arbutin is the positive control group, and α-MSH is a melanin synthesis inducer. Different letters a to f in the figure mean that there is a significant difference from each other, p<0.05.
Figure 3 shows the results showing tyrosinase activity in melanoma cells (B16F10) according to treatment with hemp seed meal extract. CON is a normal group without any treatment, arbutin is a positive control group, and α-MSH is a tyrosinase activity inducer. Different letters a to f in the figure mean that there is a significant difference from each other, p<0.05.
Figure 4 shows the results showing the level of MITF (microphthalmia-associated transcription factor) gene expression in melanoma cells (B16F10) according to treatment with hemp seed meal extract. CON is the normal group without any treatment, arbutin is the positive control group, and α-MSH is a melanin synthesis inducer. Different letters a to f in the figure mean that there is a significant difference from each other, p<0.05.

In order to achieve the object of the present invention, the present invention provides a cosmetic composition for skin whitening containing hemp seed meal extract as an active ingredient.

The solvent for the hemp seed meal extract may be water, a lower alcohol of C ₁ to C ₄ , or a mixture thereof, and is preferably extracted using ethanol as a solvent, but is not limited thereto.

The hemp seed meal is a by-product remaining after extracting oil from hemp seeds.

In one embodiment of the present invention, the hemp seed meal extract has the effect of inhibiting the activity of tyrosinase or inhibiting melanin synthesis.

In the cosmetic composition according to one embodiment of the present invention, the cosmetic composition for skin whitening is cream, softening lotion, nourishing lotion, pack, essence, hair tonic, shampoo, rinse, hair conditioner, hair treatment, gel, skin lotion. , skin softener, skin toner, astringent, milk lotion, moisture lotion, nutritional lotion, massage cream, nutritional cream, moisture cream, hand cream, foundation, nutritional essence, sunscreen, soap, cleansing foam, cleansing lotion, cleansing cream, body. It may have any one formulation selected from the group consisting of lotion and body cleanser, but is not limited thereto. A cosmetic composition composed of each of these formulations may contain various bases and additives necessary and appropriate for the formulation of the formulation, and the types and amounts of these components can be easily selected by a person skilled in the art.

When the formulation of the cosmetic composition of the present invention is a paste, cream, or gel, animal fiber, plant fiber, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide are used as carrier ingredients. etc. can be used.

When the formulation of the cosmetic composition of the present invention is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder can be used as the carrier ingredient. In particular, when the cosmetic composition is a spray, chlorofluorohydride may be used as a carrier ingredient. It may contain propellants such as carbon, propane-butane or dimethyl ether.

When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene. These include fatty acid esters of glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan.

When the formulation of the cosmetic composition of the present invention is a suspension, the carrier component includes water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing agent, the carrier ingredients include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, acethionate, imidazolinium derivative, methyl taurate, and sarcosinate. , fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester can be used.

The cosmetic composition of the present invention may further contain excipients including fluorescent substances, fungicides, hydrotropes-inducing substances, moisturizers, fragrances, fragrance carriers, proteins, solubilizers, sugar derivatives, sunscreens, vitamins, plant extracts, etc. .

In addition, the present invention provides a health functional food composition for preventing or improving melanin hyperpigmentation disease containing hemp seed meal extract as an active ingredient.

The health functional food composition of the present invention has the advantage of having more excellent effects when consumed in the form of inner beauty food. The inner beauty is a food called 'edible cosmetics or beauty food'. It refers to foods that change the skin constitution to a healthy one by absorbing various ingredients that are good for the skin into the body. Just like choosing cosmetics that suit your skin type, it is important to check your skin condition and health. Considering your lifestyle, you can choose and consume inner beauty foods that suit each individual. When cosmetics containing the above-described cosmetic composition are mixed with inner beauty food containing the compound of the present invention, the skin whitening effect is significantly increased compared to using only cosmetics, making it more effective for melanin hyperpigmentation disease.

The health functional food composition of the present invention may be in a formulation selected from powder, granule, pill, tablet, capsule, candy, syrup, and beverage, but is not limited thereto.

When using the health functional food composition of the present invention as a food additive, the health functional food composition may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The mixed amount of active ingredients can be appropriately used depending on the purpose of use (prevention or improvement). Generally, when manufacturing a food or beverage, the health functional food composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw materials. However, in the case of long-term intake for health purposes, the amount may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

There are no particular restrictions on the types of health functional foods. Examples of foods to which the health functional food composition can be added include meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, and tea. There are drinks, alcoholic beverages, and vitamin complexes, and it includes all health foods in the conventional sense.

Additionally, the health functional food composition of the present invention can be manufactured into food, especially functional food. The functional food of the present invention includes ingredients commonly added during food production, and includes, for example, proteins, carbohydrates, fats, nutrients and seasonings. For example, when manufacturing a drink, natural carbohydrates or flavoring agents may be included as additional ingredients in addition to the active ingredient. The natural carbohydrates include monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, etc.), oligosaccharides, polysaccharides (e.g., dextrins, cyclodextrins, etc.), or sugar alcohols (e.g., For example, xylitol, sorbitol, erythritol, etc.) is preferable. The flavoring agent may be a natural flavoring agent (e.g., thaumatin, stevia extract, etc.) or a synthetic flavoring agent (e.g., saccharin, aspartame, etc.).

In addition to the above health functional food composition, various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid. It may further contain carbonating agents used in beverages. The ratio of the ingredients added is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional product composition of the present invention.

In addition, the present invention provides a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease containing hemp seed meal extract as an active ingredient.

The hyperpigmentation of melanin means that a specific area of the skin or hands or toenails becomes black or darker than other areas due to an excessive increase in melanin. The above melanin hyperpigmentation diseases include freckles, senile spots, liver spots, freckles, brown or black spots, solar pigment spots, cyanic melasma, hyperpigmentation after drug use, gravidic chloasma, or scratches and burns. This includes, but is not limited to, hyperpigmentation after inflammation due to wounds or dermatitis.

The pharmaceutical composition of the present invention may further include appropriate carriers, excipients, or diluents commonly used in the preparation of pharmaceutical compositions. The pharmaceutical dosage form of the composition according to the present invention can be used alone or in combination with other pharmaceutically active compounds, as well as in appropriate combinations.

The pharmaceutical composition according to the present invention can be formulated and used in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and injections according to conventional methods. . Carriers, excipients, and diluents that may be included in the pharmaceutical composition containing the hemp seed meal extract include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, Various compounds or mixtures including calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. I can hear it. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include the hemp seed meal extract with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, and gelatin. It is prepared by mixing etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, syrups, etc. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, wethepsol, macrogol, Tween 61, cacao, laurin, glycerogelatin, etc. can be used.

The preferred dosage of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. You can.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered topically on the skin, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

Hereinafter, the present invention will be explained in more detail by examples. These examples are only for illustrating the present invention in more detail, and it is obvious to those skilled in the art that the scope of the present invention is not limited thereto.

Preparation Example 1. Preparation of hemp seed meal extract

Hemp seeds were purchased and used from Awesome Tea Co., Ltd. Add 100 ml of hexane to 10 g of hemp seeds, homogenize at 10,000 rpm for 10 minutes, extract by stirring at room temperature for 3 hours at 180 rpm, and then centrifuge at 12,000 rpm for 10 minutes to obtain supernatant (oil component). has been removed. Afterwards, the remaining residue was dried at 30°C for 24 hours, and a total of 4.7 g of hemp seed meal was recovered.

47 ml of 70% (v/v) ethanol was added to 4.7 g of the hemp seed meal, extracted by stirring at room temperature at 180 rpm for 3 hours, and then centrifuged at 12,000 rpm for 10 minutes, and the obtained supernatant was filtered through a 0.45 ㎛ syringe filter. Hemp seed meal extract was prepared by filtration.

The hemp seed meal extract was placed in an aluminum dish, dried at 60°C for 3 hours, 85°C for 30 minutes, and 90°C for 30 minutes, and then weighed. Afterwards, the extraction yield (%) was calculated by substituting the formula below.

Extraction yield (%)={(weight after drying)/(weight of powder used before extraction)}×100

As a result, it was confirmed that the extraction yield of the hemp seed meal extract was 8.6%.

Example 1. Measurement of cytotoxicity

Mouse-derived melanoma cells (B16F10) were distributed at ^0.5 The seed meal extract was treated and cultured for 24 hours. Afterwards, 5 mg/ml of MTT (3-(4,5-dimethylthiazole-2-yl)-2,5-biphenyl tetrazolium bromide) reagent was added to each well, and after 3 hours of incubation, the supernatant was removed and 100 ㎕ of DMSO was added. (dimethyl sulfoxide) was added to dissolve the formazan crystals, and the absorbance was measured at 570 nm using a microplate reader. For cytotoxicity, the relative cell survival rate of the hemp seed meal extract treated group was calculated by taking the survival rate of the untreated group as 100%.

As a result, it was confirmed that 50㎍/㎖, 100㎍/㎖ and 200㎍/㎖ hemp seed meal extract did not show cytotoxicity in melanoma cells (Figure 1).

Example 2. Measurement of melanin synthesis inhibition ability

Mouse-derived melanoma cells (B16F10) were distributed in a 12-well plate at ^0.5 was derived. At this time, 100 μg/ml of arbutin or 50 μg/ml, 100 μg/ml, and 200 μg/ml of hemp seed meal extract were simultaneously treated and cultured for 48 hours. Afterwards, the medium was removed, washed twice with PBS (phosphatate buffer saline), and lysis buffer (0.1M sodium phosphate buffer, 1% triton The cells were lysed by leaving it for a while. Afterwards, 200 ㎕ of a 1N NaOH solution containing 10% (v/v) DMSO (dimethyl sulfoxide) was added to the pellet obtained by collecting the dissolved cells and centrifuging them, and reacted at 80°C for 1 hour, followed by 405 Absorbance was measured at nm. The amount of melanin synthesis was expressed as a percentage (%) compared to the α-MSH treatment group alone.

As a result, it was confirmed that the hemp seed meal extract reduced the amount of melanin synthesis increased by α-MSH in a concentration-dependent manner (Figure 2).

Example 3. Measurement of tyrosinase activity inhibition ability

Mouse-derived melanoma cells (B16F10) were dispensed in a 12-well plate at ^0.5 The enzyme activity was induced. At this time, 100 μg/ml of arbutin or 50 μg/ml, 100 μg/ml, and 200 μg/ml of hemp seed meal extract were simultaneously treated and cultured for 48 hours. Afterwards, the medium was removed, washed twice with PBS (phosphatate buffer saline), and lysis buffer (0.1M sodium phosphate buffer, 1% triton The cells were lysed by leaving it for a while. Afterwards, the lysed cells were collected and centrifuged to obtain a supernatant. Mix 60㎕ of the supernatant with 140㎕ of substrate solution containing 10mM L-3,4-dihydroxyphenylalanine (L-DOPA) dissolved in 1㎖ of 0.1M sodium phosphate buffer (pH 6.8). After reacting at 37°C for 1 hour, absorbance was measured at 490 nm.

As a result, it was confirmed that the hemp seed meal extract reduced the activity of tyrosinase increased by α-MSH in a concentration-dependent manner (Figure 3).

Example 4. MITF gene expression level analysis

The mRNA expression level of MITF (microphthalmia-associated transcription factor), a transcription factor for the TRP1 (tyrosinase related protein 1) protein involved in tyrosinase and melanin synthesis, was analyzed.

Mouse-derived melanoma cells (B16F10) were distributed in a 6-well plate at ^0.5 The enzyme activity was induced. At this time, 100 μg/ml of arbutin or 25 μg/ml, 50 μg/ml, and 100 μg/ml of hemp seed meal extract were simultaneously treated and cultured for 48 hours. Afterwards, centrifugation was performed to remove the supernatant, and the obtained cell pellet was treated with TRIzol reagent to extract and quantify mRNA. cDNA was synthesized using a cDNA synthesis kit, and PCR was performed using primers as shown in Table 1 below. did.

Primer sequences for PCR analysis gene primer sequence sequence number MITF F:AGGCGTATTTTTTCCCCACAG One R:TAGCTCCTTAATGCGGTCGT 2

As a result, it was confirmed that the hemp seed meal extract reduced the expression of the MITF gene increased by α-MSH in a concentration-dependent manner (Figure 4).

<110> NIKKYUHBIO andong national university industry-Academic cooperation Foundation <120> Composition for skin whitening comprising extract of hempseed meal as effective component <130> PN20448 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 agcgtgtatt ttccccacag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tagctcctta atgcggtcgt 20

Claims (7)

(1) homogenizing hemp seeds by adding hexane and extracting them by stirring at room temperature;
(2) recovering the hemp seed meal by centrifuging the extract to remove the oil component of the supernatant and drying it; and
(3) adding ethanol to the hemp seed meal, extracting it by stirring at room temperature, and filtering the supernatant obtained by centrifugation to recover the hemp seed meal extract; A cosmetic composition for skin whitening containing. delete delete The cosmetic composition for skin whitening according to claim 1, wherein the hemp seed meal extract inhibits the activity of tyrosinase or inhibits melanin synthesis. (1) homogenizing hemp seeds by adding hexane and extracting them by stirring at room temperature;
(2) recovering the hemp seed meal by centrifuging the extract to remove the oil component of the supernatant and drying it; and
(3) adding ethanol to the hemp seed meal, extracting it by stirring at room temperature, and filtering the supernatant obtained by centrifugation to recover the hemp seed meal extract; A health functional food composition for preventing or improving melanin hyperpigmentation disease. (1) homogenizing hemp seeds by adding hexane and extracting them by stirring at room temperature;
(2) recovering the hemp seed meal by centrifuging the extract to remove the oil component of the supernatant and drying it; and
(3) adding ethanol to the hemp seed meal, extracting it by stirring at room temperature, and filtering the supernatant obtained by centrifugation to recover the hemp seed meal extract; A pharmaceutical composition for preventing or treating melanin hyperpigmentation disease containing. The method of claim 6, wherein the melanin hyperpigmentation disease includes freckles, senile spots, liver spots, melasma, brown or dark spots, solar pigment spots, cyanic melasma, hyperpigmentation after drug use, and pregnancy brown spots. A pharmaceutical composition for the prevention or treatment of melanin hyperpigmentation disease, characterized in that it is post-inflammatory hyperpigmentation due to chloasma) or wounds or dermatitis.