JP2022111768A - External and internal agents for skin - Google Patents

Abstract

To provide external and internal agents for skin that have high safety and stability and show great effects of promoting collagen production, inhibiting MMP, promoting hyaluronic acid production, promoting cell proliferation, and antioxidation.SOLUTION: The present invention relates to: a collagen production promoter containing extract from Alisma orientale; an MMP inhibitor, a hyaluronic acid production promoter, a cell proliferation promoter, and an antioxidant, containing extract from Alisma orientale; and a food composition for preventing/improving various diseases caused by an increase of MMP, containing extract from Alisma orientale.SELECTED DRAWING: None

Description

TECHNICAL FIELD The present invention relates to collagen production promoters, MMP inhibitors, hyaluronic acid production promoters, cell growth promoters, antioxidants or food compositions.

Skin is exposed to various physical and chemical stresses such as ultraviolet rays, dryness, cold, heat, and drugs on a daily basis. As a result, functional deterioration of the skin is caused, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles, and are wrinkles that are temporarily caused by a decrease in the water content in the stratum corneum due to dryness of the skin. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in sunlight and aging. Mechanisms for its formation include a decrease in the ability to synthesize collagen in dermal fibroblasts due to ultraviolet light and aging, and an increase in matrix metalloproteinase (MMP) to promote the degradation of collagen.

Epidermal wrinkles caused by dryness and dermal wrinkles differ in histological morphology, onset mechanisms, and treatment methods. Dermal wrinkles caused by UV rays and aging can be improved by using cosmetics with moisturizing effects. is difficult.

So far, for the purpose of improving dermal wrinkles caused by ultraviolet rays, a skin wrinkle formation preventive/improving agent containing hydrolyzed almonds as an active ingredient (Patent Document 1), extracts of mulberry, tenki and marigold has been reported as an active ingredient for improving wrinkles caused by ultraviolet irradiation (Patent Document 2).

Fibroblasts and collagen are present in the dermis, and type I collagen accounts for 80% of the total. Besides type I collagen, the existence of type III, V, XII and XIV collagens is known. One of the causes of wrinkles and sagging is a decrease in type I collagen. Therefore, promoting the production of type I collagen is effective in preventing and improving wrinkles and sagging.

Collagen is also a major structural protein, accounting for approximately one-third of mammalian tissues, and an essential component of many matrix tissues such as cartilage, bone, tendon and skin. Collagen molecules, which are stable in normal tissues, are denatured into single-stranded gelatin when cleaved at one site by collagenase (MMP-1) belonging to MMP, and then decomposed by various other proteases. Become. As a result, the structural integrity of the matrix tissue is lost.

Gelatinase (MMP-2) belonging to MMP is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and is a structural protein that forms a special component of elastic tissues such as collagen, gelatin, and elastin (arteries, tendons, skin, etc.). ) and other substrates. Therefore, a substance having an inhibitory activity against gelatinase is expected to have an effect of suppressing angiogenesis in cancer tissue and metastasis of cancer, and is considered useful for the prevention and treatment of cancer diseases. Furthermore, inhibition of MMPs is useful not only for cancer diseases, but also for the prevention, treatment and improvement of various diseases such as ulceration, rheumatoid arthritis, osteoporosis and periodontitis caused by MMP enhancement.

As materials having collagenase inhibitory activity, for example, a cacao husk extract (Patent Document 3), which is a cocoa bean skin, a Rosaceae extract (Patent Document 4), lactoferrin (Patent Document 5), and the like have been proposed. Under the circumstances of increasing interest in skin aging and oral hygiene, it is desired to find a highly safe material with no side effects and excellent collagenase activity inhibitory action.

In addition, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue and maintain skin firmness. It is believed that this connective tissue loses its contractile force and further loses its elasticity, resulting in wrinkles and sagging of the skin.

In particular, hyaluronic acid is known as a high-molecular-weight polysaccharide that is widely distributed in connective tissue, exhibits a gel-like form in the dermis, and maintains skin elasticity. Therefore, it is believed that alteration or reduction of hyaluronic acid is important in skin aging. In addition, since hyaluronic acid is a polymer, there is a problem that cosmetics containing hyaluronic acid are not easily absorbed even when directly applied to the skin. Therefore, an external preparation for skin that can promote the cells' own production of collagen and hyaluronic acid by activating fibroblasts has been sought (Patent Document 6).

Moreover, hyaluronic acid is also present in joints, and is known to function to soften the impact of joint loads and to smooth joint movements. The concentration of hyaluronic acid in normal human joint fluid is about 2.3 mg/mL, but in the case of rheumatoid arthritis, the concentration of hyaluronic acid in synovial fluid decreases to about 1.2 mg/mL, and at the same time the viscosity of synovial fluid increases. significantly reduced (Non-Patent Document 1). It is also known that pyogenic arthritis, gouty arthritis, and the like cause a decrease in hyaluronic acid content, as in the case of rheumatoid arthritis (Non-Patent Document 2). In the above diseases, increasing the amount of hyaluronic acid in synovial fluid is considered to improve lubricating function, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that joint injection of sodium hyaluronate to rheumatoid arthritis patients improves the above symptoms (Non-Patent Document 3). However, treatment of the above diseases is long-term. Therefore, external skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters are desired for easy prevention and treatment in daily life.

Floaters are a condition in which faint shadows that look like lint or mosquitoes appear in the field of vision, and are caused by opacities in the vitreous that fill the inside of the eye and cast shadows on the retina. Floaters can be roughly divided into two types: physiological floaters that develop due to aging, ultraviolet rays, active oxygen, etc., and diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. There is pathological floaters presenting as one symptom. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, which is a major component of the vitreous, and turbidity in the vitreous due to the accompanying degradation of collagen fibers. Vitrectomy and laser therapy are available as treatment methods, but these procedures are not often performed in Japan due to safety concerns, and treatment overseas requires a large amount of money. . Therefore, in order to prevent and improve physiological floaters, foods and pharmaceuticals containing hyaluronic acid production promoters that can be used on a daily basis are desired.

In general, with aging, the ability of epidermal cells to proliferate and divide decreases, and the epidermal layer itself becomes thinner (Non-Patent Document 4). Biological factors such as epidermal growth factor (EGF/epidermal growth factor) and female hormones (estrogen) act on epidermal cell proliferation in the skin, but their secretion decreases with aging. Such deterioration in epidermal cell metabolic function due to aging delays the turnover rate of the skin and causes rough skin and aging of the skin. In addition, the retention of corneocytes that peel off from the surface of the stratum corneum hinders the smooth excretion of melanin in the epidermis, causing pigmentation and dullness of the skin. Furthermore, it is also known that wound healing of the epidermis is delayed. In order to prevent or improve the progression of these phenomena, many attempts have been made to search for components that promote the proliferation of epidermal cells and to propose topical skin preparations.

In addition, the skin is located in the outermost layer of the living body, is an organ that is likely to generate active oxygen under the influence of ultraviolet rays, etc., and is constantly exposed to oxygen stress. On the other hand, active oxygen scavenging enzymes are present in skin cells, and protect skin cells from injury by active oxygen unless the amount of active oxygen exceeding its capacity is generated. However, it is known that the activity of active oxygen scavenging enzymes in skin cells decreases with age. is thought to proceed. In addition, when organs other than the skin are exposed to active oxygen that exceeds their ability to scavenge active oxygen, it is thought that functional deterioration occurs and aging occurs, and various lifestyle-related diseases such as cancer and myocardial infarction develop. Therefore, active oxygen scavenging agents and antioxidants have been studied for the purpose of protecting against damage caused by active oxygen, and active oxygen scavenging enzymes such as SOD and catalase, and active oxygen scavenging agents and antioxidants such as SOD-like active substances are included. Foods, cosmetics, quasi-drugs, pharmaceuticals, etc. that have been developed have been developed (Patent Documents 7 and 8).

Alisma orientale (scientific name: Alisma orientale) is a perennial herb belonging to the genus Alisma orientale, in the family Alisma orientales, in the order Alisma. It is used in herbal medicine with the effect of So far, extracts of sagemodaka have the effect of treating contact dermatitis due to type IV allergy (Patent Document 9), suppress the production of interleukin 4 (Patent Document 10), and suppress the production of TNF-α. In addition to anti-inflammatory effects such as suppressing (Patent Document 11) and suppressing the production of prostaglandin E2 ₍ Patent Document 12), it is known to have a ceramide production promoting effect (Patent Document 13). . However, it has not been known that the extract of Pseudomonas spp. has collagen production promoting action, MMP inhibitory action, hyaluronic acid production promoting action, cell proliferation promoting action and antioxidant action.

Japanese Patent Application Laid-Open No. 2000-119125 Japanese Patent Application Laid-Open No. 2006-199611 JP-A-3-44331 JP-A-2003-137801 JP-A-5-186368 JP 2007-1924 A JP-A-9-118630 JP-A-9-208484 JP-A-9-2961 JP-A-10-45613 JP 2015-218145 A JP 2012-144464 A JP 2010-70499 A

"Arthritis Rheumatism", vol. 10, pp 357, 1967 "Combination Composition", Kanehara Shuppan, Item 481, 1984 "Inflammation", Japanese Inflammation Society, Vol. 11, Item 16, 1991 Varani J et al. , J Invest Dermatol, Vol. 3, pp 57-60, 1998

A material that is safe and excellent in stability and has excellent collagen production-promoting action, MMP-inhibiting action, hyaluronic acid production-promoting action, cell growth-promoting action and antioxidant action has been desired, but a material that is still sufficiently satisfactory has been provided. The current situation is that they are not.

Under these circumstances, the present inventors have made intensive studies, and found that the extract of sagemodaka has excellent collagen production-promoting action, MMP inhibitory action, hyaluronic acid production-promoting action, cell proliferation-promoting action and antioxidant action, and is stable. It was also found to be superior in terms of sex. Furthermore, the external preparation or internal preparation containing the extract is safe and stable, and has excellent collagen production promoting action, MMP inhibitory action, hyaluronic acid production promoting action, cell growth promoting action and antioxidant action, The inventors have found that it can be used as a multifunctional beauty/health material and medicine, and have completed the present invention.

That is, the present invention includes the following inventions.
(1) A collagen production promoting agent characterized by containing an extract of sagemodaka.
(2) An MMP inhibitor characterized by containing an extract of Pseudomodaka.
(3) A hyaluronic acid production promoter characterized by containing an extract of sagemodaka.
(4) A cell growth promoting agent characterized by containing an extract of Pseudomodaka.
(5) An antioxidant characterized by containing an extract of Sageomodaka.
(6) A food composition for preventing and ameliorating various diseases caused by MMP enhancement, characterized by containing an extract of Sageomodaka.

According to the present invention, a collagen production promoter, an MMP inhibitor, a hyaluronic acid production promoter, a cell proliferation promoter, and an antioxidant containing an extract of Pleurotus as an active ingredient are provided. In addition, since the extract of sagemodaka is a natural edible plant, it has no side effects and is highly safe. Therefore, external preparations or internal preparations containing the extract of Pseudomodaka can be used with confidence.

Takusha used in the present invention (scientific name: Alisma orientale, Japanese name: Sajimendaka, herbal medicine name: Takusha) is a perennial plant belonging to the genus Takusha, belonging to the genus Takusha, belonging to the genus Takusha, mainly in northern Japan, East Asia, Central Asia, etc. Although it inhabits, the place of production is not particularly limited. In the present invention, the extract of Pseudomodaka refers to a part of the plant body such as its rhizome (tuber), flower, fruit, seed, leaf, stem, etc., or the whole plant body, or an extract of a mixture thereof, but the present invention The part used as the raw material for extraction in is preferably the rhizome used as a crude drug (Rhizome). For extraction, the plant body may be used as it is, or may be subjected to treatments such as drying, pulverization, and shredding.

The extraction method is not particularly limited, but it can be carried out by stirring or column extraction using water, hot water, or a mixed solvent of water and an organic solvent. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, , glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used singly or in combination of two or more. A particularly preferred extraction solvent includes water or a water-ethanol mixed polar solvent. The amount of the solvent to be used is not particularly limited, for example, it may be 10 times or more, preferably 20 times or more, relative to the rhizome (dry weight) of the rhizome, but when concentrating or isolating after extraction is preferably 100 times or less for convenience of operation. Also, the extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, and the like.

The above extract may be used as an extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization by activated carbon, etc., within the range where the effect of the present invention is exhibited. , deodorization, ethanol precipitation, or the like may be performed before use. Furthermore, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

In the present invention, the above extract may be used as it is, and within the range that does not impair the effect of the extract, oils and fats, waxes, and carbonized oils that are ingredients used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , chelating agents, excipients, film-forming agents, sweeteners, acidulants and the like.

The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods. , bath agents, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids , emulsions, suppositories, injection solutions and the like.

For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight in terms of solid matter. Furthermore, 0.01 to 5% by weight is most preferred. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to recognize the enhancement of the effect and it is uneconomical.

In the case of internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Furthermore, 20 mg to 2 g is most preferred.

Next, in order to explain the present invention in detail, production examples, experimental examples and formulation examples of the extract used in the present invention will be given as examples, but the present invention is not limited to these. % shown in Production Examples means % by weight, and parts of content shown in Formulation Examples means parts by weight.

Example of production of extract of sagemodaka An extract of sagemodaka was prepared as follows. In Production Examples 1 to 4, rhizomes of sagemodaka were used as the extraction material.

(Manufacturing Example 1) Preparation of Hot Water Extract of Pseudomorpha spp. 200 mL of water was added to 10 g of the dried product of Pseudomodaca spp. and extracted at 95 to 100°C for 2 hours. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 2.0 g of a hot water extract of sagemodaka.

(Manufacturing Example 2) Preparation of 50% Ethanol Extract of Rhododendron spp. 10 g of the dried material of Rhododendron purpurea was immersed in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days for extraction. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 1.5 g of a 50% ethanol extract of sagemodaka.

(Production Example 3) Preparation of Ethanol Extract of Rhododendron spp. 10 g of dried material of Rhododendron purpurea was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.5 g of an ethanol extract of Sagiomodaka.

(Production Example 4) Preparation of 1,3-Butylene Glycol Extract of Rhododendron dilatatum 10 g of dried Rhododendron dilatatum was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The resulting extract was filtered to obtain 195 g of a 1,3-butylene glycol extract of sagemodaka.

(Prescription example 1) Lotion Prescription Content (parts)
1. Hot water extract of sagemodaka (manufacturing example 1) 2.0
2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance Appropriate amount 11. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, mixed and filtered to obtain a product.

(Comparative Formulation Example 1) Conventional Lotion In Formulation Example 1, a conventional lotion was prepared by substituting purified water for the hot-water extract of Sagiomodaka.

(Prescription example 2) Cream Prescription Content (parts)
1. 50% ethanol extract of sagemodaka (manufacturing example 2) 1.0
2. Squalane 5.5
3. Olive oil 3.0
4. stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20 E.O.) 3.0
8. behenyl alcohol 1.5
9. Glyceryl monostearate 2.5
10. Perfume 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-butylene glycol 8.5
13. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 9 are dissolved by heating, mixed, and maintained at 70°C to form an oil phase. Ingredients 1 and 11 to 13 are heated, melted and mixed, and kept at 75°C to form an aqueous phase. Add the water phase to the oil phase to emulsify, cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain the product.

(Comparative Formulation Example 2) Conventional Cream In Formulation Example 2, a conventional cream was obtained by replacing the 50% ethanolic extract of Sagiomodaka with purified water.

(Prescription example 3) Milky lotion Prescription Content (parts)
1. Ethanol extract of Sagiomodaka (Production Example 3) 0.01
2. Squalane 5.0
3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glyceryl monostearate 2.0
7. Polyoxyethylene cetyl ether (20 E.O.) 3.0
8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Perfume 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 8 are dissolved by heating, mixed, and kept at 70°C to form an oil phase. Ingredients 10 to 13 are dissolved by heating, mixed, and kept at 75° C. to form an aqueous phase. The water phase is added to the oil phase to emulsify, and the mixture is cooled with stirring, added with component 9 at 45°C, and further cooled to 30°C to obtain a product.

(Prescription example 4) Gel Formulation Content (parts)
1. 1,3-butylene glycol extract of sagemodaka (manufacturing example 4) 1.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxy vinyl polymer 0.2
10. Potassium hydroxide 0.2
11. Adjust the total amount to 100 with purified water [Manufacturing method] Components 2 to 5 and components 1 and 6 to 11 are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 5) Pack Prescription Content (parts)
1. Hot water extract of sagemodaka (manufacturing example 1) 1.0
2. 1,3-butylene glycol extract of sagemodaka (manufacturing example 4) 5.0
3. Polyvinyl alcohol 12.0
4. Ethanol 5.0
5.1,3-butylene glycol 8.0
6. Methyl paraoxybenzoate 0.2
7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5
8. Citric acid 0.1
9. Sodium citrate 0.3
10. Fragrance Appropriate amount 11. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 11 are uniformly dissolved to obtain a product.

(Prescription example 6) Foundation Prescription Content (parts)
1. 50% ethanol extract of sagemodaka (manufacturing example 2) 1.0
2. stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0
4. Polyoxyethylene cetyl ether (20 E.O.) 2.0
5. Cetanol 1.0
6. Liquid Lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Carboxymethylcellulose sodium 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengara 1.0
17. Yellow iron oxide 2.0
18. Perfume Appropriate amount 19. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 8 are dissolved by heating and maintained at 80°C to form an oil phase. Ingredient 19 is sufficiently swelled with ingredient 9, then ingredients 1 and 10 to 13 are added and mixed uniformly. Ingredients 14 to 17 pulverized and mixed with a pulverizer are added to this, stirred with a homomixer and kept at 75° C. to form an aqueous phase. Add the water phase to the oil phase with stirring to emulsify. After cooling, add component 18 at 45°C and cool to 30°C with stirring to obtain the product.

(Prescription example 7) Bath agent Prescription Content (parts)
1. Ethanol extract of sagemodaka (manufacturing example 3) 1.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume Appropriate amount 5. [Manufacturing method] Components 1 to 5 are uniformly mixed to obtain a product.

(Prescription example 8) Ointment Prescription Content (parts)
1. Hot water extract of sagemodaka (manufacturing example 1) 5.0
2. 1,3-butylene glycol extract of sagemodaka (manufacturing example 4) 1.0
3. Polyoxyethylene cetyl ether (30 E.O.) 2.0
4. Glyceryl monostearate 10.0
5. Liquid paraffin 5.0
6. Cetanol 6.0
7. Methyl paraoxybenzoate 0.1
8. Propylene glycol 10.0
9. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 3 to 6 are dissolved by heating, mixed, and kept at 70°C to form an oil phase. Ingredients 1, 2 and 7 to 9 are dissolved by heating, mixed, and maintained at 75°C to form an aqueous phase. The water phase is added to the oil phase to emulsify, and the mixture is cooled to 30°C while stirring to obtain a product.

(Prescription example 9) Powder Formulation Content (parts)
1. Hot water extract of sagemodaka (manufacturing example 1) 1.0
2. Dry cornstarch 39.0
3. Microcrystalline cellulose 60.0
[Manufacturing method] Components 1 to 3 are mixed to form a powder.

(Prescription example 10) Tablet Prescription Content (parts)
1. Ethanol extract of sagemodaka (manufacturing example 3) 5.0
2. Dry cornstarch 25.0
3. Carboxymethylcellulose calcium 20.0
4. Microcrystalline cellulose 40.0
5. polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and tableted. One tablet is 0.52 g.

(Prescription example 11) Tablet prescription Content (parts)
1. Ethanol extract of Sagiomodaka (Production Example 3) 2.0
2. Dry cornstarch 49.8
3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Perfume 0.1
7. Purified water 0.1
[Manufacturing method] Components 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and compressed into tablets. 1 grain is 1.0 g.

(Prescription example 12) Beverage Prescription Content (parts)
1. Hot water extract of sagemodaka (manufacturing example 1) 0.05
2. Stevia 0.05
3. Malic acid 5.0
4. Perfume 0.1
5. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 3 are dissolved in a small amount of water. Ingredients 4 and 5 are then added and mixed.

Next, an experimental example will be given in order to describe the effects of the present invention in detail.

Experimental Example 1 Type I Collagen (COL1A1), MMP-1, MMP-2 and Hyaluronic Acid Synthase 2 (HAS2) Measurement of mRNA Expression Levels COL1A1, MMP-1, MMP-2 and HAS2 mRNA expression levels were measured. . 1×10 ⁵ human fibroblasts NB1RGB were seeded in a 60 mm dish and cultured in a DMEM culture medium containing 10% FBS under conditions of 37° C. and 5% CO ₂ . When the cells became confluent, each sample was cultured for 24 hours in DMEM(−) culture medium added to a final concentration of 1 or 10 μg/mL, and then total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The mRNA expression level was measured by real-time RT-PCR method based on the total RNA extracted from the cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Life Technologies) were used for the real-time RT-PCR method. That is, after reverse transcription of 500 ng of total RNA, PCR reaction (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the prescribed method, and the expression levels of COL1A1, MMP-1, MMP-2 and HAS2 mRNA were determined as a ratio to the expression level of β-actin mRNA as an internal standard. The COL1A1 expression rate was calculated as the ratio of the expression level of COL1A1 mRNA in the sample-added group to the expression level of COL1A1 mRNA in the control (no sample added) group. MMP-1 expression rate, MMP-2 expression rate and HAS2 expression rate were also calculated in the same manner. The primers used for measuring the expression level of each gene are as follows.

Primer set AGGACAAGAGGGCATGTCTGGTT for COL1A1 (SEQ ID NO: 1)
TTGCAGTGGGTAGGTGATGTTCTG (SEQ ID NO: 2)
Primer set GGGAGATCATCGGGACAACTC for MMP-1 (SEQ ID NO: 3)
TGAGCATCCCCTCCAATACC (SEQ ID NO: 4)
Primer set CCGTCGCCCATCATCAA for MMP-2 (SEQ ID NO: 5)
CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 6)
Primer set TGGATGACCTACGAAGCGATTA for HAS2 (SEQ ID NO: 7)
GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 8)
Primer set CACTCTTCCAGCCTTCCTTCC for β-Actin (SEQ ID NO: 9)
GTGTTGGGCGTACAGGTCTTTG (SEQ ID NO: 10)

The results of these experiments are shown in Tables 1-4. As a result, the extract of the present invention was found to have excellent COL1A1 expression promoting effect (collagen production promoting effect), MMP expression suppressing effect (MMP inhibitory effect) and HAS2 expression promoting effect (hyaluronic acid production promoting effect). rice field. In particular, the COL1A1 expression-promoting effect and MMP-1 inhibitory effect of the ethanol extract of Papillae chinensis (Production Example 3) were remarkably high.

Experimental Example 2 Cell Proliferation Promotion Test Human-derived keratinocytes were seeded in a DMEM culture medium containing 0.1% FBS at 1× ¹⁰ per well in a 96-well plate, and the final concentration of each sample was 0.1 or 1 μg/ After addition to make up to mL, culture was carried out for 4 days under conditions of 37° C. and 5% CO ₂ . Cell count was measured by staining method. That is, after the culture was completed, the culture medium was removed, and the cells were fixed using methanol. Subsequently, 0.1% methylene blue was added to stain the cells for 1 hour. After drying, 100 μL of 0.1 N HCl was added to each well and well stirred, and the absorbance at 650 nm was measured using a microplate reader. The cell growth rate was calculated as the ratio of the cell amount of the sample-added group to the cell amount of the control (no sample-added) group.

These experimental results are shown in Table 5. As a result, the extract of the present invention showed an excellent cell growth promoting effect. In particular, the cell proliferation-promoting effect of the hot-water extract (Production Example 1) of Pseudomonas spp. was remarkably high.

Experimental Example 3 Active Oxygen Scavenging Action The free radical scavenging and removing action was evaluated. As a model of free radicals, α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), which is a stable free radical, is used and reacted with a sample at a constant rate for a certain period of time to reduce the amount of radicals. was measured from the decrease in absorbance at 517 nm.

Measurement method of free radical scavenging and removing action Add 2 mL of ethanol and 1 mL of 0.5 mM DPPH ethanol solution to 2 mL of 1.0 M acetate buffer (pH 5.5) to which each sample was added so that the final concentration was 250 to 750 μg / mL. It was used as a reaction solution. In the case of an oil-soluble sample, the sample was added to 2 mL of ethanol to prepare a reaction solution. After that, reaction was carried out at 37° C. for 30 minutes, and absorbance (A) at 517 nm was measured using water as a control. Also, as a blank, purified water was used in place of the sample to measure the absorbance (B). The capture-removal rate of free radicals was calculated from the following formula.
Free radical capture and removal rate (%) = (1-A/B) x 100

From the test results for each sample, the concentration required for 50% free radical scavenging (hereinafter referred to as _IC50 ) was calculated. A lower _IC50 value corresponds to a more potent ROS scavenger. These test results are shown in Table 6. For some materials, increasing the concentration to solubility does not lead to an _IC50 calculation. The hot water extract (Production Example 1) and the 50% ethanol extract (Production Example 2) of the present invention have calculated IC ₅₀ and have stable and excellent free radical scavenging and removing action (antioxidant action). It was recognized that there was

Experimental Example 4 Use test Using the lotion of Formulation Example 1 and the conventional lotion of Comparative Formulation Example 1, a one-month use test was conducted on 5 people (26 to 66 years old) with wrinkles and sagging. . After use, the degree of wrinkles and sagging was determined by a questionnaire.

As a result, the lotion containing the extract of the present invention reduced wrinkles and sagging. During the test period, no skin trouble occurred, and there was no problem in terms of safety. Moreover, there was no problem with deterioration of prescription components.

From the above, the extract of the present invention has excellent collagen production-promoting action, MMP inhibitory action, hyaluronic acid production-promoting action, cell proliferation-promoting action and antioxidant action, and is also excellent in stability. . Therefore, the extract of the present invention can be used not only in the cosmetic field such as aging of the skin, but also in the medical field such as suppression of function deterioration due to aging, prevention and treatment of cancer, etc. And application to pharmaceuticals is expected.

Claims (6)

A collagen production promoter, characterized by containing an extract of Sageomodaka. An MMP inhibitor, characterized by containing an extract of sagemodaka. A hyaluronic acid production promoter, characterized by containing an extract of Sageomodaka. A cell growth promoting agent, characterized by containing an extract of Sageomodaka. 1. An antioxidant characterized by containing an extract of Sageomodaka. A food composition for the prevention and improvement of various diseases caused by MMP enhancement, characterized by containing an extract of Sageomodaka.