JP6595192B2 - A skin external preparation or an internal preparation containing an extract of fenugreek cultivated by irradiation with light having a specific wavelength range. - Google Patents

Description

  The present invention relates to a novel skin external preparation or internal preparation excellent in antioxidant effect, collagen production promoting effect, whitening effect, ceramide production promoting effect and the like.

  The skin is located in the outermost layer of the living body, is an organ in which active oxygen is easily generated due to the influence of ultraviolet rays and the like, and is constantly exposed to the oxygen stress. On the other hand, active oxygen scavenging enzymes exist in the skin cells, and protect the skin cells from injury of active oxygen unless active oxygen exceeding that capacity is generated. However, it is known that the activity of the active oxygen scavenging enzyme in skin cells decreases with age, and when the injury due to active oxygen surpasses its protective reaction, the skin is oxidized and the cell function deteriorates and ages. It is thought that it will do. Also, in organs other than the skin, when exposed to active oxygen exceeding the active oxygen scavenging ability, it is considered that functional deterioration occurs and aging occurs, and various lifestyle-related diseases such as cancer and myocardial infarction develop. Therefore, active oxygen scavengers and antioxidants have been studied for the purpose of protecting against active oxygen injury, and active oxygen scavengers such as SOD and catalase, and active oxygen scavengers and antioxidants such as SOD-like active substances are included. Foods, cosmetics, quasi-drugs and pharmaceuticals have been developed (see Patent Documents 1 and 2).

  Skin is exposed to various physical and chemical stresses such as ultraviolet rays, dryness, coldness, heat, and drugs every day. As a result, the skin function is lowered, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles and are temporary wrinkles caused by a decrease in the amount of water in the epidermal stratum corneum due to dry skin. As a method for improving fine lines, the use of cosmetics having a moisturizing effect is common. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in sunlight or aging. The formation mechanism includes a decrease in the ability to synthesize collagen in dermal fibroblasts due to ultraviolet light or aging.

  Histological morphology, onset mechanism, and treatment method differ between epidermal wrinkles and dermal wrinkles caused by dryness, and dermal wrinkles caused by ultraviolet rays and aging are improved by the use of cosmetics that have a moisturizing effect. Can not.

  So far, for the purpose of improving dermal wrinkles caused by ultraviolet rays, an extract of skin wrinkle formation preventing / improving agent containing hydrolyzed almond as an active ingredient (Patent Document 3) An agent for improving wrinkles caused by ultraviolet irradiation (Patent Document 4) containing as an active ingredient has been reported.

  The dermis contains fibroblasts and collagen, and type I collagen accounts for 80% of the total. In addition to type I collagen, the presence of type III, V, XII and XIV type collagen is known. One cause of wrinkles and sagging is a decrease in type I collagen. Therefore, it is considered that promoting the production of type I collagen is effective in preventing and improving wrinkles and sagging. The promotion of type I collagen production is also effective in improving wound healing of the skin.

  Fibroblasts also produce proteins such as collagen to form dermal connective tissue and keep the skin firm. It is believed that this connective tissue loses its contractile force and further loses its elasticity, resulting in skin wrinkles and sagging.

  In general, pigmentation of the skin seen in spots, buckwheat, sunburn, etc. is caused by melanocytes that are excessively produced in the skin due to hormonal abnormalities or stimulation of ultraviolet rays, which is deposited in the skin. It is believed that. As one method for preventing such pigmentation, a method for suppressing excessive production of melanin is known. Conventionally, ascorbic acid (vitamin C) or the like has been used for treatment of pigmentation in internal use or external use.

Ceramide is a kind of sphingolipid and is a general term for a group of compounds in which sphingosine and a fatty acid are amide-bonded. Ceramide is known to be present at a high concentration in the cell membrane. Ceramide is a component of keratin intercellular lipids, and is secreted extracellularly in the process of keratinization, and plays an important role in the skin barrier function and water retention ability. Furthermore, ceramide is known as a signal transducing substance to control cell proliferation, differentiation, apoptosis, and the like. From these facts, substances that promote ceramide production can be expected to suppress cell proliferation, induce differentiation and induce apoptosis, and can be expected to have therapeutic effects on diseases caused by these abnormalities.
Examples of skin diseases highly related to ceramide include squamous cell carcinoma, psoriasis, and atopic dermatitis. Therefore, it is possible to treat and prevent skin diseases such as squamous cell carcinoma, psoriasis and atopic dermatitis by promoting the production of ceramide in the skin.

  It has been confirmed that seven types of ceramide are present in human skin, and it is ideal that all kinds of ceramides are supplemented at a ratio of existing in the stratum corneum. Conventionally, ceramide has been blended into various skin external preparations as a cosmetic that is effective in preventing and improving rough skin and dry skin, but supplements all types of ceramide present in human skin at an appropriate ratio. That was technically difficult. Therefore, it is considered important to promote ceramide production in vivo. Patent Documents 5 and 6 have been reported as ceramide production promoters.

  Known literature on fenugreek has been known to have a moisturizing effect and an anti-inflammatory effect (Patent Document 7).

  On the other hand, as a method for enhancing the medicinal effect of plants by plant cultivation methods, methods for characteristically increasing functional substances such as vitamins, polyphenols and rutin in plants have already been reported in the patent literature. Patent Document 8 discloses a method for increasing the amount of vitamin A and vitamin E by irradiating soybean bean sprouts with light in the near-ultraviolet to blue region wavelength. A cultivation method for increasing α-tocopherol and vitamin C, which are functional substances, by performing artificial ultraviolet irradiation for 5 minutes a day is disclosed. Patent Document 10 discloses blue light, red light, and far-red light of artificial light sources. A method for increasing vitamin C and vitamin A in Japanese mustard spinach and lettuce by adjusting the strength of the rice is disclosed.

JP-A-9-118630 JP-A-9-208484 JP 2000-119125 A JP 2006-199611 A JP-A-8-217658 JP 2001-220345 A JP-A-8-301777 Japanese Patent Laid-Open No. 11-103680 JP 2004-305040 A JP-A-8-205777

  This invention makes it a subject to provide the novel skin external preparation or internal preparation excellent in the antioxidant effect, the collagen production promotion effect, the whitening effect, the ceramide production promotion effect, etc.

  As a result of intensive studies to solve this problem, the present inventors have obtained an antioxidant effect, collagen generation on an extract of fenugreek cultivated by simultaneously irradiating two kinds of light having a specific wavelength range. It was discovered that the promoting effect, whitening effect and ceramide production promoting effect were excellent, and the present invention was completed.

  That is, this invention consists of the following (1)-(7).

(1) Water, lower alcohols and liquid polyhydric alcohols of fenugreek cultivated by irradiating with light having a photosynthesis photon flux density (PPFD) ratio of 8: 1 to 1: 1 in the wavelength range of 570 to 730 nm and 400 to 515 nm An external preparation for skin containing an extract from one or more solvents selected from the group consisting of:
(2) The external preparation for skin according to claim 1, wherein the ratio of photosynthetic photon flux density (PPFD) between the wavelength range of 570 to 730 nm and 400 to 515 nm is 4: 1 to 2: 1.
(3) Fenugreek cultivated with fluorescent light or sunlight by irradiating with light having a photosynthesis photon flux density (PPFD) ratio of 8: 1 to 1: 1 in the wavelength range of 570 to 730 nm and 400 to 515 nm. Fenugreek characterized by enhancing one or more effects selected from an antioxidant effect, a collagen production promoting effect, a whitening effect, and a ceramide production promoting effect, as compared with the above.
(4) Fenugreek cultivated with fluorescent light or sunlight by irradiating with light having a photosynthesis photon flux density (PPFD) ratio of 8: 1 to 1: 1 in the wavelength range of 570 to 730 nm and 400 to 515 nm. Fenugreek or one kind selected from water, lower alcohols and liquid polyhydric alcohols, which is selected from the group consisting of antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect. Or the pharmaceutical containing the extract extracted by 2 or more types of solvent.
(5) Fenugreek cultivated with fluorescent light or sunlight by irradiating with light having a photosynthesis photon flux density (PPFD) ratio of 8: 1 to 1: 1 in the wavelength range of 570 to 730 nm and 400 to 515 nm. Fenugreek or one kind selected from water, lower alcohols and liquid polyhydric alcohols, which is selected from the group consisting of antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect. Or the foodstuff characterized by including the extract extracted with 2 or more types of solvent.
(6) An extract of fenugreek cultivated by irradiation with light in the wavelength range of 570 to 730 nm and / or 400 to 515 nm, extracted with one or more solvents selected from water, lower alcohols and liquid polyhydric alcohols. An external preparation for skin, comprising:
(7) Extracted with one or more solvents selected from fenugreek cultivated by irradiating light in the wavelength range of 570 to 730 nm and / or 400 to 515 nm, or water, lower alcohols and liquid polyhydric alcohols of the fenugreeks Extract.

  The fenugreek of the present invention or an extract thereof has excellent antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect, and can contribute to the fields of pharmaceuticals, quasi drugs, cosmetics and foods. It is.

  The present invention will be described in detail below.

  The extract of fenugreek used in the present invention is a part or whole plant of a plant body such as a flower, fruit, seed, stem, leaf, root, etc. It is extracted from. The extraction method is not particularly limited, and for example, it may be a heat extraction or a room temperature extraction. Moreover, in this invention, it can also be used with a plant body instead of an extract, can be used raw or dried, and can be used properly according to the objective. Furthermore, an extract and a plant can be used in combination.

  As a cultivation method, it can carry out by cultivation using soil or hydroponics. In the case of hydroponics, the seeds can be used for hydroponics in the rooted state after sowing. Cultivation is preferably carried out in a facility where the temperature, light, and carbon dioxide concentration are controlled. The cultivation temperature is 15 to 30 ° C, preferably 20 to 25 ° C. Although a cultivation period changes with conditions to irradiate, it can be harvested in about 10 to 30 days. It is possible to cultivate further.

  As the light source, a light source used in a plant cultivation facility can be used, and examples thereof include an optical semiconductor element such as a light emitting diode (LED) and a laser diode, but a light source capable of selectively irradiating a specific wavelength range. It is not limited to LEDs.

  In the cultivation of fenugreek, the wavelength to be irradiated is preferably blue light having a wavelength range of 400 to 515 nm and red light having a wavelength of 570 to 730 nm, and more preferably light having a wavelength range of 430 to 460 nm and 630 to 680 nm. Most preferably, these lights are irradiated simultaneously. The wavelength at this time refers to the maximum wavelength (peak wavelength) of the irradiation spectrum. If it is a light source which has such a wavelength peak, what was produced uniquely and a commercial thing can also be used. Further, an optical filter may be used so that the wavelength can be selectively irradiated. In addition to the above two ranges of light, a light source such as sunlight or a fluorescent lamp can also be used.

The amount of light to be irradiated is expressed as photosynthetic effective photon flux density (PPFD). In the case of irradiating a combination of two types of light emitters, it means the total amount of light. Its quantity of light after germination is preferably 10~300μmol ^{· m} -2 ^{s -1,} more preferably 50~200μmol ^{· m} -2 ^{s -1.} If the light intensity is out of this range, it may cause growth failure or growth failure. Irradiation is preferably performed from a position 10 to 50 cm above the fenugreek. Although irradiation time can be suitably changed according to the characteristic and purpose of a plant, 6 hours or more are preferable and 12 to 24 hours are more preferable.

  The light quantity ratio between red and blue means the ratio of each PPFD, and can be selected according to the purpose such as yield and effectiveness.

  Among them, in order to increase the yield of the plant body, the light quantity ratio of red and blue is preferably 1: 0 to 0: 1, more preferably 1: 0 to 2: 1, and 4: 1 to 2: 1. Most preferred.

  In the active oxygen scavenging action (free radical scavenging and removing action), the light quantity ratio of red to blue is preferably 1: 0 to 0: 1, more preferably 8: 1 to 0: 1. Among these, the light quantity ratio between red and blue is most preferably 8: 1 to 1: 1.

  In the type I collagen (COL1A) expression promoting action, the light quantity ratio of red to blue is preferably 1: 0 to 1: 1 in view of the effect. Among these, the light quantity ratio between red and blue is most preferably 8: 1 to 1: 1.

  In the melanin production inhibitory effect, the light quantity ratio between red and blue is preferably 1: 0 to 1: 1 in view of the effect. Among these, the light quantity ratio between red and blue is most preferably 8: 1 to 2: 1.

  In the ceramide production promoting action, the light quantity ratio of red to blue is preferably 4: 1 to 0: 1 in view of the effect. Among these, the light quantity ratio between red and blue is most preferably 2: 1.

  In general, the light quantity ratio between red and blue is preferably 8: 1 to 1: 1, and most preferably 4: 1 to 2: 1.

  As an extraction solvent, for example, water, lower alcohol (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol), liquid polyhydric alcohol (1,3-butylene glycol, propylene glycol, glycerin, etc.) ), Ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.) Can be mentioned. Preferred are polar solvents such as water, lower alcohols and liquid polyhydric alcohols, and particularly preferred are water, ethanol, 1,3-butylene glycol and propylene glycol. These solvents may be used alone or in combination of two or more.

  The extract may be used as it is, or may be used after concentration, dilution and filtration treatment, decolorization with activated carbon, deodorization treatment, or the like, if necessary. Further, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product. You can also eat raw salads.

  The external preparation or the internal preparation of the present invention includes foods, and the above-mentioned plant body and / or extract may be used as it is, and cosmetics, pharmaceuticals are used within the range not impairing these effects. Fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers that are components used in quasi-drugs, pharmaceuticals, foods, etc. Components such as agents, powders, ultraviolet absorbers, thickeners, dyes, antioxidants, whitening agents, chelating agents, excipients, film agents, sweeteners, and sour agents can also be blended.

  The present invention can be used for pharmaceuticals, quasi drugs, cosmetics, and foods. Examples of the dosage form include lotions, creams, massage creams, emulsions, gels, aerosols, packs, cleaning agents, and baths. Agent, foundation, powder, lipstick, ointment, cataplasm, paste, plaster, essence, powder, pill, tablet, injection, suppository, emulsion, capsule, granule, liquid (tinced, fluid extract) , Alcoholic beverages, suspensions, limonades, etc.), tablet confectionery, beverages, tea packs, spices, salads and other fresh foods.

  In the case of external use, the amount of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, in terms of solid matter, based on the total amount. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, a sufficient effect is hardly expected. When the blending amount exceeds 10% by weight, the enhancement of the effect is hardly recognized and it is uneconomical. On the other hand, for internal use, the dose varies depending on age, weight, symptoms, therapeutic effect, administration method, treatment time, etc., but the daily dose per adult is usually preferably 5 mg or more, and 10 mg to 5 g. Is more preferable. Furthermore, 100 mg to 1 g is most preferable.

  Next, in order to describe the present invention in detail, examples of production, experimental examples and formulation examples of fenugreek extract used in the present invention are given as examples, but the present invention is not limited thereto. In the production examples, “%” means “% by weight”, and “parts” in the examples means “parts by weight”.

(1) Experimental materials and growth conditions Fenugreek seeds were sown on a moisture-containing mesh, germinated in a dark place at a temperature of 22-24 ° C, wrapped in a sponge, and exposed to white light at 22-24 ° C for 24 hours. Cultivated and raised seedlings. Then, using a hydroponic cultivation device, at room temperature 21 to 23 ° C. for 24 hours, from a position 30 cm directly above the plant, a blue LED (peak wavelength 450 nm) and a red LED (peak wavelength 660 nm) are simultaneously irradiated, Cultivation was performed with the light quantity ratio of red and blue being 1: 0 to 0: 1 so that the total photosynthesis effective photon flux density of the blue LED was 100 μmol · m ⁻² s ⁻¹ . Further, as Comparative Example 1, cultivation was performed under a white fluorescent lamp so that the photosynthetic effective photon flux density was 100 μmol · m ⁻² s ^−1, and as Comparative Example 2, cultivation was performed under sunlight. In addition, the light quantity ratio was not changed during cultivation. After cultivating for 4 weeks, it was harvested to obtain raw fenugreek. This was dried in warm air at about 60 ° C. to obtain a dried fenugreek (Table 1).

(2) Extraction
Production example 1A Hot water extract 200 g of purified water was added to 10 g of the dried product, extracted at 95-100C for 2 hours, filtered, the filtrate was concentrated, freeze-dried, and the hot water extract was extracted. Obtained (Table 2).

Production Example 1B 50% ethanol extract 50% ethanol 200 mL was added to 10 g of the dried product, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain a 50% ethanol extract. (Table 2).

Production example 1C Ethanol extract 200 mL of ethanol was added to 10 g of the dried product, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain an ethanol extract (Table 2).

Similarly to the above, fenugreek cultivated by changing the light quantity ratio of red and blue so that the total photosynthesis effective photon flux density of red and blue LEDs is 100 μmol · m ⁻² s ⁻¹ or photosynthesis effective photon flux as a comparative example Using fenugreek cultivated under the same conditions as the above growth conditions under a white fluorescent lamp so that the density becomes 100 μmol · m ⁻² s ^−1, and fenugreek cultivated with sunlight as Comparative Example 2, the above production examples 1A to 1C and Extraction was carried out in the same manner to make Production Examples 2A to 7C and Comparative Production Examples 1A to 1C (Table 2).

Experimental Example 1 Active oxygen scavenging action Free radical scavenging and removing action was evaluated. Ascorbic acid was used as a positive control. As a free radical model, α, α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), which is a stable free radical, is used and reacted with a sample at a certain rate for a certain period of time. Was measured from the decrease in absorbance at a wavelength of 517 nm.

Method for measuring free radical scavenging / removing action 0.1 M acetate buffer solution (pH 5.5) in which each sample was added to a final concentration of 0.3 to 0.7 mg / mL (ascorbic acid was 0.01 mg / mL). 2 mL of absolute ethanol and 1 mL of 0.5 mM DPPH absolute ethanol solution were added to 2 mL to prepare a reaction solution. Then, it was made to react at 37 degreeC for 30 minutes, and the light absorbency of wavelength 517nm was measured by making water into a control | contrast. Moreover, the light absorbency was measured using the reaction liquid which added the purified water instead of the sample as a blank. The concentration (IC ₅₀ ) of the sample when the absorbance decreased by 50% compared to the blank was calculated.

  These test results are shown in Table 3. It was recognized that the extract of the present invention has a stable and excellent free radical scavenging and removing action. In particular, a high effect was recognized when the light quantity ratio between red and blue was 1: 0 to 0: 1, and a high effect was recognized with 8: 1 to 0: 1. Among them, particularly when the light quantity ratio between red and blue was 8: 1 to 1: 1, a significantly higher effect was recognized as compared with the cultivated product by sunlight which is a conventional technique. Ascorbic acid was inactivated by heat treatment at 100 ° C. for 1 hour, but the extract of the present invention did not change in activity.

Experimental Example 2 Collagen Production Promotion Effect Type I collagen (COL1A) mRNA expression level was measured. Human skin fibroblasts (NB1RGB) were seeded at 1 × 10 ⁵ cells in a 60 mm dish, and cultured in a DMEM culture solution containing 10% FBS under conditions of 37 ° C. and 5% CO ₂ . When the cells became confluent, each sample was cultured in a DMEM culture solution added with a final concentration of 10 μg / mL for 24 hours, and then total RNA was extracted. Extraction of total RNA from the cells was performed using TRIZOL Reagent (Invitrogen), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). Measurement of mRNA expression level was performed by real-time RT-PCR method based on total RNA extracted from cells. For the real-time RT-PCR method, SuperScriptIII Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen) was used. Specifically, 500 ng of total RNA was subjected to a reverse transcription reaction, followed by a PCR reaction (95 ° C .: 15 seconds, 60 ° C .: 30 seconds, 40 cycles). For other operations, the expression level of COL1A mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, in accordance with a predetermined method. The expression level of COL1A was calculated as a ratio of the expression level of COL1A mRNA in the sample addition group to the expression level of COL1A mRNA in the control.

Primer set AGGACAAGAGGGCATGTCTGGTT for COL1A (SEQ ID NO: 1)
TTGCAGTGGGTAGGTGATGTCTG (SEQ ID NO: 2)
Primer set CACTCTCCCAGCCCTTCCTCC for β-actin (SEQ ID NO: 3)
GTGTTGCGCGTACAGGTCTTTG (SEQ ID NO: 4)

  The results of these experiments are shown in Table 4. As a result, the extract of the present invention was found to have an excellent COL1A expression promoting effect (collagen production promoting effect). In particular, a high effect of a light quantity ratio between red and blue was recognized at 1: 0 to 1: 1. Among them, in particular, a high effect was recognized when the light quantity ratio between red and blue was 8: 1 to 1: 1.

Experimental Example 3 Melanin Production Inhibition Test 3 × 10 ⁴ B16 mouse melanoma cells in logarithmic growth phase were seeded in a 60 mm dish, and Eagles'MEM (containing 10% fetal bovine serum) containing each sample (final concentration 10 μg / mL) In the medium, the cells were cultured at 37 ° C. and 5% CO ₂ for 5 days. Next, after the cells were detached from the dish and sonicated, 4N NaOH was added and treated at 60 ° C. for 2 hours. D. 475 nm was measured. In addition, protein quantification is performed for the cell lysate after sonication by the Lowry method (J. Biol. Chem., 193, 265-275, 1951), the amount of melanin per amount of protein is calculated, and melanin with no sample added Using the amount of production as a control, the melanin production inhibition rate was calculated from the value of the amount of melanin produced when the sample was added to the control.

  The test results are shown in Table 5. It was recognized that the extract of the present invention has an excellent melanin production inhibitory action. In particular, a high effect of a light quantity ratio between red and blue was recognized at 1: 0 to 1: 1. Among them, in particular, a high effect was recognized when the light quantity ratio between red and blue was 8: 1 to 2: 1.

  Moreover, when the cultivated product by sunlight which is the prior art and the production example 3A having the highest effect were compared, a significantly high effect was recognized. The test results at a final concentration of 100 μg / mL are shown in Table 6.

Experimental Example 4 Ceramide Production Promotion Test The mRNA expression level of serine palmoyltransferase long chain subunit 1 (SPTLC1), which is a rate-limiting enzyme gene in ceramide synthesis, was evaluated as an index. That is, 5 × 10 ⁴ keratinocyte-derived HaCaT cells were seeded on a 6-well plate per well, and cultured in a DMEM culture solution containing 10% FBS under conditions of 37 ° C. and 5% CO ₂ for 4 days. Next, after culturing for 24 hours in a DMEM culture solution to which each sample (final concentration 10 μg / mL) was added, total RNA was extracted. Extraction of total RNA from the cells was performed using TRIZOL Reagent (Invitrogen), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). Measurement of mRNA expression level was performed by real-time RT-PCR method based on total RNA extracted from cells. For the real-time RT-PCR method, SuperScriptIII Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen) was used. Specifically, 500 ng of total RNA was subjected to a reverse transcription reaction, followed by a PCR reaction (95 ° C .: 15 seconds, 60 ° C .: 30 seconds, 40 cycles). In other operations, the expression level of SPTLCl mRNA was determined as a ratio to the expression level of GAPDH mRNA, which is an internal standard, in accordance with a predetermined method. The SPTLC1 expression level was calculated as the ratio of the SPTLC1 mRNA expression level in the sample addition group to the control SPTLC1 mRNA expression level. The primers used for measuring the expression level of each gene are as follows.

Primer set TGGTCACGGGTGGAACAAAACA for SPTLC1 (SEQ ID NO: 5)
GCCTGGGCTACCTCCTTGA (SEQ ID NO: 6)
GAPDH primer set TGCACCACCAACTGCCTTAGC (SEQ ID NO: 7)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 8)

  The results of these experiments are shown in Table 7. As a result, the extract of the present invention showed a ceramide production promoting effect. In particular, a high effect was recognized when the light quantity ratio between red and blue was 4: 1 to 0: 1. Among them, in particular, a high effect of a light quantity ratio of red and blue of 2: 1 was recognized.

Formulation Example 1 Lotion Prescription Formulation Amount (parts)
1. Extract of Production Example 3A 1.0
2.1,3-Butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5). Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Perfume proper amount11. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water, and both are mixed and filtered to obtain a product.

Formulation Example 2 Cream Formulation Amount (parts)
1. Extract of Production Example 4A 0.5
2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5). Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.25
12.1,3-Butylene glycol 8.5
13. [Manufacturing method] Components 2 to 9 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11 to 13 are heated and dissolved and mixed, and kept at 75 ° C. to obtain an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 10 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

  In Formulation Example 2, Formulation Examples 3, 4 and 5 were obtained by replacing the extract of Production Example 4A with the extract of Production Example 1A, the extract of Production Example 7A and the extract of Production Example 4B.

Formulation Example 6 Latex Formulation Formulation amount (parts)
1. Extract of Production Example 2A 1.0
2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5). Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Components 2 to 8 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 9 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 7 Gel formulation Formulation Amount (parts)
1. Extract of Production Example 4C 0.001
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5). Perfume appropriate amount 6.1,3-butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Production method] Ingredients 2 to 5 and ingredients 1 and 6 to 11 are uniformly dissolved in purified water, and the two are mixed to obtain a product.

Formulation Example 8 Pack Formulation Amount (parts)
1. Extract of Production Example 5A 0.1
2. Extract of Production Example 5B 0.1
3. Polyvinyl alcohol 12.0
4). Ethanol 5.0
5.1,3-butylene glycol 8.0
6). Methyl paraoxybenzoate 0.2
7). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
8). Citric acid 0.1
9. Sodium citrate 0.3
10. Perfume proper amount11. [Production Method] Components 1 to 11 are uniformly dissolved in purified water to make a total amount of 100 to obtain a product.

Formulation Example 9 Foundation Formulation Amount (parts)
1. Extract of Production Example 3A 1.0
2. Stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
4). Polyoxyethylene cetyl ether (20E.O.) 2.0
5). Cetanol 1.0
6). Liquid lanolin 2.0
7). Liquid paraffin 3.0
8). Isopropyl myristate 6.5
9. Sodium carboxymethylcellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12 Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14 Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Perfume proper amount19. [Manufacturing method] Components 2 to 8 are heated and dissolved in purified water to a total amount of 100, and kept at 80 ° C to obtain an oil phase. Swell component 9 well in component 19, then add components 1 and 10-13 and mix uniformly. To this, components 14 to 17 pulverized and mixed with a pulverizer are added, and the mixture is stirred with a homomixer and kept at 75 ° C. to obtain an aqueous phase. The aqueous phase is added to this oil phase while stirring and emulsified. Thereafter, the mixture is cooled, component 18 is added at 45 ° C., and the mixture is cooled to 30 ° C. with stirring to obtain a product.

Formulation Example 10 Bath Agent Formulation Formulation Amount (parts)
1. Extract of Production Example 6A 5.0
2. Extract of Production Example 6B 1.0
3. Sodium bicarbonate 50.0
4). Yellow No. 202 (1) Appropriate amount 5. Perfume appropriate amount 6. [Production Method] Components 1 to 6 are mixed uniformly with sodium sulfate to make a product.

Formulation Example 11 Ointment Formulation Formulation amount (parts)
1. Extract of Production Example 4B 0.5
2. Polyoxyethylene cetyl ether (30E.O.) 2.0
3. Glycerol monostearate 10.0
4). Liquid paraffin 5.0
5). Cetanol 6.0
6). Methyl paraoxybenzoate 0.1
7). Propylene glycol 10.0
8). [Manufacturing method] Components 2-5 are heated and dissolved and mixed with purified water to 100, and kept at 70 ° C. to obtain an oil phase. Ingredients 1 and 6 to 8 are dissolved by heating and mixed, and kept at 75 ° C. to obtain an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled to 30 ° C. with stirring to obtain a product.

Formulation Example 12 Powder Formulation Formulation Amount (parts)
1. Extract of Production Example 4A 20.0
2. Dried corn starch 30.0
3. Microcrystalline cellulose 50.0
[Production method] Components 1 to 3 are mixed to obtain a powder.

Formulation Example 13 Tablet Formulation Amount (parts)
1. Extract of Production Example 4A 3.0
2. Dried cornstarch 27.0
3. Carboxymethylcellulose calcium 20.0
4). Microcrystalline cellulose 40.0
5). Polyvinylpyrrolidone 7.0
6). Talc 3.0
[Production method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the formed granules and compressed. One tablet is 0.52 g.

Formulation Example 14 Tablet Confectionery Formulation Amount (parts)
1. Extract of Production Example 5A 0.5
2. Dried corn starch 50.0
3. Erythritol 40.0
4). Citric acid 5.0
5). Sucrose fatty acid ester 3.0
6). Perfume appropriate amount 7. [Manufacturing method] Components 1 to 4 and 7 with a total amount of 100 in purified water are mixed and granulated. Ingredients 5 and 6 are added to the formed granules and compressed. One tablet is 1.0 g.

Formulation Example 15 Beverage Formulation Blending (parts)
1. Extract of Production Example 5A 2.0
2. Fructose dextrose liquid sugar 12.5
3. Citric acid 0.1
4). Fragrance 0.05
5). [Production method] Ingredients 1-5 are mixed with purified water to a total amount of 100 to obtain a beverage.

Formulation Example 16 Powdered Beverage Formulation Amount (parts)
1. Extract of Production Example 7A 10.0
2. Powdered sugar 65.0
3. Powdered peach juice 15.0
4). L-ascorbic acid 8.0
5). Crystalline citric acid 1.2
6). Sodium citrate 0.75
7). Aspartame 0.02
8). Powdered peach flavor 0.03
[Production method] Components 1 to 8 are mixed to obtain a powdered beverage.

Formulation Example 17 Herbal Tea Formulation Amount (parts)
1. Dry fenugreek (Table 1 of Example 1 excluding comparative example) 1.0
2. Peppermint 0.5
3. Rosehip 0.5
[Manufacturing method] Components 1 to 3 are mixed, and 2 g is enclosed in a tea bag to make an herbal tea.

  From the above, fenugreek and its extract cultivated by irradiating with light having a specific wavelength range show excellent antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect, and contain these Skin external preparations or internal preparations are particularly effective.

Claims (7)

Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light of photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm A fenugreek characterized by enhancing one or more effects selected from an antioxidant effect, a collagen production promoting effect, a whitening effect, and a ceramide production promoting effect. Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light of photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm Fenugreek or one or two kinds selected from water, lower alcohols and liquid polyhydric alcohols, which are one or more kinds selected from antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect A pharmaceutical comprising the extract extracted by the above solvent. Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light of photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm Fenugreek or one or two kinds selected from water, lower alcohols and liquid polyhydric alcohols, which are one or more kinds selected from antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect A food comprising an extract extracted with the above solvent. Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light with photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm Fenugreek or one or two kinds selected from water, lower alcohols and liquid polyhydric alcohols, which are one or more kinds selected from antioxidant effect, collagen production promoting effect, whitening effect and ceramide production promoting effect A skin external preparation characterized by containing an extract extracted by the above solvent. Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light with photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm And an anti-oxidant characterized by containing an extract extracted with one or two or more kinds of solvents selected from fenugreek or water, lower alcohols and liquid polyhydric alcohols with enhanced antioxidant effect. Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light with photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm A whitening agent comprising fenugreek with enhanced whitening effect or an extract extracted with one or more solvents selected from water, lower alcohols and liquid polyhydric alcohols. Compared with fenugreek cultivated with fluorescent lamp or sunlight by irradiating with light with photosynthesis photon flux density (PPFD) ratio of 3: 1 to 2: 1 between wavelength range 570-730nm and 400-515nm A ceramide production promoter characterized by containing fenugreek with enhanced ceramide production promoting effect or an extract extracted with one or more solvents selected from water, lower alcohols and liquid polyhydric alcohols.