JP5690150B2 - External preparation or internal preparation - Google Patents

Description

  The present invention relates to a novel external or internal preparation excellent in active oxygen elimination, MMP production inhibition, melanin production inhibition and cell growth promoting action.

  The skin is located in the outermost layer of the living body, is an organ in which active oxygen is easily generated due to the influence of ultraviolet rays and the like, and is constantly exposed to the oxygen stress. On the other hand, active oxygen scavenging enzymes exist in the skin cells, and protect the skin cells from injury of active oxygen unless active oxygen exceeding that capacity is generated. However, it is known that the activity of the active oxygen scavenging enzyme in skin cells decreases with age, and when the injury due to active oxygen surpasses its protective reaction, the skin is oxidized and the cell function deteriorates and ages. It is thought that it will do. Also, in organs other than the skin, when exposed to active oxygen exceeding its active oxygen scavenging ability, it is considered that functional deterioration occurs and aging occurs. Therefore, active oxygen scavengers and antioxidants have been studied for the purpose of protecting against active oxygen injury, and active oxygen scavengers such as SOD and catalase, and active oxygen scavengers and antioxidants such as SOD-like active substances are included. Foods, cosmetics, quasi-drugs and pharmaceuticals have been developed (see Patent Documents 1 and 2).

JP-A-9-118630 JP-A-9-208484

  Involvement of matrix metalloproteinases (MMPs) is pointed out as factors that induce changes associated with skin aging. Among these MMPs, matrix metalloproteinase-1 (MMP-1) is known as an enzyme that degrades collagen, which is a major component of the dermal extracellular matrix of skin, but its expression is greatly increased by irradiation with ultraviolet rays. However, it is thought to contribute to the decrease / denaturation of collagen, and to become a major factor such as the formation of wrinkles on the skin and the decrease in elasticity. For example, an extract of a bark of a pine genus Pinaceae is known as one having such an MMP-1 activity inhibitory effect (see Patent Document 3).

JP 2003-277223 A

  Matrix metalloproteinase-2 (MMP-2), an enzyme belonging to the gelatinase group, is known as an enzyme that degrades type IV collagen and laminin 5, which are the main components of the basement membrane. Is significantly increased by UV irradiation, causes a decrease in basement membrane components due to ultraviolet rays, changes in the structure of the basement membrane, and is a major factor in the formation of wrinkles and sagging in the skin (see Non-Patent Document 1). ).

Gary J. Fisher et al. , Nature, 1996, 379, 25, p. 335

  Furthermore, MMP-2 degrades type IV collagen and the like constituting the basement membrane existing under the vascular endothelial cells, and the decomposed vascular endothelial cells migrate to the stroma, proliferate in the stroma, and tube A cavity is formed and new blood vessels are constructed. Then, it is known that the newly formed blood vessels reach the tumor cells, supply nutrient sources and oxygen to the tumor cells, and the tumor grows (see Non-Patent Document 2). In addition, MMP-2 plays an important role in cancer growth and angiogenesis, such as angiogenesis underdevelopment and cancer growth inhibition in MMP-2 knockout mice (see Non-Patent Document 3). .

Angiogenesis and matrix metalloproteinases, “Records of the 120th Annual Meeting of the Japanese Medical Society Symposium: Basics and Clinic of Angiogenesis”, December 13, 2001, p. 43-49 Itoh T et al. , Cancer Res, 1998, 58, 1048-1051.

  In general, pigmentation of the skin seen in spots, buckwheat, sunburn, etc. is caused by excessive melanin pigment formation in the skin by melanin pigment-producing cells present in the skin due to hormonal abnormalities and stimulation of ultraviolet rays. It is thought to be the cause. As one method for preventing such pigmentation, a method for suppressing excessive production of melanin is known. Conventionally, ascorbic acid (vitamin C) or the like has been used for treatment of pigmentation in internal use or external use.

  The proliferation / division ability of epidermal cells decreases with aging, and the epidermal layer itself becomes thin (see Non-Patent Document 4). Epidermal Growth Factor (EGF / epidermal growth factor) and female hormones (estrogens), which are biological factors, act on the proliferation of epidermal cells in the skin, but their secretion decreases with age. Such a decrease in epidermal cell metabolic function due to aging delays the turnover speed of the skin, causing rough skin and aging of the skin. In addition, the horny layer cells that fall off from the stratum corneum surface stay, and the melanin in the epidermis is not excreted smoothly, causing pigmentation and dull skin. It is also known that epidermal wound healing is delayed. In order to prevent or improve the progression of these phenomena, search for components that promote the proliferation of epidermal cells and proposals for many external preparations for skin have been made.

Varani J et al. , J Investig Dermato Sym Proc, 1998, 3, 5760.

  However, the Ryukyu rose strawberry used in the present invention has not been studied as a plant-derived natural raw material having these active oxygen scavenging effects, MMP production inhibitory effects, melanin production inhibitory effects, and cell growth promoting effects.

  A material that is safe and excellent in stability, excellent in active oxygen scavenging action, MMP production inhibitory action, melanin production inhibitory action, and cell growth promoting action is desired, but a material that is still satisfactory is not provided. Currently.

  Under these circumstances, the present inventors have intensively studied. As a result, the extract of Ryukyu rose strawberry has excellent active oxygen scavenging action, MMP production inhibitory action, melanin production inhibitory action, and cell growth promoting action, and in stability. Also found it to be excellent. Furthermore, the external preparation or internal preparation containing the extract is safe and stable, and has excellent active oxygen scavenging action, MMP production inhibitory action, melanin production inhibitory action, and cell growth promoting action, and has a multifunctional beauty.・ It was found that it could be a health material, and the present invention was completed.

  The extract of Ryukyu rose strawberry used in the present invention refers to plants such as flowers, stems, leaves, branches, branches, leaves, roots, seeds, etc. It is extracted from a part of the whole or whole grass. The extraction method is not particularly limited, and for example, it may be a heat extraction or a room temperature extraction.

  Examples of the solvent to be extracted include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol). , Glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether) Etc.). Preferred are polar solvents such as water, lower alcohols and liquid polyhydric alcohols, and particularly preferred are water, ethanol, 1,3-butylene glycol and propylene glycol. These solvents may be used alone or in combination of two or more.

  The extract may be used as it is, or may be used after concentration, dilution and filtration treatment, decolorization with activated carbon, deodorization treatment, or the like, if necessary. Further, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

  In the external preparation or internal preparation of the present invention, the above-mentioned extract may be used as it is, and it is a component used in cosmetics, quasi drugs, pharmaceuticals, foods, etc. within the range not impairing the effect of the extract. Certain fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, Components such as a dye, an antioxidant, a whitening agent, a chelating agent, an excipient, a film agent, a sweetener, and a sour agent can also be blended.

  Examples of the dosage form of the present invention include lotions, creams, massage creams, emulsions, gels, aerosols, packs, cleaning agents, bath preparations, foundations, powders, lipsticks, ointments, poultices, pastes, plasters. Essences, powders, pills, tablets, injections, suppositories, emulsions, capsules, granules, liquids (including tinctures, fluid extracts, spirits, suspensions, limonades, etc.), tablets, A drink etc. are mentioned.

  In the case of external use, the amount of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, in terms of solid matter, based on the total amount. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, a sufficient effect is hardly expected. When the blending amount exceeds 10% by weight, the effect is hardly recognized and it is uneconomical. On the other hand, for internal use, the dose varies depending on age, weight, symptoms, therapeutic effect, administration method, treatment time, etc., but the daily dose per adult is usually preferably 5 mg or more, and 10 mg to 0 0.5 g is more preferable. Furthermore, 20 mg to 0.2 g is most preferable.

  Next, in order to describe the present invention in detail, examples of production of the extract used in the present invention, formulation examples and experimental examples will be given as examples, but the present invention is not limited thereto. In the examples, the part of the amount is part by weight, and% is% by weight.

Production Example 1 Ryukyu rose strawberry hot water extract 400 g of purified water was added to 20 g of dried dried ryukyuba strawberry whole plant, extracted at 95-100 ° C. for 2 hours, filtered, and the filtrate was concentrated and lyophilized. As a result, 2.5 g of a hot water extract of Ryukyu rose strawberry was obtained.

Production Example 2 50% ethanol extract of Ryukyu rose strawberry 1 L of 50% ethanol aqueous solution was added to 100 g of dry product of whole plant of Ryukyu rose strawberry, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness. 3.8 g of 50% ethanol extract of Ryukyu rose strawberry was obtained.

Production Example 3 Ethanol extract of Ryukyu rose strawberry Add 1 L of ethanol to 100 g of dried Ryukyu rose strawberry leaves, extract at room temperature for 7 days, filter, concentrate the filtrate to dryness, and ethanol of Ryukyu rose strawberry. 4.1 g of extract was obtained.

Production Example 4 50% 1,3-butylene glycol extract of Ryukyu rose strawberry 400 mL of 50% 1,3-butylene glycol aqueous solution was added to 20 g of the dried product of the above-ground portion of Ryukyu rose strawberry, extracted at room temperature for 7 days, and then filtered. 370 g of 50% 1,3-butylene glycol extract of Ryukyu rose strawberry was obtained.

Formulation Example 1 Lotion Prescription Formulation Amount (parts)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 1.0
2. 1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5. Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Perfume proper amount11. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water, and both are mixed and filtered to obtain a product.

Comparative Example 1 Conventional lotion In Formulation Example 1, the hot water extract of Ryukyu rose strawberry was replaced with purified water to obtain a conventional lotion.

Formulation Example 2 Cream Formulation Amount (parts)
1. 50% ethanol extract of Ryukyu rose strawberry (Production Example 2) 0.5
2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5. Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12 Ethyl paraoxybenzoate 0.05
13.1,3-Butylene glycol 8.5
14 [Manufacturing method] Components 2 to 9 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11 to 14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 10 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 3 Latex Formulation Formulation amount (parts)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 0.01
2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5. Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Components 2 to 8 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring.

Formulation Example 4 Gel formulation Formulation Amount (parts)
1. Ethanol extract of Ryukyu rose strawberry (Production Example 3) 1.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Production method] Ingredients 2 to 5 and ingredients 1 and 6 to 11 are uniformly dissolved in purified water, and the two are mixed to obtain a product.

Formulation Example 5 Pack Formulation Amount (part)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 1.0
2. 50% 1,3-butylene glycol extract of Ryukyu rose strawberry (Production Example 4) 5.0
3. Polyvinyl alcohol 12.0
4). Ethanol 5.0
5.1,3-Butylene glycol 8.0
6). Methyl paraoxybenzoate 0.2
7). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
8). Citric acid 0.1
9. Sodium citrate 0.3
10. Perfume proper amount11. [Production Method] Components 1 to 11 are uniformly dissolved in purified water to make a total amount of 100 to obtain a product.

Formulation Example 6 Foundation Formulation Amount (parts)
1. 50% ethanol extract of Ryukyu rose strawberry (Production Example 2) 1.0
2. Stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
4). Polyoxyethylene cetyl ether (20E.O.) 2.0
5. Cetanol 1.0
6). Liquid lanolin 2.0
7). Liquid paraffin 3.0
8). Isopropyl myristate 6.5
9. Sodium carboxymethylcellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12 Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14 Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Perfume proper amount19. [Manufacturing method] Components 2 to 8 are heated and dissolved in purified water to a total amount of 100, and kept at 80 ° C to obtain an oil phase. Swell component 9 well in component 19, then add components 1 and 10-13 and mix uniformly. To this, components 14 to 17 pulverized and mixed with a pulverizer are added, and the mixture is stirred with a homomixer and kept at 75 ° C. to obtain an aqueous phase. The oil phase is added to this aqueous phase with stirring, cooled, component 18 is added at 45 ° C., and cooled to 30 ° C. with stirring to give a product.

Formulation Example 7 Bath preparation Formulation Formulation amount (parts)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 1.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume appropriate amount 5. [Manufacturing method] Ingredients 1 to 5 are mixed uniformly with sodium sulfate to make a product.

Formulation Example 8 Ointment Formulation Formulation amount (parts)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 1.0
2. 50% 1,3-butylene glycol extract of Ryukyu rose strawberry (Production Example 4) 5.0
3. Polyoxyethylene cetyl ether (30E.O.) 2.0
4). Glycerol monostearate 10.0
5. Liquid paraffin 5.0
6). Cetanol 6.0
7). Methyl paraoxybenzoate 0.1
8). Propylene glycol 10.0
9. [Production Method] Components 3 to 6 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C. to obtain an oil phase. Ingredients 1, 2, and 7-9 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled to 30 ° C. with stirring to obtain a product.

Formulation Example 9 Powder 1
Formulation Amount (parts)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 1.0
2. Dried corn starch 39.0
3. Microcrystalline cellulose 60.0
[Production method] Components 1 to 3 are mixed to obtain a powder.

Formulation Example 10 Powder 2
In Formulation Example 9, Powder 2 was prepared by replacing the hot water extract of Ryukyu rose strawberry with an ethanol extract (Production Example 3).

Formulation Example 11 Tablet Formulation Blending amount (parts)
1. Ethanol extract of Ryukyu rose strawberry (Production Example 3) 5.0
2. Dried corn starch 25.0
3. Carboxymethylcellulose calcium 20.0
4). Microcrystalline cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6). Talc 3.0
[Production method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and compressed. One tablet is 0.52 g.

Formulation Example 12 Tablet Confection Formulation Amount (parts)
1. Ethanol extract of Ryukyu rose strawberry (Production Example 3) 2.0
2. Dried corn starch 49.8
3. Erythritol 40.0
4). Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6). Fragrance 0.1
7). Purified water 0.1
[Production method] Components 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and tableted. One tablet is 1.0 g.

Formulation Example 12 Beverage Formulation Blending amount (parts)
1. Ryukyu rose strawberry hot water extract (Production Example 1) 0.05
2. Stevia 0.05
3. Malic acid 5.0
4). Fragrance 0.1
5. Purified water 94.8
[Production Method] Components 2 and 3 are dissolved in a small amount of water. Components 1, 4 and 5 are then added and mixed.

  Next, experimental examples will be given to explain the effects of the present invention in detail.

Experimental Example 1 Active oxygen scavenging action Free radical scavenging and removing action was evaluated. Ascorbic acid was used as a positive control. As a free radical model, α, α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), which is a stable free radical, is used and reacted with a sample at a certain rate for a certain period of time. Was measured from the decrease in absorbance at a wavelength of 517 nm.

Measurement method of free radical scavenging and removing action Each sample was added to absolute ethanol in 2 mL of 0.1 M acetate buffer (pH 5.5) added to a final concentration of 0.01 mg / mL (ascorbic acid was 0.01 mg / mL). 2 mL and 1 mL of 0.5 mM DPPH absolute ethanol solution were added to prepare a reaction solution. In the case of an oil-soluble sample, the sample was added to 2 mL of absolute ethanol to prepare a reaction solution. Then, it was made to react at 37 degreeC for 30 minute (s), and the light absorbency (A) of wavelength 517nm was measured by using water as a control. Moreover, the light absorbency (B) was measured using the purified water instead of the sample as a blank. The free radical scavenging removal rate was calculated from the following equation.
Free radical scavenging removal rate (%) = (1−A / B) × 100

The test results are shown in Table 1. It was confirmed that the hot water and 50% ethanol extract of Ryukyu rose strawberry of the present invention have a stable and excellent free radical scavenging and removing action. Moreover, the effect was recognized also about the other extract. Ascorbic acid was inactivated by heat treatment at 100 ° C. for 1 hour, but the activity of the Ryukyu rose strawberry extract of the present invention was not changed.

Experimental Example 2 MMP Production Inhibitory Action MMP production inhibitory action was evaluated using MMP-1 and MMP-2 mRNA expression levels as indices.

Method for measuring MMP-1 and MMP-2 mRNA expression levels Normal human skin fibroblasts were cultured in DMEM medium containing 10% FCS under conditions of 37 ° C. and 5% CO _2. After further culturing in DMEM medium supplemented with (final concentration 10 μg / mL), total RNA was extracted. ISOGEN (Nippon Gene) was used for extraction of total RNA. MMP-1 and MMP-2 mRNA expression levels were measured by real-time RT-PCR based on total RNA extracted from fibroblasts. TaKaRa SYBR ExScript RT-PCR Kit was used for the real-time RT-PCR method, and 5'GGGAGATCCATGGGACAACTC3 '(SEQ ID NO: 1) and 5'TGAGCATCCCCCTCCATAACC3' (SEQ ID NO: 2) were used as primers for MMP-1. As a primer for MMP-2, 5′CCGTCGCCCATCATCAA3 ′ (SEQ ID NO: 3) and 5′CTTCTGCCATCTTCTTTAGTGGTCCTT3 ′ (SEQ ID NO: 4) were used. In addition, GAPDH was used as an internal standard, and 5′TGCACCACCAACTGCTTTAGC3 ′ (SEQ ID NO: 5) and 5′TCTCTGGGTGGCAGGTGATG3 ′ (SEQ ID NO: 6) were used as primers for GAPDH. For other operations, the mRNA expression levels of MMP-1 and MMP-2 were determined as a ratio to the mRNA expression level of GAPDH, which is an internal standard, in accordance with a predetermined method.

The test results are shown in Table 2. It was confirmed that the 50% ethanol extract of Ryukyu rose strawberry of the present invention has an excellent MMP production inhibitory action. Moreover, the effect was recognized also about the other extract.

Experimental Example 3 Inhibition test of melanin production using B16 mouse melanoma B16 mouse melanoma in the logarithmic growth phase was seeded at 3 × 10 ⁴ cells in φ60 mm dish, and Eagles'MEM (final concentration 1 μg / mL) containing each sample (final concentration 1 μg / mL). 10% fetal calf serum-containing medium was added, and the cells were cultured at 37 ° C. and 5% CO ₂ . After 5 days of culture, the cells were detached from the dish, and the cells were sonicated, and then treated with 4N NaOH for 2 hours at 60 ° C. D. 475 nm was measured. In addition, the protein quantification is performed for the cell lysate after sonication by Lowry's method (J. Biol. Chem., 193, 265-275, 1951), and the amount of melanin per amount of protein is compared to suppress melanin production. It was used as an effect index.

These test results are shown in Table 3. It was recognized that the hot water extract of Ryukyu rose strawberry of the present invention has an excellent melanin production inhibitory action. Moreover, the effect was recognized also about the other extract.

Experimental Example 4 Cell Growth Promotion Test HaCaT cells were seeded in a 96-well plate at 5,000 cells per well in a DMEM culture solution containing 0.1% FBS, and after adding each sample, conditions of 37 ° C., 5% CO ₂ The cells were cultured for 3 days. The number of cells was measured by the MTT method. That is, after completion of the culture, the culture medium is removed, the medium is replaced with DMEM in which MTT is dissolved at a concentration of 500 μg / mL, the cells are cultured for 2 hours, cells are dissolved in 150 μL of DMEM, and a microplate reader is used. The absorbance at 590 and 650 nm was measured. The number of cells was calculated by subtracting the absorbance value at 650 nm from the absorbance value at 590 nm, and was shown as a conversion value with the cell group to which no sample was added (unadded cell group) as 100%.

The results of these experiments are shown in Table 4. As a result, the 50% ethanol extract of Ryukyu rose strawberry of the present invention showed an excellent cell growth promoting action. Moreover, the effect was recognized also about the other extract.

Experiment 5 Use test 1
Using the skin lotion of Formulation Example 1 and the conventional skin lotion of Comparative Example 1, a use test for 1 month was conducted on 10 women (23 to 50 years old) who suffer from spots and freckles. After use, the effect of improving spots and freckles was judged by a questionnaire.

  As a result, the external preparation for skin containing the extract of the present invention showed an excellent effect of improving spots and freckles. During the test period, there was no skin problem and there was no problem with safety. There was also no problem with the deterioration of the prescription ingredients.

  From the above, the extract of Ryukyu rose strawberry of the present invention had excellent active oxygen scavenging action, MMP production inhibitory action, melanin production inhibitory action and cell growth promoting action, and was also excellent in stability. Therefore, the extract of Ryukyu rose strawberry of the present invention can be used not only in the beauty field such as skin aging and whitening, but also in the medical field such as suppression of functional deterioration due to aging, prevention of cancer, treatment and wound healing, Expected to be applied to food, cosmetics, quasi-drugs and pharmaceuticals.

Claims (1)

A melanin production inhibitor comprising an extract of Ryukyu rose strawberry.