JP2021014438A - Cathepsin V activity promoter and GATA-3 production inhibitor - Google Patents

Abstract

To provide effective cathepsin V activity promoters and GATA-3 production inhibitors containing botanical ingredients that are less likely to cause rough skin.SOLUTION: The present invention is characterized by containing a mandarin orange extract and/or a loofah extract. The invention is characterized by promoting the enzymatic activity of cathepsin V involved in the degradation of the inner root sheath of a hair follicle, or suppressing the production of GATA-3 involved in the formation of the inner root sheath, the invention suppressing the formation of keratin plugs and disassembling the keratin plugs to eliminate the keratin plugs accumulated in the pores to eliminate the clogging of the pores, and further having the effects of improving the conspicuity of the pores and the conspicuity of the body hair. The invention of the present application can be incorporated into pharmaceuticals, quasi-drugs, cosmetics, foods and the like.SELECTED DRAWING: None

Description

The present invention relates to a cathepsin V activity promoter and a GATA-3 production inhibitor, which are characterized by containing a specific extract, and symptoms and diseases associated with the cathepsin V activity promoter and the GATA-3 production inhibitor. For preventive, ameliorating or therapeutic drug compositions against.

Cathepsin V is a proteolytic enzyme belonging to cysteine protease. It is localized in skin epidermal cells, inner root sheath in hair follicles, and keratin plugs. Since it was identified as an enzyme involved in keratin desquamation, it is considered to have an action of cleaving adhesion molecules between keratinocytes in the stratum corneum, inner root sheath, and keratinocytes (Non-Patent Documents 1 and 2). ). It is also localized in intracellular lysosomes and has been shown to be involved in proteolysis (Non-Patent Document 3). It has been pointed out that the skin color is related to cathepsin V, and its application to whitening cosmetics and the like is expected (Non-Patent Document 4). Furthermore, since it is involved in the production of endostatin and angiostatin, which have an inhibitory effect on angiogenesis (Non-Patent Document 5), it prevents cancers associated with angiogenesis, intraocular angiogenesis, rheumatoid arthritis, and scleroderma. It is expected to be applied to medical treatments, and also for symptoms and diseases related to keratin plugs caused by clogging of pores, etc., by promoting the enzymatic activity of catepsin V, it promotes keratin plug decomposition. It can be prevented and treated, and catepsin V is attracting attention from both medical and industrial perspectives.

The GATA-3 gene is a gene encoding a transcription factor existing in the nucleus of a cell, and may be involved in cell differentiation of immune cells such as T cells, vascular endothelial cells, and inner hair root sheath cells of hair follicles. It has been reported that deficiency of this gene and dysfunction of gene products impair the ability to differentiate into the above cells. For example, suppression of GATA-3 in hair follicles suppresses hair growth because inner root sheath formation is impaired. In addition, GATA-3 is required for the differentiation of Th2 cells, which are a type of helper T cells involved in allergic symptoms seen in pollinosis and the like (Non-Patent Document 6). From the above, it can be applied as a hair suppressant and also for prevention and treatment of allergic symptoms such as pollinosis, and symptoms involving keratin plugs caused by clogging of pores, etc. GATA-3 is a medical and industrial treatment because it can prevent and treat the formation of inner hair follicle sheaths of hair follicles involved in keratin plug formation by suppressing the production of GATA-3. It is attracting attention from both sides.

Citrus is an evergreen shrub of the genus Citrus in the family Rutaceae. The fruits of mandarin oranges are used for food. Mandarin orange peel is called chimpi in Chinese medicine, and is used as an aromatic stomachic and antitussive for anorexia, vomiting, pain, etc., and also has a blood pressure lowering effect. Further, it has been shown that it can be used in cosmetics as a whitening agent, a moisturizer, or the like (Patent Documents 1 and 2).

Luffa is an annual plant of the genus Luffa in the family Cucurbitaceae. It is used for cosmetic purposes such as loofah water, and is known to have a mitochondrial transfer promoting action (Patent Document 3) and a proton pump inhibitory action (Patent Document 4).

However, the keratin plug removing action, the pore conspicuous improving action, the cathepsin V activity promoting action, the GATA-3 production suppressing action and the hair hair suppressing action of these mandarin orange extracts and loofah extracts are not known.

JP-A-2005-132793 JP 2012-184180 JP-A-2018-123130 JP 2013-1659

D. Bernard, et al. J. Invest. Dermatol. 120, 592-600 (2003) Patrick L. J. M. Zeeuwen, et al. J. Invest. Dermatol. 127,120-128 (2007) Y. Miwa, et al. FEBS Lett. 586,3601-3607 (2012) N. Chen, et al. J. Invest. Dermatol. 126,2345-2347 (2006) S. Noda, et al. Rheumatology 52, 790-799 (2013) W. Zheng & R. A. Flavel Cell 89,587-596 (1997)

In view of this situation, the subject of the present invention is the production of GATA-3, a cathepsin V activity promoter containing a plant component that is effective and has a cathepsin V activity promoting action and / or a GATA-3 production suppressing action with few side effects. The purpose is to provide an inhibitor.

As a result of searching for an active ingredient having a cathepsin V activity promoting action and / or a GATA-3 production inhibitory action, the inventors of the present application have found that the citrus extract and the loofah extract have the same action, and have described the present invention. It came to be completed.

Action of invention

The mandarin orange extract and / or loofah extract of the present invention has an excellent cathepsin V activity promoting action, GATA-3 production suppressing action, and keratin plug removing action, and is used for pharmaceuticals, quasi-drugs, cosmetics, and foods. It is available in the field.

The invention of the present application will be described in detail below.

The citrus extract used in the present invention includes citrus citrus citrus, mandarin orange, citrus tachibana, citrus citrus, citrus citrus, citrus citrus, citrus citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, citrus, and citrus. , Fruits, fruit bark, seeds, bark, branches, leaves, roots, etc., extracted from part or whole plant, preferably extracted from fruit, fruit bark, most preferably extracted from fruit bark. is there. Further, these plants may be used as they are for extraction, or may be subjected to treatments such as drying, crushing, and shredding.

The loofah extract used in the present invention is the annual flower, fruit, seed, and stem of the genus Luffa of the Cucurbitaceae family (Luffa, Luffa, scientific name: Luffa cylindrica (L.) Rome., Also known as Luffa aegyptica Mill.). , Leaves, roots, etc., extracted from a part or whole plant, preferably extracted from fruits, roots, and most preferably extracted from roots. Further, these plants may be used as they are for extraction, or may be subjected to treatments such as drying, crushing, and shredding.

The extraction method is not particularly limited, but can be carried out by a method of extracting by stirring or immersing in water or hot water or a mixed solvent of water and an organic solvent. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, etc.). , Glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.) Etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used alone or in admixture of two or more. Particularly preferred extraction solvents include water or water-ethanol mixed polar solvents. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more the amount of the above-mentioned plant (dry weight), but when it is concentrated or isolated after extraction. It is preferably 100 times or less for convenience of operation. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure at the time of extraction, and the like.

The above extract may be used as it is in the extracted solution, but if necessary, concentration (concentration under reduced pressure, concentration by membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, etc., and deodorization are performed within the range in which the action of the present invention is exhibited. , Ethanol precipitation and the like may be performed before use. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze drying and the like, and used as a dried product. The extract may be used alone, or two or more kinds may be used in combination. When used in combination, the mixing ratio is not limited.

In the present invention, the above-mentioned extract may be used as it is, and fats and oils, waxes, and charcoal which are components used in cosmetics, non-medicinal products, pharmaceuticals, foods, etc., as long as the action of the extract is not impaired. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH regulators, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , Chelating agents, excipients, film agents, sweeteners, acidulants and the like may be contained.

The mandarin orange extract and / or loofah extract used in the present invention may be used as they are, or may be used after being subjected to treatments such as extraction, concentration, dilution and filtration, and decolorization and deodorization treatments with activated carbon or the like, if necessary. good.

The above-mentioned extract may be used as it is in the external preparation or the internal preparation of the present invention, and is used for cosmetics, non-pharmaceutical products, pharmaceuticals, foods, etc. as long as the action of the extract is not impaired. Ingredients such as fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners. Ingredients such as agents, pigments, antioxidants, whitening agents, chelating agents, excipients, film agents, sweeteners and acidulants can also be blended.

Dosage forms of the present invention include, for example, lotions, creams, massage creams, emulsions, gels, aerosols, packs, cleaning agents, bathing agents, foundations, dusting powders, lipsticks, ointments, poultices, pastes, plasters. , Essences, powders, pills, tablets, injections, suppositories, emulsions, capsules, granules, liquids (including tinctures, pastes, alcohols, suspensions, limonades, etc.), tablets , Beverages, etc.

The content of the mandarin orange extract and the loofah extract used in the present invention is preferably 0.001% by weight or more, preferably 0.001 to 5% by weight, in terms of solid matter. If it is less than 0.001% by weight, it may be difficult to sufficiently exert the action of the present invention. The method of addition may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

Next, in order to explain the present invention in detail, examples of production, formulation, and experimental examples of the citrus extract used in the present invention will be given as examples, but the present invention is not limited thereto. The contents in the examples are all% by weight. As the loofah extract used in the examples, loose-now (technoble) was concentrated and then freeze-dried.
An example of producing a mandarin orange extract is shown below.

Production Example 1 Hot water extract of mandarin oranges
200 mL of purified water is added to 10 g of dried mandarin oranges, extracted at 95-100 ° C. for 2 hours, filtered, the filtrate is concentrated, freeze-dried, and 1.6 g of hot water extract of mandarin oranges is obtained. Obtained.

Production Example 2 50% ethanol extract of mandarin oranges 200 mL of 50% ethanol is added to 10 g of dried mandarin oranges, extracted at room temperature for 7 days, filtered, and the filtrate is concentrated to dryness to concentrate and dry the mandarin oranges. To obtain 1.2 g of a 50% ethanol extract of.

Production Example 3 Ethanol extract of mandarin oranges 200 mL of ethanol is added to 10 g of dried mandarin oranges, extracted at room temperature for 7 days, filtered, and the filtrate is concentrated to dryness to extract ethanol of mandarin oranges. Was obtained in an amount of 0.8 g.

Production Example 4 Hot water extract of mandarin orange peel
200 mL of purified water is added to 10 g of dried mandarin peel, extracted at 95-100 ° C. for 2 hours, filtered, the filtrate is concentrated, freeze-dried, and 1.3 g of hot water extract of mandarin peel. Obtained.

Production Example 5 50% ethanol extract of citrus peel 200 mL of 50% ethanol was added to 10 g of dried citrus peel, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to concentrate and dry the citrus peel. 0.6 g of 50% ethanol extract of the above was obtained.

Production Example 6 Ethanol extract of citrus peel Add 200 mL of ethanol to 10 g of dried citrus peel, extract at room temperature for 7 days, filter, concentrate and dry the filtrate, and concentrate ethanol extract of citrus peel. Was obtained in an amount of 0.4 g.

Prescription example 1 Lotion Prescription content (%)
1. 1. Hot water extract of mandarin orange peel (Production Example 4) 0.5
2. 2. Loofah extract 0.5
3.1,3-butylene glycol 8.0
4. Glycerin 2.0
5. Xanthan gum 0.02
6. Citric acid 0.01
7. Sodium citrate 0.1
8. Ethanol 5.0
9. Methyl paraoxybenzoate 0.1
10. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
11. Appropriate amount of fragrance 12. [Manufacturing method] Ingredients 1 to 7 and 12 and components 8 to 11 are uniformly dissolved in purified water to make the total amount 100, and both are mixed and filtered to obtain a product.

Comparative Example 1 Conventional Lotion In Formulation Example 1, the hot water extract and loofah extract of mandarin orange peel were replaced with purified water to obtain a conventional lotion.

Prescription example 2 Emulsion prescription content (%)
1. 1. 50% ethanol extract of mandarin orange (Production Example 2) 0.5
2. 2. Hot water extract of mandarin orange peel (Production Example 4) 0.3
3. 3. Squalene 5.0
4. Olive oil 5.0
5. Jojoba oil 5.0
6. Cetanol 1.5
7. Glycerin monostearate 2.0
8. Polyoxyethylene cetyl ether (20EO) 3.0
9. Polyoxyethylene sorbitan monooleate 2.0
10. Fragrance 0.1
11. Propylene glycol 1.0
12. Glycerin 2.0
13. Methyl paraoxybenzoate 0.2
14. [Manufacturing method] Ingredients 3 to 9 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 11 to 14 are heated and dissolved and mixed to prepare an aqueous phase at 75 ° C. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 10 is added at 45 ° C., and the mixture is further cooled to 30 ° C. and components 1 and 2 are added to prepare a product.

Comparative Example 2 Conventional Emulsion In Formulation Example 2, a 50% ethanol extract of mandarin oranges and a hot water extract of mandarin orange peel were replaced with purified water to obtain a conventional emulsion.

Prescription example 3 Cream ingredient content (%)
1. 1. 50% ethanol extract of mandarin orange peel (Production Example 5) 0.1
2. 2. Polyglyceryl isostearate-10 1.3
3. 3. Polygluceryl myristate-10 1.3
4. Glycerin 4.5
5. Dimethicone 10.0
6. Diphenylsiloxyphenyltrimethicone 10.0
7. EDTA-2Na 0.05
8. Carboxyvinyl polymer 0.3
9.1,3-butylene glycol 10.0
10. Methyl paraoxybenzoate 0.3
11. AMPD 0.15
12. [Manufacturing method] Ingredients 2 to 6 having a total amount of 100 in purified water are heated and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 7 to 12 are heated and dissolved, mixed, and kept at 70 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase, emulsified, cooled while stirring, component 1 is added at 45 ° C, and the product is further cooled to 30 ° C to obtain a product.

Comparative Example 3 Conventional Cream In Formulation Example 3, a cream obtained by replacing a 50% ethanol extract of mandarin orange peel with purified water was used as a conventional cream.

Prescription example 4 Gel component content (%)
1. 1. Hot water extract of mandarin orange peel (Production Example 4) 5.0
2. 2. Loofah extract 0.5
3. 3. Ethanol 5.0
4. Methyl paraoxybenzoate 0.1
5. Polyoxyethylene hydrogenated castor oil (60EO) 0.1
6. Appropriate amount of fragrance 7.1,3-butylene glycol 5.0
8. Glycerin 5.0
9. Xanthan gum 0.1
10. Carboxyvinyl polymer 0.2
11. Potassium hydroxide 0.2
12. [Manufacturing method] Ingredients 3 to 6 and components 1, 2 and 7 to 12 having a total amount of 100 in purified water are uniformly dissolved, and the two are mixed to obtain a product.

Prescription example 5 Bath agent Ingredient content (%)
1. 1. Ethanol extract of mandarin orange (Production Example 3) 1.0
2. 2. Sodium bicarbonate 50.0
3. 3. Yellow No. 202 (1) Appropriate amount 4. Appropriate amount of fragrance 5. [Manufacturing method] Ingredients 1 to 5 with sodium sulfate to make the total amount 100 are uniformly mixed to prepare a product.

Prescription Example 6 Tablet Ingredient content (%)
1. 1. 50% ethanol extract of mandarin orange (Production Example 2) 5.0
2. 2. Dried cornstarch 25.0
3. 3. Carboxymethyl cellulose calcium 20.0
4. Microcrystalline Cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Ingredients 1 to 4 are mixed, and then an aqueous solution of ingredient 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and locked. One tablet weighs 0.52 g.

Prescription example 7 Tablet confectionery ingredient content (%)
1. 1. Hot water extract of mandarin orange (Production Example 1) 2.0
2. 2. Ethanol extract of mandarin orange peel (Production Example 6) 2.0
3. 3. Dried cornstarch 47.8
4. Erythritol 40.0
5. Citric acid 5.0
6. Sucrose fatty acid ester 3.0
7. Fragrance 0.1
8. Purified water 0.1
[Manufacturing method] Ingredients 1 to 5 and 8 are mixed and granulated. Ingredients 6 and 7 are added to the molded granules and locked. One grain is 1.0 g.

Hereinafter, experimental examples will be given in order to functionally explain the present invention. The invention of the present application is not limited thereto.

Experimental Example 1 Cathepsin V activity promoting test The promoting action of cathepsin V enzyme activity was measured under the following conditions.

The enzymatic reaction of cathepsin V was 25 ng of human recombinant cathepsin V protein (R & D), 9 μM (final concentration) Z-Leu-Arg-7-amino-4-methylcomaline (R & D) as a substrate, and 10 μg / mL (final concentration). It was carried out under the condition of 37 ° C. in 110 μL of reaction buffer (25 mM Sodium Acate, 100 mM NaCl, 5 mM Dithiothreitol, pH 5.5) containing a sample such as a hot water extract (Production Example 4) of the citrus peel. The amount of the reaction product (7-amino-4-methylcoumarin) during the enzymatic reaction was measured with a fluorescent plate reader SpectraMax i3x (Molecular Device).

The test results are shown in Table 1. Cathepsin V enzyme activity was 137% and 125%, respectively, by adding hot water extract (Production Example 4) and Hechima extract of citrus peel at a concentration of 10 μg / mL, as compared to the control (not added). It was shown that these samples have an action of promoting the enzymatic activity of cathepsin V.

* Ratio to sample-free conditions

Experimental Example 2 Test for suppressing the production of GATA-3 in epithelial cells The inhibitory effect on the production of GATA-3 in keratinocytes, which are epithelial cells, was measured under the following conditions.

HaCaT cells, a human epidermal keratinocyte line, were used. Dulbecco's modified Eagle's medium (SIGMA-ALDRICH) containing 10% fetal bovine serum was used as the culture medium, and the medium was exchanged three times a week. One day after adding a sample such as a hot water extract of mandarin orange peel (Production Example 4) to semiconfluent HaCaT cells, RNA was isolated using RNAiso + (Takara Bio). For this RNA, cDNA was synthesized by reverse transcription reaction using High Capacity RNA to cDNA Kit (Thermo Fisher Scientific), and then PCR reaction was performed using SYBR Select Master Mix (Thermo Fisher Scientific) and GA reaction. The expression level of was measured. The PCR primers shown below were used. After initial denaturation at 95 ° C. for 2 minutes, 40 cycles of PCR reaction were performed with 95 ° C., 15 seconds, 60 ° C., and 60 seconds as one cycle. For other operations, the gene expression level was determined as a ratio to the expression level of the internal standard 18S rRNA according to a predetermined method, and the gene expression ratio to the control group was calculated.

Primer set for GATA-3 Forward CACATATTAACAGACCCTGACTATTGA (SEQ ID NO: 1)
Reverse CCGGGTTAAAACGAGCTGTTCT (SEQ ID NO: 2)
Primer set for 18S rRNA Forward GTAACCGTTGAACCCCATT (SEQ ID NO: 3)
Reverse CCATCCAAATCGGTAGTAGCG (SEQ ID NO: 4)

The test results are shown in Table 2. The expression level of GATA-3 was 82% and 81, respectively, by adding hot water extract (Production Example 4) or loofah extract of citrus peel at a concentration of 10 μg / mL, as compared with the control (not added). The decrease to% indicates that these samples have an effect of suppressing the production of GATA-3.

* Ratio to sample-free conditions

By using Prescription Examples 1 to 7, the number of keratin plugs was reduced, the clogging of pores was eliminated, the conspicuousness of body hair such as conspicuous pores and hair growth was improved, and the feeling of smooth skin was obtained.

According to the present invention, the use of a mandarin orange extract and / or a loofah extract promotes the enzymatic activity of cathepsin V and suppresses the production of GATA-3, thereby improving the conspicuity of pores, removing keratin plugs, and suppressing hair. The agent can be provided.

Claims (5)

A cathepsin V activator comprising a mandarin orange extract and / or a loofah extract. A GATA-3 production inhibitor, which comprises a mandarin orange extract and / or a loofah extract. A keratin plug remover comprising a mandarin orange extract and / or a loofah extract. An agent for improving the appearance of pores, which comprises a mandarin orange extract and / or a loofah extract. A hair suppressant comprising a mandarin orange extract and / or a loofah extract.