JP2018188446A - A hyaluronic acid synthesis promoter - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a formulation that promotes production of hyaluronic acid, maintains texture of a skin surface, supports three-dimensional structure of a skin surface to keep firmness or luster of skin, prevents reduction of water-holding capacity of skin associated with aging, and furthermore, is effective for treating rheumatic arthritis, suppurative arthritis or gouty arthritis, initial period of scald.SOLUTION: A hyaluronic acid synthesis promoter has one or more kinds of extract selected from an extract of Malva sylvestris, an extract of leaves of Hydrangea serrata, an extract of Gardenia fruit, and an extract of genus Urtica plant as an active ingredient.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a preparation that promotes the production of hyaluronic acid and keeps the skin healthy.

Hyaluronic acid is a polymer with a structure in which disaccharide units of N-acetylglucosamine and glucuronic acid are linked. It is widely distributed in skin cells and is deeply involved in skin moisture retention and viscoelasticity. It is one of the important components of the skin that maintains the three-dimensional structure of the skin surface and keeps the skin firm and shiny.
Since hyaluronic acid is a high molecular compound, it is difficult to supply it to the epidermis from the outside of the skin, and since it is produced by hyaluronic acid synthase from a low-molecular raw material in vivo, hyaluronic acid is produced between epidermal cells. Expression of hyaluronic acid synthase is important to supply
Promote the expression of hyaluronic acid synthase 3 (HAS3), which is involved in promoting hyaluronic acid synthesis in the epidermis, to adjust the texture of the skin surface, support the three-dimensional structure of the skin surface, and keep the skin firm and glossy Is possible.

In addition, it has been reported that this hyaluronic acid decreases with aging, which causes a decrease in the water retention capacity of the skin with aging, and is thought to cause dry skin and the like. In patients with rheumatoid arthritis, hyaluronic acid in the joint has been shown to decrease.
In addition to rheumatoid arthritis, purulent arthritis and ventilated arthritis are known to cause a decrease in hyaluronic acid content, as in rheumatoid arthritis. (Non-patent documents 1 to 3)
It can also be used as an early treatment for burns. (Non-Patent Document 4)
As a treatment method for arthritis, for example, hyaluronic acid is injected into the affected area, but treatment is required at the hospital for medical treatment, and the improvement effect decreases with the metabolism of hyaluronic acid. Because of the high cost, it is a lot of mental and physical burden on the patient. (Non-Patent Document 5)

  Known compounds that promote the expression of hyaluronic acid synthase include phosphate derivatives and N-acetyl-D-glucosamine-containing sugar benzyl derivatives. (Patent Documents 1 and 2)

Usbenea mallow (scientific name: Malva sylvestris, or Malva mauritiana L.) is a perennial plant belonging to the genus Mallow, and is also called a mallow.
Young leaves and flowers can be used as salads and herbal teas, and leaves and roots can be boiled and used as vegetables. As a folk medicine, it is said to be effective against cough and gastritis.
In addition, uses such as moisturizing cosmetics, anti-androgenic agents, bFGF mRNA expression increase inhibitors, Maillard reaction inhibitors, and Maillard reaction inhibitors are known (see Patent Documents 3 to 6), and are extracted as raw materials for cosmetics. Things are commercially available.

Achacha (scientific name Hydrangea macrophylla var. Thunbergii) is a variant of the deciduous shrub Gaku hydrangea of the family Chironomidae.
The young leaves are steamed, sautéed and decocted, and are widely consumed.
It is also known as an antiallergic agent, melanin uptake inhibitor, lipase activity activator, slimming skin external preparation, and ceramide production promoter. (Patent Documents 7 to 10)

Gardenia (Gardenia jasminoides) is an evergreen shrub belonging to the genus Acanthaceae. The fruit is called Yamakiko or Yuzu and is used as a herbal medicine as anti-inflammatory, hemostatic, antipyretic and sedative.
Applications of ceramide production promoters, matrix metalloprotease inhibitors, hair quality improvers, trypsin inhibitors and the like are also known. (Patent Documents 11 to 14)

Nettle (Urtica thunbergiana) and nettle (Urtica dioica) are well known and are used for food and bathing, but are also used for pain.
In Europe, it is used as a medicinal herb and has a blood glucose lowering effect, and it is widely used as a health tea for diabetes.
Further, there are known uses such as suppression of melanin uptake, SCF mRNA expression promoter, type IV collagen production promotion, claudin production promotion agent, occludin production promotion, and ceramide synthesis promotion. (Patent Documents 15 to 19)

JP 2002-363081 A JP 2004-51579 A JP 60-258104 A JP 05-070360 A JP 2011-001328 A JP 2012-067061 A Japanese Patent Laid-Open No. 06-135844 JP 2011-105644 A JP 2002-356434 A JP 2002-370998 A JP 2000-169359 A JP 2000-319155 A JP 2001-270811 A JP 2006-182732 A JP 2011-1056447 A JP 2011-074022 A JP 2009-298723 A JP 2009-256244 A JP 2009-107965 A Longas MO et al. Carbohydr Res. 159 (1) 127-36 1987 “Arhritis Rheumatism”, 1967, Vol. 10, p357. "Connective tissue", 1984, Kanehara Publishing, p481 "Connective tissue and diseases", Kodansha, 153, 1980 "Inflammation", 1991, Vol. 11, p16

  The purpose of the present invention is to promote the production of hyaluronic acid, to adjust the texture of the skin surface, to support the three-dimensional structure of the skin surface, to keep the skin firm and glossy, to prevent a decrease in the water retention capacity of the skin due to aging, Is to obtain an effective drug for the early treatment of rheumatoid arthritis, purulent arthritis and ventilated arthritis, burns.

As a result of intensive studies by the present inventors, it has been found that the extract of the common carp, the extract of the leaf of the achacha, the extract of the fruit of the gardenia, the extract of the plant of the genus Nettle reach the above purpose.
The extract of the common mushroom, the extract of the leaf of the armchair, the extract of the fruit of the gardenia, and the extract of the nettle plant which are used here will be described.
After extraction, the extract of Usbunia mushroom extract, the extract of the leaf of the armature, the extract of the fruit of the gardenia, the extract of the plant of the genus Nettle are subjected to processing such as shredding, drying and crushing in consideration of the extraction efficiency. Extraction is preferably performed.
Drying may be performed in the sun or using a commonly used dryer.
As the solvent used for the extraction, water, a hydrophilic organic solvent, or a mixture thereof is used.
Examples of water that can be used as the extraction solvent include pure water, tap water, well water, mineral spring water, mineral water, hot spring water, spring water, fresh water, and the like, as well as water that has been subjected to various treatments. Examples of the treatment applied to water include purification, heating, sterilization, filtration, ion exchange, adjustment of osmotic pressure, buffering, and the like. Therefore, the water that can be used as the extraction solvent in the present invention includes purified water, hot water, ion-exchanged water, physiological saline, phosphate buffer, phosphate buffered saline, and the like.
Examples of the hydrophilic organic solvent include lower alcohols having 1 to 5 carbon atoms such as methanol, ethanol, propyl alcohol, and isopropyl alcohol; lower aliphatic ketones such as acetone and methyl ethyl ketone; 1,3-butylene glycol, propylene glycol, Examples thereof include polyhydric alcohols having 2 to 5 carbon atoms such as glycerin, and a mixed solvent of these hydrophilic organic solvents and water can be used.
In addition, when using the mixed solvent of the said water and a hydrophilic organic solvent, in the case of a lower alcohol, it is 1-20 mass parts with respect to 10 mass parts of water, and in the case of a lower aliphatic ketone, it is 10 mass parts of water. On the other hand, it is preferable to add 1 to 15 parts by mass. In the case of a polyhydric alcohol, it is preferable to add 1 to 20 parts by mass with respect to 10 parts by mass of water.
The amount of the organic solvent used for extraction is preferably about 5 to 100 times, more preferably about 10 to 50 times the amount of the plant as a raw material. Furthermore, in order to raise extraction efficiency, you may stir or homogenize in an extraction solvent. The extraction temperature is suitably about 5 ° C. to the boiling point of the extraction solvent. The extraction time varies depending on the type of extraction solvent and the extraction temperature, but it is appropriate to set it to about 1 hour to 14 days.
The extraction operation is not limited to a single operation. A fresh solvent can be added again to the residue after extraction to perform an extraction operation, or the extraction solvent can be brought into contact with the extraction raw material a plurality of times.
If necessary, purification treatment such as deodorization and decolorization may be further added within a range that does not affect the effect, and concentration can be performed by a vacuum concentrator such as an evaporator or solvent removal by heating.
Further, this extract can be further purified using a synthetic adsorbent (Diaion HP20, Sephabies SP825, Amberlite XAD4, MCIgelCHP20P, etc.), dextran resin (Sephadex LH-20, etc.), ultrafiltration and the like. is there.

  The preparation of the present invention exhibits drug efficacy for oral, injection, and external use, but is preferably used as a skin external preparation. Skin external preparations include skin cosmetics, external quasi-drugs, and medical skin external preparations.

  In addition to the above ingredients, the preparations of the present invention include surfactants, oily ingredients, moisturizers, polymer compounds, ultraviolet absorbers, anti-inflammatory agents, bactericides, and other agents used in various pharmaceutical and cosmetic preparations. Antioxidants, sequestering agents, preservatives, vitamins, pigments, fragrances, water and the like can be blended.

  As the surfactant, any of anionic, cationic, nonionic, natural, and synthetic surfactants can be used, but it is preferable to use a nonionic surfactant in consideration of irritation to the skin. Examples of the nonionic surfactant include glycerin fatty acid ester, propylene glycol fatty acid ester, sorbitan fatty acid ester, polyoxyethylene sorbitan fatty acid ester, polyoxyethylene sorbite fatty acid ester, polyoxyethylene alkyl ether, polyoxyethylene polyoxypropylene glycol. , Polyoxyethylene polyoxypropylene alkyl ether, polyethylene glycol fatty acid ester, polyoxyethylene castor oil, polyoxyethylene hydrogenated castor oil, alkylglycoside and the like.

  Examples of the oil component include fats and oils, waxes, hydrocarbons, higher fatty acids, higher alcohols, esters, essential oils, silicone oils, and the like. Examples of the fats and oils include soybean oil, nutka oil, jojoba oil, avocado oil, almond oil, olive oil, cacao oil, sesame oil, persic oil, castor oil, coconut oil, mink oil, beef fat, pork fat and the like, and these Hardened oil obtained by hydrogenation of natural fats and oils and synthetic triglycerides such as myristic acid glyceride and 2-ethylhexanoic acid triglyceride; waxes include, for example, carnauba wax, whale wax, beeswax, lanolin and the like; hydrocarbons For example, liquid paraffin, petrolatum, paraffin microcrystalline wax, ceresin, squalane, bristan etc .; higher fatty acids include, for example, lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, oleic acid, linoleic acid, Linolenic acid, lanolinic acid, isostearic acid, etc .; Examples of the class alcohols include lauryl alcohol, cetyl alcohol, stearyl alcohol, oleyl alcohol, lanolin alcohol, cholesterol, 2-hexyldecanol, etc .; examples of the esters include cetyl octanoate, triglyceride octanoate, myristyl lactate, cetyl lactate, Examples of essential oils include mint oil, jasmine, isopropyl myristate, myristyl myristate, octyldodecyl myristate, isopropyl palmitate, isopropyl adipate, butyl stearate, decyl oleate, cholesterol isostearate, POE sorbite fatty acid ester, etc. Oil, pepper brain oil, cypress oil, spruce oil, ryu oil, turpentine oil, cinnamon oil, bergamot oil, mandarin oil, ginger oil, pine , Lavender oil, bay oil, clove oil, hiba oil, rose oil, eucalyptus oil, lemon oil, thyme oil, peppermint oil, rose oil, sage oil, menthol, cineole, eugenol, citral, citronellal, borneol, linalool, geraniol, Camphor, thymol, spirantol, pinene, limonene, terpene compounds, etc .; examples of silicone oils include dimethylpolysiloxane. These oily components described above can be used alone or in combination of two or more. In the present invention, among these, myristic acid glyceride, 2-ethylhexanoic acid triglyceride, lanolin, liquid paraffin, petrolatum, paraffin microcrystalline wax, squalane, lauric acid, myristic acid, palmitic acid, linoleic acid, linolenic acid, isostearic acid , Cetyl alcohol, stearyl alcohol, oleyl alcohol, cholesterol, cetyl octanoate, triglyceride octanoate, isopropyl myristate, octyldodecyl myristate, cholesterol isostearate, POE sorbite fatty acid ester, peppermint oil, spruce oil, cinnamon oil, rose Oil, menthol, cineol, eugenol, citral, citronellal, geraniol, pinene, limonene, dimethylpolysiloxane It is preferable to use.

The following components can be further added to the preparation of the present invention, but the components are not limited thereto.
Colors: Yellow color No. 4, Blue No. 1 and Yellow No. 202 are recognized as food additives such as tar color dyes I and II, chlorophyll, riboflavin, crocin, safflower, anthraquinone, etc. Natural pigments.
Vitamins; vitamin A, vitamin C, vitamin D, vitamin E, etc.
Others: bactericides, preservatives, other ingredients necessary for formulation.

The preparation of the present invention can be produced according to a conventional method by adding the optional components to the essential components as necessary.
The amount of these extracts in the preparation is 0.000001 to 10.0% by weight, preferably 0.00001 to 3.0% by weight, more preferably 0.00005 to 1.0% by weight, as a solid content. is there.

EXAMPLES Next, although an Example is given and this invention is demonstrated in detail, it is not limited to this.

Example 1 (Usvenia mallow extract)
2 liters of a 30% (V / V) ethanol aqueous solution was added to 10 g of Usvenia oysters (part = flower, Romanian product, dried product) and extracted for 5 days while stirring.
This was evaporated and then lyophilized.

Example 2
Add 2 liters of 50% (V / V) ethanol aqueous solution to 50 g of amacha leaves (dried product, shredded product), extract for 24 hours with occasional stirring, filter (No5C), and evaporate. Lyophilized.

Example 3
Add 2 liters of 50% (V / V) aqueous ethanol solution to 50 g of gardenia fruit (dried product, shredded product), extract with stirring for 24 hours, filter (No5C) and evaporate it. Lyophilized.

Example 4
Add 1 liter of 50% (V / V) aqueous ethanol solution to 50 g of Urtica dioica leaves (dried product, shredded product), extract for 24 hours with occasional stirring, filter (No5C), and evaporate After that, this was freeze-dried.

Confirmation test HuMedia- cultivated human foreskin-derived epidermis cells (Kurabo) in the 2nd passage in HuMedia-KG2 medium (without phenol red) so as to be 50-70% confluent, and the calcium concentration was changed to 1.8 mM the day before. Examples were added to KG2 medium and cultured in a 37 ° C., 5% CO 2 incubator for 2 days.

<Extraction of RNA>
Total RNA was extracted from the cells after peeling with trypsin / EDTA and using SV Total RNA Isolation System (Promega) according to the manual attached to Promega (prepared in Japanese protocol NoTM048J, June 2001). The RNA concentration was calculated using NanoDrop1000 (Thermo SCIENTIFIC).

<RT reaction and real-time PCR>
Using 2.5 μg of total RNA, RT reaction was performed according to Toyobo recommended protocol (TOYOBO BIOCHEMICALS FOR LIFE SCIENCE 2008/2009, page 1-42) using MMLV Reverse Transcriptase RNase H- (Toyobo).
Real-time PCR was performed as follows using Applied Biosystems 7500 Real-Time PCR System. Using the SYBR Green method (THUNDERBIRD SYBR qPCR Mix, Toyobo Co., Ltd.) and the 7500 Real-Time PCR System operation manual (Applied Biosystems), gene expression comparison was performed by the Comparative CT (ΔΔCT) method (n = 3). GAPDH was used as an internal standard.

<Primer used>
HAS3: set of the base sequence of TGTTTTCCCTCTCGCTGCTTT (SEQ ID NO: 1) as the forward primer and the base sequence of TGCTGTCCCACTTAGGTGCTG (SEQ ID NO: 2) as the reverse primer GAPDH: the base sequence of GAGTCAACGGATTTGGTTCGT (SEQ ID NO: 3) as the reverse primer Set with the base sequence of TTGATTTTGGAGGGATCTCG (SEQ ID NO: 4)

The result of the confirmation test is shown in FIG.
It was found that all of Examples 1 to 4 significantly promote the expression level of the HAS3 gene compared to the control.

Moreover, the external preparation which mix | blended the Example was created, and as a result of actually using it, as a result of promoting hyaluronic acid synthesis, it turned out that the firmness of the skin increases and wrinkles decrease.
It was also effective for rheumatoid arthritis, suppurative arthritis and ventilated arthritis.

Example 1 (working concentration 0.2%), Example 2 (working concentration 0.05%), Example 3 (working concentration 0.1%), and Example 4 (working concentration 0.1%) are 2 to 3 times the HAS3 compared to the control. The expression level of the gene increased.

Claims (1)

  A hyaluronic acid synthesis promoter containing, as an active ingredient, one or more extracts selected from an extract of Ussobian mallow, an extract of achacha leaves, an extract of gardenia fruit, and an extract of plants belonging to the genus Nettle.