HUT75840A - Expression of n-terminally extended proteins in yeast - Google Patents

Description

The present invention relates to polypeptides expressed and processed in yeast, to a DNA construct comprising a DNA sequence encoding such polypeptides, to vectors carrying such DNA fragments and to yeast cells transformed with vectors, and to a process for the production of heterologous proteins in yeast.

···· ··················································································································································· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ···

Yeasts express many proteins that are synthesized intracellularly but function outside the cell. Such extracellular proteins are called secreted proteins. These secreted proteins are first synthesized in the cell in the form of a precursor or pre-protein, and contain a pre-sequence that ensures efficient redirection of the expressed product through the endoplasmic reticulum (ER) membrane. The pre-sequence, also commonly referred to as the signal sequence, is usually cleaved from the desired product during translocation. Once you have entered the secretory biosynthetic pathway, the protein is transported to the Golgi apparatus. From the Golgi apparatus, the protein can follow different pathways that can lead to different compartments of the cell, such as the cell vacuole or cell membrane, but can also be directed outside the cell to be secreted into the surrounding media [Pfeffer, S.R. and Rothman, J.E., Annu. Port. Biochem. 65: 829-852 (1987)].

Numerous approaches have been proposed for the expression and secretion of heterologous proteins in yeast. European Patent Publication No. 0088632 describes a method by which proteins that are heterologous to yeast are expressed, processed, and secreted by transforming the yeast cell with an expression carrier that encodes the desired protein and a signal peptide. carrier, culturing the transformed cell, propagating the culture and recovering the protein from the culture medium. The signal peptide may be the signal peptide of the desired protein itself, it may be a heterologous signal peptide, or a hybrid of the natural and heterologous signal peptide.

The use of signal peptides foreign to yeast can cause problems that the heterologous signal peptide does not provide efficient translocation and / or cleavage of the signal peptide.

Saccharomyces cerevisiae MFal (a-factor) is synthesized in a 165-amino acid prepro form containing a 19 amino acid signal or pre-peptide, followed by a 64 amino acid leader or pro-peptide that encases three N-linked glycosylation sites, followed by the sequence (LysArg ((Asp / Glu) Ala) _{2 - 3} α-factor) ₄ [Kurjan, J. and

Herskovitz, I., Cell 30: 933-943 (1982)]. The pre-pro-MFα1 signal peptide moiety is widely used for the synthesis and secretion of heterologous proteins in Saccharomyces cerevisiae.

The use of signal / leader peptides homologous in yeast has been described in several publications: U.S. Patent 4,546,082, European Patent Applications 116,201, 123,294, 123,544, 163,529 and 123,289, and U.S. Patent Nos. 3614/83. DK Announcement.

EP 00123 289 describes the use of a precursor for the α-factor of Saccharomyces cerevisíae.

100561 describes the use of the signal peptide Saccharomyces cerevisíae PHO5, and WO 95/02059 describes the use of the signal peptide YAP3 for the secretion of foreign proteins.

U.S. Patent Application 4,546,082, EP 0016201A, 0123544A and 0163529A describe methods for

Saccharomyces cerevisiae α-factor signaling sequence (MFα1 or MFα2) is used in the secretion processes of expressed heterologous proteins in yeast. By fusing the DNA sequence encoding the Saccharomyces cerevisiae MFalI signal / leader sequence to the 5 'end of the gene encoding the desired protein, secretion and processing of the desired protein was detected.

EP 206 783 describes a system for secretion from Saccharomyces cerevisiae using an α-factor sequence that has been truncated to eliminate the four α-factor units in the natural leader sequence, thereby fusing only the leader sequence with a via a-factor processing site. This construct is described as providing efficient processing of smaller proteins (less than 50 amino acids). For secretion and processing of larger polypeptides, the natural α-factor leader sequence has been truncated to leave only one or two afactor units between the leader peptide and the polypeptide.

Many secreted proteins proceed to contact with the proteolytic processing system, which is capable of cleaving peptide bonds at the C-terminus of two consecutive basic amino acids. This enzyme activity in Saccharomyces cerevisiae is encoded by the KEX 2 gene [Julius, D.A. et al., Cell 37, 1075 (1984b)]. Processing of the KEX 2 protease product is required for secretion of the active Saccharomyces cerevisiae mating factor al (MFα1 or α-factor), whereas KEX 2 does not play a role in secretion of the active Saccharomyces cerevisiae mating factor.

In some cases, the secretion and proper processing of a polypeptide for secretion is achieved by culturing a yeast cell transformed with a vector prepared according to the above references. In many cases, however, the secretion level is very low, with no secretion at all, or the proteolytic processing is incorrect or incomplete. As described in PCT Publication No. WO 90/10075, this is to some extent accounted for by the fact that the processing site between the C-terminus of the leader peptide and the N-terminus of the heterologous protein is exposed efficiently, and consequently that the proteolytic cleavage not available or less accessible.

WO 90/10075 describes a yeast expression system that is more efficient in processing a heterologous polypeptide and which has been obtained by making certain modifications to the processing site near the C-terminus of the leader peptide and / or N-terminus of a heterologous polypeptide fused to the leader peptide. near. Thus, it is possible that the properly processed protein will be obtained in higher yields than that obtained with unmodified leader peptide heterologous polypeptide constructs.

The present invention relates to modifications of the N-terminus of a heterologous polypeptide designed in the form of extensions that can be cleaved either by natural yeast proteases before purification from the culture medium or by in vitro proteolysis during or after purification of the product from the culture medium.

The present invention relates to DNA constructs encoding a polypeptide having the following structure: signal peptide leader peptide x ¹ '-X ² -X ³ -X ⁴ -X ⁵ -X ⁶ -x ⁷ -heterologous protein in which

X ¹ is Lys or Arg;

X is Lys or Arg, and x and X together define a lost processing site;

X ³ is Glu or Asp;

X ⁴ represents an amino acid sequence having the following structure:

(AB) _{n in} which

A is Glu or Asp,

B is Ala, Val, Leu or Pro and n is an integer of 0 or 1 to 5, and if n> 2, A and B are the same amino acid or the other of A (k) and B (k) or X is an amino acid sequence having the following structure:

in which ···· ···· " ······ • · · · ·

C is Glu or Asp and m is 0 or an integer from 1 to 5 X ⁵ is a peptide bond or one or more amino acids which may be the same or different;

X ° represents a peptide bond or an amino acid residue selected from the group consisting of Pro, Asp, Thr, Glu, Al and

Gly;

X ⁷ is Lys or Arg.

As used herein, the term signal peptide means a pre-sequence which is predominantly hydrophobic and is present in the form of the N-terminal sequence of a precursor form of an extracellular protein expressed in yeast. The function of the signal peptide is to allow the expressed protein to be secreted and to enter the endoplasmic reticulum. The signal peptide is usually cleaved during the process. The signal peptide may be heterologous or homologous to the yeast cell producing the protein, but a more efficient cleavage of the signal peptide can be achieved if it is homologous to the yeast cell in question.

The term leader peptide refers to a predominantly hydrophilic polypeptide which has the function of allowing the heterologous protein from the endoplasmic reticulum to

It should be secreted into the Golgi apparatus and transported from there to the secretory vesicles for secretion into the culture medium (i.e., delivery of the expressed protein or polypeptide through the cell wall, or at least through the cell membrane, into the periplasmic space of the cell).

A heterologous protein is a polypeptide or protein that is not naturally produced in a yeast cell.

X ³ to X ⁴ -X ^J to X ° -X together form an extension of the N-terminus of the heterologous polypeptide. This extension not only enhances the fermentation level but is also protected against dipeptidyl aminopeptidase (DPAP A) processing due to the presence of X ³ and results in a homogeneous N-terminus of the peptide. The extension may be prepared by cleavage by natural yeast proteases other than DPAP, such as yeast asparagine protease 3 (YAP3) prior to purification of the heterologous protein product from the culture medium. Alternatively, the extension may be prepared so that during fermentation it is resistant to proteolytic cleavage and the N-terminally extended protein can be purified from the medium for subsequent in vitro maturation such as trypsin, Achromobacter lyticus protease I or enterokinase.

The present invention further provides a method of producing a heterologous polypeptide in yeast, comprising culturing a transformed yeast cell in an appropriate medium to obtain expression and secretion of the heterologous protein and recovering the protein from the medium.

In the (AB) _n protein structure, n is preferably 2-4, more preferably 3.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · business · being ·

Preferred polypeptides of the invention X may be Glu, A represents Glu léjét alternatively Ala, B is, ^X5 may be a peptide bond or Glu, or Glu Pro Lys Ala, or X ° is alternatively Pro or a peptide bond.

The following examples of possible N-terminal extensions of X ^J -X ⁴ -X ⁵ -X ^b -X ⁷ are given below:

Glu Glu Alá Glu Alá Glu (Pro / Ala) (Glu / Lys) (Ala / Glu / Lys / Thr) Arg Alá Pro Arg,

Glu Glu below Glu below Glu Pro Lys below (Thr / Pro) Arg, Glu Glu below Glu below Glu below Glu Pro Arg, Glu Glu below Glu below Glu below Glu Pro Lys, Glu Glu below Glu below Glu below Glu Arg, Glu Glu below Glu below Glu below (Asp / Ala i / Gly / Glu) Lys, Glu Glu below Glu below Glu below (Pro / Let i / Ile / Thr) Lys, Glu Glu below Glu below Glu below Arg, Glu Glu below Glu below Glu (Glu / Asp / Gljy Area 7) Lys, Glu Glu below Glu below Pro Lys, Glu Glu below Pro Lys, asp asp below asp below asp below asp Pro Arg, Glu Glu Glu Glu Pro Lys, Glu Glu Glu Pro Lys, asp asp asp asp asp Lys and Glu Glu Pro Lys

The signal peptide sequence of the invention can be any signal peptide that provides efficient targeting of the expressed polypeptide to cellular secretion biosynthesis. The signal peptide may be a natural signal peptide, or a functional part thereof, or it may be a synthetic peptide.

Suitable signal peptides have been found to be the signal peptide of factor alpha, mouse salivary gland amylase, a modified carboxypeptidase signal peptide, the yeast BARI signal peptide, or the Humicola lanuginosa lipase signal peptide, or derivatives thereof. The mouse salivary gland amylase signal sequence has been described by Hagenbüchle et al., Hagenbüchle, 0, et al., Nature 289: 643-646 (1981). The signal sequence of the carboxypeptidase was reported by Valis et al. et al., Cell 48: 887-897 (1987). The BARI signal peptide is described in WO 87/0260. The signal peptide 3 of the yeast asparagine protease is described in PCT Publication No. WO 87/02670.

The leader peptide sequence of the polypeptide of the invention may be any leader peptide capable of directing the expressed polypeptide through the endoplasmic reticulum and further through secretory biosynthesis. Possible leader peptide sequences for this purpose are natural leader peptides from yeast or other organisms, such as the α-factor leader peptide or a functional analogue thereof. The leader peptide may be a synthetic leader peptide, such as one of the synthetic leader peptides described in PCT Publication Nos. WO 89/02463 or WO 92/11378.

The N-terminally extended heterologous protein produced by the method of the invention may be any protein which is preferably produced in yeast. Such ···· ···· ···

The proteins may be, for example, aprotinin, tissue factor biosynthesis inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, GLP-1, IGF- IGF-II, tissue plasminogen activator, factor VIII, factor VIII, factor XIII, platelet derived growth factor, enzymes or functional analogues thereof. In the context of the present invention, a functional analogue term is a protein that has similar functions to a natural protein (which is to be understood as being similar to the natural form rather than to the biological activity level of the natural protein). The protein may be structurally similar to the native protein, and by adding one or more amino acids or the C-terminal or the N-terminal end of the natural protein, or both, replacing one or more amino acids at one or more positions of the natural amino acid sequence. or deletion of several amino acids at one or both ends, or deletion of one or more amino acids in the sequence, or insertion of one or more amino acids at one or more points in the natural amino acid sequence. These modifications are well known to many of the proteins described above.

Examples of suitable insulin precursors and insulin analogs include the amino acid sequence B (1-29) AlaAlaLysA (1-21) (described in EP 163 529), B (1-27) -Asp-Lys-Ala-AlaLys -A (1-21) amino acid sequence (see, e.g., ···· ····

95/00550 in PCT Publication), the amino acid sequence B (1-29) -Ala-Ala-Arg-A (1-21) (described in PCT Publication 95/07931) and B (1-29) -Ser. -Asp-Asp-Ala-Arg-A (1-21) amino acid sequence.

The DNA construct of the invention encoding the polypeptide of the present invention may be prepared synthetically by known methods using automated DNA synthesizers (Applied Biosystems, Model 380A) using phosphoramidite chemistry and commercially available reagents [Beaucage, S.L. and Caruthers, M.H .: Tetrahedron Letters 22, 1859-1869 (1981); Matthes et al., 1984, EMBO Journal 3, 801-805. In the phosphoramidite method, oligonucleotides are synthesized, for example, by an automated DNA synthesizer, purified, duplexed, and ligated to create a synthetic DNA construct. A currently preferred method of constructing the DNA construct is polymerase chain reaction (PCR) [Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press, Cold Spring Harbor, N.Y.

(1989)].

The DNA construct of the invention may be genomic or cDNA derived, for example, by constructing a genomic or cDNA library by searching for the DNA sequence encoding the polypeptide of the present invention or a portion thereof by hybridization using synthetic oligonucleotide probes using standard techniques [Sambrook et al., Molecular Cloning. : A Laboratory Manual ·; Cold Spring Harbor Press, Cold Spring Harbor, NY (1989). In this case, a genomic or cDNA sequence encoding a signal peptide and a leader peptide ································· linked to a genomic or cDNA sequence encoding a heterologous protein, and then the DNA sequence. may be modified at a position corresponding to the amino acid sequence of the polypeptide X ² -XX ³ -X ⁴ -X ⁵ -X ^c -X ', for example, by inserting synthetic oligonucleotides encoding the desired amino acid sequence by homologous recombination using well known techniques.

Finally, the DNA construct can be a mixed synthetic and genomic, a mixed synthetic and a cDNA, or a mixed genomic and cDNA derived fragment by aligning the synthetic, genomic or cDNA derived fragments (as they correspond) to the various parts of the entire DNA construct, standard using techniques. Thus, it is conceivable that the DNA sequence encoding the heterologous protein may be of genomic or cDNA origin, while the sequence encoding the signal peptide and leader peptide and the N-terminal extension of X ¹ -X ² -X ³ -X ⁴ -X ⁵ -X ⁶ -X ⁷ a coding sequence may be synthetically generated.

The present invention further provides a recombinant expression vector capable of replication in yeast and carrying a DNA construct encoding the polypeptide described above. The recombinant expression vector may be any vector capable of replication in yeast. The DNA sequence encoding the polypeptide of the invention in the vector is operably linked to a suitable promoter sequence. The promoter may be any DNA sequence that exhibits transcriptional activity in yeast and may be derived from genes encoding homologous or heterologous proteins in yeast. Preferably, the promoter is derived from a protein homologous to yeast. Suitable promoters include, for example, Saccharomyces cerevisiae MFal, TPI,

ADH or PGK promoter.

In addition, the DNA sequence encoding the polypeptide of the present invention is preferably functionally terminally

torhoz must to connect, ie for example the For TPI terminator [Alber, T and Kawasaki, G. : J. Mole. Appl. Genet. 1 419-434 (1982)] • THE present according to the invention recombinant expression vector

contains a DNA sequence that allows the vector to replicate in yeast. Such a sequence may be, for example, the replication gene and the origin of replication of the yeast 2 μ plasmid REP 1-3. The vector may also contain a selectable marker, such as the TPI gene of Schizoaccharomyces pombe (Russell, P.R. Gene 40 0: 125-130 (1985)).

Methods used to ligate the DNA sequences encoding the polypeptide of the invention, the promoter and terminator, and their incorporation into suitable yeast vectors containing the information required for yeast replication are well known to those skilled in the art [Sambrook et al., Molecular Cloning: Laboratory Manual; Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)]. It will be appreciated that the vector may be prepared either by first constructing a DNA construct comprising the entire DNA sequence encoding the polypeptide of the invention, and then inserting this fragment into a suitable expression vector, or sequentially inserting it. · · · · 9 · DNA · fragments of each element (e.g., promoter sequence, signal peptide, heterologous polypeptide) after ligation.

The yeast of the present invention may be any suitable yeast that produces a large amount of the desired polypeptide during cultivation. Suitable yeasts include, for example, a strain of Saccharomyces cerevisíae, Saccharomyces kluyveri, Schizoaccharomyces pombe or Saccharomyces uvarum. Transformation of yeast cells may be accomplished, for example, by protoplast formation followed by transformation known per se. The cell culture medium may be any conventional medium for the growth of yeast cells. The secreted polypeptide, most of which may be present in the medium in a properly processed form, may be recovered from the medium by conventional means, including separation of yeast cells from the medium by centrifugation or filtration, precipitation of proteinaceous material from the supernatant or filtrate, e.g. sulfate followed by purification by various chromatographic techniques such as ion exchange chromatography, affinity chromatography or the like.

After secretion into the culture medium, the protein can be subjected to a variety of procedures to remove the sequence X ³ -X ⁴ -X ⁵ -X ⁶ X '.

When X ⁶ is Pro, Thr, Ser, Gly, or Asp, then turned to the extensions shall be to stably attached to the heterologous protein during fermentation, and protect the heterologous • · ·· N-terminus of the protein of yeast proteases such as DPAP proteolytic activity. The presence of an N-terminal extension on the heterologous protein may also serve to protect the N-terminal amino group of the heterologous protein during chemical processing of the protein, i.e., as a substitute for BOC or cleavage protecting groups. In such cases, the amino acid sequence X ³ -X ⁴ -X ⁵ -X ^s -X ⁷ can be removed from the recovered heterologous protein by a proteolytic enzyme specific for a basic amino acid (such as Lys or Arg), thereby cleaving the terminal moiety X ⁷ than. Examples of such proteolytic enzymes are trypsin, Achromobacter lyticus protease I, enterokinase, trypsin-like protein of Fusarium oxysporum, and yeast asparagine protease 3 (YAP3) from Saccharomyces cerevisiae.

YAP3 has been characterized by various prohormones and expression of heterologous proteins in Saccharomyces cerevisiae [Niamh, X.C. et al., 1993, FEBS Letters 232, 273-276; Bourbonnais, Y., et al. (1993) EMBO Journal 12: 285-294; Egel-Mitani, M. et al. (1990) YEAST 6: 127-137.

YAP3 is produced during high-volume fermentation of Saccharomyces cerevisiae. It is active when the pH is between 3 and 6. The appearance of YEP3 is most pronounced when minimal media is used. In such media, the cells are starved for glucose and / or nitrogen, but other growth-limiting conditions may also be employed. YEP3 needs a specific motif next to the cleavage site. Such a motif is present at the N-terminal extension if the amino acid immediately before X ^{7 is} Al or Glu (but not if X ⁶ is Pro, Thr, Ser, Gly or Asp).

Thus, if X ° is a peptide bond (and the amino acid Ala or Glu preceding the X '), the extensions may need to be cleaved from the heterologous protein during fermentation, most likely following its secretion from the yeast cell, which depends on YEP3 acting on its substrate (peptide binding after lysine or arginine) in yeast cells or culture medium. YAP3 in, linked to, or escaped from, yeast cells can selectively cleave extensions, thereby purifying the non-extended product from the propagation medium.

X ³ -X ⁴ -X ⁵ -X ⁶ -X ⁷ amino acid sequence, wherein X ⁶ is Glu or Ala, or a peptide bond (and the amino acid preceding ^X7 is Ala or Glu eth) can be removed from the heterologous protein in the medium, a process which consists in exposing yeast cells to stress to release YAP3 into the medium and consequently cleave the amino acid sequence X ³ -X ' ¹ -X ⁵ -X ⁶ -X ⁷ .

The stress effect to which the yeast cell is subjected may be by lowering the pH of the culture medium to below 6.0, preferably below pH 5, or starving the yeast cell to glucose and nitrogen.

In the method of producing the heterologous protein of the invention, the yeast cell is further transformed with one or more genes encoding proteases that are specific for the protease. · · · ·· · basic amino acids such that by culturing the cell, the gene or genes are expressed and, due to protease production, provide a more complete cleavage of X ³ -X ^{7 from} the heterologous polypeptide.

In a preferred embodiment, one or more YAP3 may be used a gene coding for transforming yeast cell, such that the cell culturing overproduce the gene or genes overexpressed as a consequence of YAP3 ensuring X ³ -X ⁷ complete cleavage of the heterologous polypeptide.

As used in the present context, the term yeast asparagine protease 3 (YAP3) refers to the natural enzyme YAP3 as well as to enzymes derived from the natural enzyme whose C-terminus has been modified to ensure efficient release of the YAP3 protein from the cell or where any modification has occurred. which retains its proteolytic activity.

Other proteases may be A.lyticus protease I, enterokinase or trypsin.

The present invention is illustrated in more detail by the following examples, which, however, are not intended to limit the scope of the invention in any way.

The invention is further illustrated in the accompanying drawings.

These are briefly described below.

Figure 1 shows a general scheme for the construction of plasmids containing extended polypeptides at their N-terminus.

The following symbols are used in Figure 1:

1: Indicates the promoter sequence of the TPI gene from Saccharomyces cerevisiae.

2: Indicates the signal / leader peptide coding region (e.g., the? -Factor gene from Saccharomyces cerevisiae).

3: Indicates the region encoding the heterologous polypeptide.

3 *: Indicates the coding region for the extended heterologous polypeptide on the N-terminus.

4: Indicates the TPI terminator sequence of Saccharomyces cerevísiae.

Eg: Labels a synthetic oligonucleotide PCR primer that defines the structure of the N-terminal extension.

P2: Indicates a universal PCR primer for amplifying region 3.

REPLACEMENT: Indicates the TPI gene of Schizoaccharomyces pombe.

2μ Guard: Denotes a sequence from a plasmid 2μ-οε of Saccharomyces cerevísiae that contains the origin of DNA replication in Saccharomyces cerevisiae.

Ap ^R : A sequence from pBR322 / pUC13 containing the ampicillin resistance gene and an origin of replication in Escherichia cci.

Figure 2 shows the DNA sequence in pJB59 encoding the N-terminal amino acid sequence of insulin precursor B _chain (1-27) -Asp-Lys-Ala-Ala-Lys-A _chain (1-21). fused to the 85-membered group, which forms the α-factor signal / leader peptide in which Leu at position 82 and the 8320 »··························································································

-36Aia encodes the Asp at the N-terminus of the YAP3 / S1 _peptide at position As and Met.

Figure 3 shows the DNA sequence of pAK623 fused to the GLP1 synthetic signal / leader sequence.

Figure 4 shows the DNA sequence of pKV142 encoding the ^B _chain (1-29) -Ala-Ala-Arg-A _chain (1-21) fused N-terminally to the 85-membered moiety which is the afactor. is a signal / leader peptide in which Leu at position 82 and Asp at position 83 are replaced by the amino acid Met and Ala.

See the DNA sequence of pAK679 5 illusion that dioxalan _C ^B (1-29) -Ala-Ala-Lys-A _chain is encoded by (1-21), N-terminally fused to the YAP3 / LA19 synthetic signal / leader sequence.

Figure 6 is an HPLC chromatogram of culture supernatants containing the B _chain (1-27) -Asp-Lys-Ala-Ala-LysAl _chain d-21) insulin precursor, with or without N-terminal extension; and N-terminal extension without in vivo or in vitro processing.

Figure 7 shows the products of Figure 4, segregated on a 10% Tricin-SDS-PAGE gel.

Figure 8 shows the effect of co-expression of YAP3 on production derived from HPLC data comparing pJB176 to pJBo4.

Examples • ·

Each expression plasmid is of the C-POT type. These plasmids are described in WO EP 171,142 and are characterized by the presence of the triose phosphate isomerase (POT) gene of Schizoaccharomyces pombe for selectivity and stability of the plasmid in Saccharomyces cerevisiae. The plasmids also contain the Saccharomyces cerevisiae triose phosphate isomerase promoter (region 1 in Figure 1) and the terminator (region 4 in Figure 1). These sequences are identical to the corresponding sequences in pKFN1003 (see WO 90/100075), as with all sequences, the difference is the sequence of the EcoRI-XbaI fragment encoding the signal peptide / leader peptide / product sequence (2 and 3). region in Figure 1). In order to express other heterologous proteins, the EcoRI-XbaI fragment of pKFN1003 simply needs to be replaced by a signal / leader / product sequence of interest. Such Eco RI-Xba I fragments can be synthesized using synthetic oligonucleotides and PCR using standard techniques [Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring

Harbor Press, Cold Spring Harbor, N.Y. (1989)].

Figure 1 is a general diagram of the construction of plasmids containing genes expressing the extended polypeptides at their N-terminus, the scheme comprising the steps below.

A sample of the C-POT vector was digested with EcoRV and XbaI and the largest DNA fragment was isolated using standard molecular techniques [Sambrook et al., Molecular Cloning: A Laboratory

Manual; Cold Spring Harbor Press, Cold Spring Harbor, N.Y.

(1989)]].

• Another sample (identical or different from the plasmid mentioned above) of C-POT plasmid was digested with EcoRV and NcoI restriction endonucleases, and the fragment containing regions 1 and 2 was isolated.

Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR Reagent Kit (Perkin Elmer, 761 Main Avewalk, CT 06859, USA) according to the manufacturer's instructions using P1 and P2 synthetic oligonucleotide primers on a template (which may be the same or different). from the aforementioned plasmids) encoding a heterologous polypeptide of interest to us. Pi was designed to contain a recognition site for the NcoI restriction endonuclease (5 'CCATGG 3'), followed by the KEX2 processing site coding sequences, the N-terminal extension, and 10-15 nucleotides identical to that sequence. which encodes the original N-terminus of the heterologous protein of interest to us. P2 (e.g., 5 'AATTTATTTTACATAACACTAG-3') was designed to amplify region 3 and the flanking recognition site for Xba I (5 '-TCTAGA-3') in P1 polymerase chain reactions. , using standard techniques [Sambrook et al., Molecular Cloning: A ········· · * · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Laboratory Manual; Cold Spring Harbor Press, Cold Spring

Harbor, N.Y. (1989)].

• The PCR product was digested with restriction endonucleases NcoI and XbaI and the digested fragment was isolated.

Isolated fragments were ligated with T4 DNA ligase under standard conditions [Sambrook et al., Molecular Cloning:

A Laboratory Manual; Cold Spring Harbor Press, Cold Spring

Harbor, N.Y. (1989)].

The ligation mixture was used to transform competent Escherichia coli ap ^r cells and selected for ampicillin resistant colonies [Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press, Cold Spring Harbor, NY (1989).

Plasmids were isolated from the resulting Escherichia coli colonies using standard molecular biological techniques [Sambrook et al., Molecular Cloning: A

Laboratory Manual; Cold Spring Harbor Press, Cold Spring

Harbor, N.Y. (1989)].

• DNA sequencing is performed by enzymatic chain termination (Sequenase, United States Biochemicals), according to the manufacturer's instructions, to confirm (or determine) that the DNA sequences encode the N-terminal extended polypeptide and to ensure that it is within the reading frame. Region 2 with the DNA sequence encoding the signal / leader peptide sequence.

··· · · «• The yeast strain MT63 was transformed with the plasmid and selected for growth on glucose as follows:

Yeast transformation: Saccharomyces cerevisiae strain MT663 (E2-7B XE11-36, α / α, Atpi / Medium, pulp 4-3 / pep 4-3) (

Yeast strain MT663 was deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen in connection with patent application 92/11378 and is assigned the accession number DSM 6278) on YPGal medium (1% Bacto Yeast extract, 2% Bacto Peptone, 2% Bacto Peptone, lactate), OD _goo = 0.6.

100 ml of the culture was centrifuged, washed with 10 ml of water, centrifuged again and resuspended in 10 ml of a solution of 1.2 M sorbitol, 25 mM Na ₂ EDTA pH 8.0 and 6.7 mg / ml dithiothreitol. The suspension is incubated at 30 ° C for 15 minutes, centrifuged, and the cells are resuspended in 10 ml of a solution containing 1.2 M sorbitol, 10 mM Na ₂ EDTA, 0.1 M sodium citrate pH = 5.8 and 2 mg of Novozym 234. The suspension is incubated at 30 ° C for 30 minutes, the cells are harvested by centrifugation, washed in 10 ml of a solution of 1.2 mol / l sorbitol and 10 ml of CAS (1.2 mol / l). (1 sorbitol, 10 mM CaCl ₂ , 10 mM TRIS-HCl (TRIS = Tris (hydroxymethyl) aminomethane) pH 7.5) and resuspended in 2 mL CAS. For transformation, 1 ml of the cell suspension in CAS was mixed with about 0.1 pg of plasmid DNA and allowed to stand at room temperature for 15 minutes. 1 ml of a solution of 20% polyethylene glycol 4000, 10 mM CaCl ₂ , 10 mM TRIS-HCl, pH 7.5; then allow the mixture to stand at room temperature for another 30 minutes. The mixture is centrifuged and the pellet resuspended in ο 1 ml SOS (1.2 M sorbitol, 33 vol / vol YPD, 6.7 mmol / L CaCl ₂ ) and then at 30 ° C for 2 hours. incubate. The suspension is then centrifuged and the pellet resuspended in 0.5 ml

In a solution containing 1.2 mol / l sorbitol. 6 ml of cover agar was then added at 52 ° C (Sherman et al., SC medium (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory (1992))), 1.2 mol / l sorbitol and 2.5% agar and the slurry is poured onto sorbitol plates fixed with the same agar.

Example 1

Construction of plasmids pJB108 and pJB109

Plasmid pJB59 is a derivative of plasmid pKFN1003 in which the Eco RI-Xba I fragment encodes the insulin precursor B _chain (1-27) -Asp-Lys-Ala-Lys-A _chain (1-21), at the N-terminus of a signal / fusion to a leader peptide sequence corresponding to the afactor prepro signal peptide in which Leu at position 82 and Asp at position 83 are replaced by Met and Ala (Figure 2). The EcoRI-Xbal fragment was synthesized using an Applied Biosystems DNA Synthesizer (Perkin Elmer DNA Thermal Cycler) according to the manufacturer's protocol.

Plasmid constructs designed to express the N-terminally extended B _chain (1-27) -Asp-Lys-AlaLys-A _chain (1-21) insulin precursor were obtained with a P1 primer having the following sequence:

«* · · · · · · · · · · · · · · · · · · · · · · · · · ···

NcoI

5 '-GGGGTATCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAAGCT (AC) CAAAG GlyLeuSerMetAlaLysArgGluGluAlaGluAlaGluAla Xaa Lys

TTCGTTAACCAACAC-3 '

PheValAsnGlnHis with the P2 primer: 5 '-AATTTATTTTACATAACACTAG-3' and pJB59 according to the general scheme described above. The result of PCR and cloning is a construct in which the DNA sequence encoding the Asp-Lys-Ala-Lys-A _chain (1-21) insulin precursor of the B _chain (1-27) is preceded by a DNA sequence which is the Glu-Glu-Ala-. GluAla-Xaa-Lys encodes an N-terminal extension where Xaa is either Pro (pJB108; Pro is CCA encoded) or Thr (Pjbl09; Thr is ACA encoded).

Example 2

Construction of plasmids pJB44, pJB107 and pJB126

Further plasmid constructs designed to express the N-terminal extended B _chain (I-27) Asp-Lys-Ala-Lys-A _chain (1-21) insulin precursor variants were obtained with a P1 primer having the following sequence:

NcoI

5 '-GGGGTATCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAAGCTG (CAG) (AC) A GlyLeuSerMetAlaLysArgGluGluAlaGluAlaGluAla Xaa

AAGTTCGTTAACCAACAC-3 '

LysPheValAsnGlnHis, with the P2 primer: 5 '-AATTTATTTTACATAACACTAG-3' and pJB59, as described in Example 1. From the resulting plasmids, pJB44, pJB107 and pJB126 were isolated. These plasmids encode the insulin precursor B _lanc (1-27) -Asp-Lys-Ala-Lys-A _chain (1-21) preceded by a DNA sequence that is Glu-Glu-Ala-Glu-Ala-Glu. -Ala-Xaa-Lys encodes an N-terminal extension wherein Xaa is either Glu (pJB44; Glu is GAA encoded), Asp (pJB126; Asp is GAC encoded) or Gly (pJB107;

Gly is encoded by GGC).

Example 3

Plasmid constructs designed to express the N-terminally extended B _chain (1-27) -Asp-Lys-AlaLys-A _chain (1-21) insulin precursor were obtained with a P1 primer having the following sequence:

NcoI

5 '-GGGGTATCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAAGG (AC) A GlyLeuSerMetAlaLysArgGluGluAlaGluAlaGlu Xaa

AAGTTCGTTAACCAACAC-3 '

LysPheValAsnGlnHis with the P2 primer: 5 '-AATTTATTTTACATAACACTAG-3' and pJB59 as described in Example 1. From the resulting plasmids, pJB64, pJBHO, was isolated. These plasmids encode the B _chain (1-27) -Asp-Lys-Ala-Lys-A _chain (1-21) insulin precursor preceded by a DNA sequence that is Glu-GluAla-Glu-Ala-Glu-Xaa. -Lys encodes an N-terminal extension wherein Xaa is either Glu (pJBHO; Glu is GAA encoded) or Ala (pJB64; Ala is encoded by GCA).

Example 4

Construction of Plasmid pAK663 »· ··

The plasmid pAK623 pKNF1003 the derived plasmid in which the EcoRI-XbaI fragment of GLP-l ₇ _ _36Ala -t encodes the N-terminus of a synthetic leader sequence (YAP3 / _Pava S1), fused (3rd

figure).

The EcoRI-Xbal fragment was synthesized on an Applied Biosystems DNA synthesizer according to the manufacturer's protocol.

GLP-1 containing the N-terminal Glu-Glu-Ala-Glu-Ala-Glu-Ala-Glu-Arg ₇ _ extension is designed _36ala expressing plasmid constructs having the sequence Pl primer:

NcoI

5 '-AACGTTGCCATGGCTCCAGCTCCAGCTAAGAGAGAAGAAGCTGAAGCTGAA AsnValAlaMetAlaProAlaValAlaLysArgGluGluAlaGluAlaGlu

GCTGAAAGACATGCTGAAGGT-3 '

AlaGluArgHisAlaGluGly and the P2 primer: 5 '-AATTTATTTTACATAACACTAG-3' and pAK623 were prepared using the method described to give plasmid pAK663.

Example 5

Expression of products extended at their N-terminus and removal of extensions

Yeast strain MT663 transformed with the above-described C-POT plasmids (pJB59, pJB108, pJB109, pJB44, pJB126, pJB107, pJB64 and pJBHO) was grown on YPD agar medium (1% yeast extract, 2% gluten extract). Isolated colonies were harvested, and 5 ml of liquid media was started in YPD medium (pH 6.0) and shaken for 72 hours at 30 ° C.

The amount of product formed is directly determined in the culture supernatant by the method of Snel, Damgaard and Mollerup [Snell, Damgaard and Mollerup: Chromatographia 24,

329-332 (1987).

The results obtained with the yeast strains expressing the insulin precursor B _chain (1-27) -Asp-Lys-AlaLys-A _ldnc (1-21) at the N-terminus as compared to the non-extended form (pJB59) are shown below:

plasmid N-terminal extension Production pJB59 100% pJB108 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Pro-Lys 275% pJB109 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Thr-Lys 300% pJB44 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Glu-Lys 325% * pJB126 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Asp-Lys 300% * PJB107 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Gly-Lys 275% pJB64 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Lys 250% * pJBHO Glu-Glu-Ala-Glu-Ala-Glu-Glu-Lys 225% THE productions marked with an asterisk (*) indicate it report that product in this case at the N-terminal extended

^B unc (1-27) -Asp-Lys-Ala-Lys-A _chain (1-21) and its non-extended B _chain (1-2 7) -Asp-Lys-Ala-Lys-A _chain (1-21), the latter of which is described above and 4a. as well as

5 is the result of in vivo flipping the extension shown in Figure 5.

· · · · · · · · · · · · · · · · · · · · · · · · · · ··· ·

In the case where the pAK663 expressing the N-terminally extended by Glu-Glu-Ala-Glu-Ala-Glu-Ala-Arg sequence of GLP-l ₇ _ _36Ala -t, the yield was found to twenty times higher than when the pAX623 expresses non-extended GLP-1 ₇ _ _35Ala .

Example 6

Removal of N-terminal extensions in vivo

Supernatants from cultures of yeast strains transformed with plasmids pJB59, pJB64, pJB44 and pJB108 were evaluated by HPLC chromatography (Figure 4a), and duplicate samples were run on a 10% Tricin-SDS-PAGE gel (Figure 5, 1, 2, 3 and Lane 4). From the HPLC chromatograms, the supernatant of the cultures of the yeast strains containing plasmid pJB44 (chromatogram 3) and plasmid pJB64 (chromatogram 4) contains both N-terminally extended and N-terminally extended B _chain (1-27) - Asp-Lys-Ala-LysAianc (1), while supernatants from the yeast strain of pJB108 (chromatogram 4) contain only the N-terminally extended form. In the case of pJB64, about 50% of the precursor is in the non-extended form (see lane 2 of Figure 5), whereas in the case of pJB44 this form represents only a negligible proportion.

These results illustrate the ability of yeast to selectively cleave N-terminal extensions in vivo when the extension is either Glu-Glu-AlaGlu-Ala-Glu-Ala-Lys (pJB64) or Glu-Glu-Ala -Glu-Ala-Glu31 • · · · · · · · · · · · · · · · · · · · · · · · · · ··· ·

Ala-Glu-Lys (pJB44) and that yeast is unable to cleave the N-terminal extension when its sequence is Glu-Glu-Ala-Glu-Ala-Glu-Ala-Pro-Lys (pJB108). The proteolytic activity responsible for cleaving the elongations may be linked to enzymes, such as membrane-bound YAP3, in the yeast cell trans zGolgi by secretion biosynthesis.

Example 7

Removal of N-terminal extension in vitro

The culture supernatants described above are used as substrates for proteolytic cleavage or with the YAP-3 enzyme isolated from the yeast strain ME783 overexpressing YAP3 (Egel-Mitani, M. et al., YEAST_6, 127-137 (1990)), or

Achromobacter lyticus protease I.

The YAP3 assay is performed as follows:

μΐ YAP3 enzyme

800 ml cell-free growth medium

Samples were incubated for 15 hours at 37 ° C in 0.1 M sodium citrate buffer, pH 4.0.

The Achromobacter lytícus protease I assay is performed as follows:

pg Achromobacter lytícus protease I ml cell-free propagation medium

Samples were incubated for 1 hour at 37 ° C in 0.1 M TRIS buffer, pH 8.75.

···· ···· ·· • · · · «· • · · · · · · · · · · · · • • · · · ·

4b. 4c and 4c. Figures 1 to 5 show the results of HPLC evaluation of YAP3 and Achromobacter lyticus protease I digests. Duplicate samples were run on a 10% TRICIN-SDS polyacrylamide gel (Figure 5, lane 5-12).

4b. The YAP3 enzyme is capable of selectively cleaving N-terminal extensions when they have the formula Glu-Glu-Ala-Glu-Ala-Glu-Ala-Lys (pJB64) or Glu-Glu-Ala-Glu- Ala-Glu-Ala-Glu-Lys (pJB108) but is unable to cleave the N-terminal extension when its sequence is Glu-Glu-Ala-Glu-Ala-Glu-Ala-Pro-Lys (pJB108). 6, 7 and 8). These results clearly indicate that YAP3 or YAP3-like enzyme (s) are responsible for the in vivo down-regulation of N-terminal extensions (see

Example 6).

4c. Figure A shows that digestion with Achromobacter lyticus protease I results in the same product in all cases, namely, _chain B (l27) -Asp-Lys- (disulfide bonded) -A _chain (1-21) et. which is all the Lys residues in the insulin precursor of the B _lanc (1-27) -Asp-Lys-Ala-Ala-Lys-A _chain (1-21) (including those in the precursor between the B and A chains) ), the end product of proteolytic cleavage.

When digesting the supernatant of the yeast transformed with pJB59 (which expresses the non-extended B _chain (1-27) -Asp-Lys-Ala-Ala-LysA _chain (1)), one can see a product , which is not found in other digestions. This product, the Arg-B _chain (1-27) -Asp-Lys- (disulfide) · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · to to (Linked to bonds) _-Lanc (1-21) is derived from the cleavage of a leader precursor secreted into growth medium by Achromobacter lyticus I protease. Achromobacter lyticus protease I cleaves between Lys and Arg at the dibasic KEX2 site of the product, which avoids KEX2 cleavage by yeast secretion biosynthesis.

. Example

Removal of the N-terminal extension by overexpression of YAP3

The YAP3 gene, cloned by Egel-Mitani et al., (1990, Egel-Mitani, M. et al., YEAST 6: 127-137), was introduced into the plasmid pJB64 CPOT, which is the Glu-Glu-Ala-Glu-Ala-Glu _{-AlaLys-Bchain} (1-27) -Pro-Lys-Ala-Ala-Lys-A _chain (1-21) encodes the precursor (see Example 3) insulin, as follows:

The 2.5 kb SalI / SacI fragment containing the YAP3 gene was isolated from plasmid pME768 (Egel-Mitani, M. et al., YEAST 6, 127-137 (1990)), followed by plasmid pIC19R (March et al., Gene 32). 481-485 (1984)]. From the resulting plasmid pME834, a 2.5 kb SalI / XhoI fragment containing the YAP3 gene was isolated and inserted into the plasmid pJB64 at the single SalI cleavage site between the POT and the Ap ^R sequences. One such plasmid generated is designated pJB176.

The yeast strain MT663 was transformed with pJB176 and analyzed as described in Example 5.

»· · · · ·

As shown by HPLC analysis of production data in Figure 8, the presence of the YAP3 gene in pJB176 clearly leads to a higher percentage of non-extension B _Lanc (l-27) Pro-Lys-Ala. -Ala-Lys-A _lanc (1-21) in the culture supernatant of the corresponding yeast transformants when compared to yeast transformants transformed with plasmid pJB64.

These results suggest the possibility of producing yeast strains that have the ability to selectively cleave N-terminal extensions in vivo by manipulating the level of YAP3 proteolysis.

Example 9

Construction of plasmid pKV143

Plasmid pKV143 is a derivative of pKFN1003 in which the Eco RI-Xba I fragment encodes the insulin precursor B _lanc (1-29) -Ala-Ala-Arg-A _chain (1-21) linked at its N-terminus to a signal / leader sequence. corresponds to the α-factor prepro signal peptide in which Leu at position 82 and Asp at position 83 are replaced by Met and Ala (Figure 4).

Insulin at the N-terminus of the _chain extended by Glu-Glu-Ala-Glu-Ala-Glu-Ala-Glu-Pro-LysAla-Thr-Arg insulin (1-29) -Ala-AlaArg-A _chain (1-21) Plasmid constructs for expression of the precursor were constructed with a P1 primer having the following sequence:

5 '-GGGGTATCCATGGCTAAGAGAGACGACGCTGACGCTGACGCTGACCCAAGA GlyLeuSerMetAlaLysArgAspAspAlaAspAlaAspAlaAspProArg • · • · · · · · · ·

TTCGTTAACCAACACTTGTGCGG-3 '

PheValAsnGlnHisLeuCys for the P2 primer: 5 '-AATTTATTTTACATAACACTAG-3' and pKV142, according to the general scheme described above.

Example 10

Construction of plasmid pKV102

The N-terminal Asp-Asp-Ala-Asp-Ala-Asp-Ala-Asp-Pro-Arg sequence extended _Bchain (1-29) -Ala-Ala-Arg-A _chain (ΙΟΙ) Plasmid constructs expressing insulin precursor in prepared with a P1 primer having the following sequence:

5 '-GGGGTATCCATGGCTAAGAGAGACGACGCTGACGCTGACGCTGACCCA GlyLeuSerMetAlaLysArgGluGluAlaGluAlaGluAlaGluPro

AAGGCTACAAGATTCGTTAACCAACACTTGTGCGG-3 '

LysAlaThrArgPheValAsnGlnHisLeuCys using the P2 primer: 5'-AATTTATTTTACATAACACTAG-3 'and pKV142, according to the general scheme described above.

Example 11

Expression of the insulin precursor of the N-terminally extended B- _strand (1-29) -Ala-Ala-ArgA _chain (1-21)

The yeast strain MT663 was transformed with the C-POT plasmids pKV142, pKV143 and pKV102 and analyzed as described in Example 5.

The results obtained with the yeast strains expressing the N-terminally extended B _chain (1-29) -Ala-Ala-ArgAl _anc (I-21) insulin precursor are shown below in comparison with the non-extended form:

plasmid

N-terminal extension

Production pKV142 100% pKV143 Asp-Asp-Ala-Asp-Ala-Asp-Ala-Asp-Pro-Arg 263% pKV102 Glu-Glu-Ala-Glu-Ala-Glu-Ala-Glu-Pro- 400%

Lys-Ala-Thr-Arg

Example 12

Construction and expression of pIM69 and pIM70

The plasmid pAK679 pKFNl003 the derived plasmid in which the EcoRI XbaI fragment encodes a precursor of the extended B _chain (l-29) -Ala-Ala-Arg-A _chain (1-21), the N-terminus of a synthetic YAP3 / LA19 signal / fused to the leader sequence (Figure 5).

Extended at the N-terminus of B _chain (1-29) -Ala-Ala-ArgAiánc (l ^_ 21) insulin precursor plasmid constructs were designed to express prepared by two successive PCR reaction.

The first PCR reaction is performed with the primer having the following sequence:

5 '-GAAGAAGAAGAAGAAGAACCAAAGTTCGTTAACCAACAC-3' GluGluGluGluGluGluProLysPheValAsnGlnHis and the P2 primer: 5 '-AATTTATTTTACATAACACTAG-3' and plasmid pAK679.

The second PCR reaction is carried out with P2 primer having the following sequence:

NcoI

5 '-GTTGTTAACTTGATCTCCATGGCTAAGAGAGAAGAA-3'

ValValAsnLeuilleSerMetAlaLysArgGluGlu and P2 primer: 5'-AATTTATTTTACATAACACTAG-3 'and the product of the first PCR reaction as DNA template in the second PCR reaction.

The PCR product of the second PCR reaction was cleaved with NcoI and XbaI restriction endonucleases and ligated into your plasmid pAK679 according to the general scheme described above. Two of the resulting plasmids are identical! we have found that the N-terminal extension of the B _chain (1-29) -AlaAla-Lys-A _chain (1-21) is encoded by GluGlu-Glu-Pro-Lys (pIM70) and Glu-Glu-Glu-Glu-Pro- lys (pIM69).

The yeast strain MT663 was transformed with the C-POT plasmids pAK579, pIM69 and pIM70 as described in Example 5.

Although the non-extended _Bchain (1-29) -Ala-Ala-lysA _LANC insulin (l ^_ 21) precursor of pAK579 yeast practically does not occur, the pIM69 and pIM70 plasmids revealed transformed yeast product to produce high levels of Glu _{Glu-Glu-Glu-Pro-Lys-Bchain} (1-29) -Ala-Ala-lysA _chain (1-21) eth and the _chain of Glu-Glu-Glu-Pro-Lys-B (J-2 9 ) -Ala-Ala-LysA _chain (1-21).

The sequences described herein are described below.

• · · · ·

SEQUENCE LIST (1) GENERAL INFORMATION (i) NOTIFIER:

(A) NAME: Novo Nordisk A / S (B) STREET: Novo Allé (C) CITY: Bagsvaerd (E) COUNTRY: Denmark (F) DIRECTORY: 2880 (G) PHONE: +45 4444 8888 (H) TELEPHONE: + 45 4449 3256 (I) TELEX: 37304 (ii) TITLE OF THE INVENTION: Expression of N-terminal Proteins in Yeast (Arc) COMPUTER READING FORM:

(A) MEDIA TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patent Release # 1.0, Version # 1.25 (EPO) (2) AZ 1.

(I)

SEQ ID NO:

The sequence features:

(A) Length: 6 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear ···· ···· (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antissen: no (vi) Original source:

(A) Organism: Saccharomyces cerevisiae (xi) SEQ ID NO: 1

Lys Arg Glu Alá Glu Alá

5 (2) DETAILS OF SEQ ID NO: 2:

(i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 2

Glu Glu Alá Glu Alá Glu Xaa Xaa Xaa Arg Alá Pro Arg (2) DETAILS OF SEQ ID NO: 3:

(i) Sequence Characteristics:

(A) Length: 11 amino acids (B) Type: amino acid (C) Strain type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 3

Glu Glu Alá Glu Alá Glu Pro Lys Alá Xaa Arg

10 (2) DETAILS OF SEQ ID NO: 4:

(i) Sequence Characteristics:

(A) Length: 10 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Originated :

(A) Organism: Synthetic (xi) SEQ ID NO: 4

Glu Glu Ala Glu Ala Glu Ala Glu Pro Arg

10 (2) DETAILS OF SEQ ID NO: 5:

(i) Sequence Characteristics:

(A) Length: 10 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 5

Glu Glu Ala Glu Ala Glu Ala Glu Pro Lys

10 (2) DETAILS OF SEQ ID NO: 6:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: peptide (iii) Hypothetical: no · · · · · · · · · · · (Iii) Antissen: no (vi) Original source: ··· · · · · · · · · · · · · · · · ·

(A) Organism: Synthetic (xi) SEQ ID NO: 6

Glu Glu Alá Glu Alá Glu Alá Glu Arg

5 (2) DETAILS OF SEQ ID NO: 7:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 7

Glu Glu Alá Glu Alá Glu Alá Xaa Lys (2) DETAILS OF SEQ ID NO: 8:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 8

Glu Glu Alá Glu Alá Glu Alá Xaa Lys

5 (2) DETAILS OF SEQ ID NO: 9:

(i) Sequence Characteristics:

(A) Length: 8 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic ···· ···· ♦ · ························································································································· sequence

Glu Glu Alá Glu Alá Glu Alá Arg

5 (2) DETAILS OF SEQ ID NO: 10:

(i) Sequence Characteristics:

(A) Length: 8 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 10

Glu Glu Alá Glu Alá Glu Xaa Lys

5 (2) DETAILS OF SEQ ID NO: 11:

(i) Sequence Characteristics:

(A) Length: 7 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no t ··· · »J · ·· · * • · · 4 · to · · ·· <>

(Iii) Antisense: no (vi) Original Source:

(A) Organism: Synthetic (xi) SEQ ID NO: 11

Glu Glu Alá Glu Alá Pro Lys

5 (2) DETAILS OF SEQ ID NO: 12:

(i) Sequence Characteristics:

(A) Length: 5 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 12

Glu Glu Alá Pro Lys * ··· ····

Glu (2)

DETAILS OF SEQ ID NO: 13:

(i) Sequence Characteristics:

(A) Hss: 4 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 13

Glu Pro Lys

DETAILS OF SEQ ID NO: 14:

(i) Sequence Characteristics:

(A) Length: 22 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: DNA (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic ···· ···· (xi) Sequence Description: SEQ ID NO: 14

AATTTATTTT ACATAACACT AG (2) DETAILS OF SEQ ID NO: 15:

(i) Sequence Characteristics:

(A) Length: 63 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: DNA (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 15

GGGGTATCCA TGGCTAAGAG AGAAGAAGCT GAAGCTGAAG CTNCAAAGTT CGTTAACCAA 60

CAC 63 (2) DETAILS OF SEQ ID NO: 16:

(i) Sequence Characteristics:

(A) Length: 64 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: DNA (iii) Hypothetical: no (iii) Antisense: no ··· · ···· · · (vi) Original source:

(A) Organism: Synthetic (xi) SEQ ID NO: 16

GGGGTATCCA TGGCTAAGAG AGAAGAAGCT GAAGCTGAAG CTGNNAAAGT TCGTTAACCA 60

ACAC 64 (2) DETAILS OF SEQ ID NO: 17:

(i) Sequence Characteristics:

(A) Length: 61 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: DNA (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 17

GGGGTATCCA TGGCTAAGAG AGAAGAAGCT GAAGCTGAAG CNAAAGTTCG TTAACCAACA 60

C 61 (2) DETAILS OF SEQ ID NO: 18:

(i) Sequence Characteristics:

(A) Length: 72 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: DNA • (·) Hypothetical: no ( iii) Antisen: No (vi) Original Source:

(A) Organism: Synthetic (xi) SEQ ID NO: 18

AACGTTGCCA TGGCTCCAGC TCCAGCTAAG AGAGAAGAAG CTGAAGCTGA AGCTGAAAGA 60

CATGCTGAAG GT 72 (2) DETAILS OF SEQ ID NO: 19:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 19

Glu Glu Alá Glu Alá Glu Alá Pro Lys (2) DETAILS OF SEQ ID NO: 20:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 20

Glu Glu Alá Glu Alá Glu Alá Thr Lys

5 (2) DETAILS OF SEQ ID NO: 21:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: synthetic number sequence

Glu (xi) Sequence description: 21.

Glu Alla Glu Alla Glu Alla Glu Lys (2)

Glu

DETAILS OF SEQ ID NO: 22:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 22

Glu Ala Glu Ala Glu Ala Asp Lys Sequence (2)

DETAILS OF SEQ ID NO: 23:

(i) Sequence Characteristics:

(A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no

• · · (iii) Antisense: No (vi) Original Source:

(A) Organism: Synthetic (xi) SEQ ID NO: 23

Glu Glu Alá Glu Alá Glu Alá Gly Lys

5 (2) DETAILS OF SEQ ID NO: 24:

(i) Sequence Characteristics:

(A) Length: 8 amino acids (B) Type: amino acid (C) Thread type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 24

Glu Glu Alá Glu Alá Glu Alá Lys • · · · ···

(2) In paragraph 25. SEQ ID NO: (1) The sequence features: (A) Hss: 8 amino acids (Ii) (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear Type of molecule: peptide (Iii) ι Hypothetical: no (Ill! ι Antisense: no (Vi) Original Source: (XI) (A) Organism: synthetic Sequence description: SEQ ID NO: 25

Glu Glu Alá Glu Alá Glu Glu Lys

5

2. SEQ ID NO: (I) The sequence features: (Ii) (A) Length: 9 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear Type of molecule: peptide (Iii) ι Hypothetical: no (Iii) ι Antisense: no (Vi) Original Source:

(A) Organism: Synthetic Here ···· (xi) Sequence Description: SEQ ID NO: 26

Glu Glu Alá Glu Alá Glu Alá Pro Lys

5 (2)

DETAILS OF SEQ ID NO: 27:

(i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 27

Glu Glu Alla Glu Alla Glu Alla Glu Pro Lys Alá Thr Arg (2) DETAILS OF SEQ ID NO: 28:

(i) Sequence Characteristics:

(A) Length: 8 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no · *** r.

(iii) Antisense: No (vi) Original Source:

(A) Organism: Synthetic (xi) SEQ ID NO: 28

Glu Glu Alá Glu Alá Glu Alá Lys

5 (2)

Glu

DETAILS OF SEQ ID NO: 29:

(i) Sequence Characteristics:

(A) Length: 5 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (xi) SEQ ID NO: 29

Glu Alá Pro Lys «··· ················································ (2) A 3 Ο.

(Ί)

SEQ ID NO:

The sequence features:

(A) Hss: 660 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: DNA (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (ix) Property:

(A) Name / Key: CDS (B) Localization: 127..540 (ix) Property:

(A) Name / Key: sig_peptid (B) Localization: 127.381 (ix) Property:

(A) Name / Key: mat_peptide (B) Localization: 382-540 (xi) Sequence Description: SEQ ID NO: 30

GTTTGTATTCTTTTCTTGCTTAAATCTATAACTACAAAAAACACATACAGGAATTCC

ATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAATATAA

ACGATTAAAAGA

ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCT MetArgPheProSerllePheThrAlaValLeuPheAlaA.laSerSerAlaLeuAla -85 -80 -75 -70

GCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTC

AlaProValAsnThrThrThrGluAspGluThrAlaGlnlleProAlaGluAlaVal

-65 -60 -55 -50 «··· ···· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

ATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAAC

IleGlyTyrSerAspLeuGluGlyAspPheAspValAlaValLeuProPheSerAsn

-45 -40 -35 -30

AGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAA SerThrAsnAsnGlyLeuLeuPheIleAsnThrThrlleAlaSerIleAlaAlaLys

-25 -20 -15 -10

GAAGAAGGGGTATCCATGGCTAAGAGATTCGTTAACCAACACTTGTGCGGTTCCCAC

GluGluGlyValSerMetAlaLysArgPheValAsnGlnHisLeuCysGlySerHis

-5 15 10

TTGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGAGGTTTCTTCTACACTGACAAG

LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThrAspLys

20 25

GCTGCTAAGGGTATCGTTGAACAATGCTGTACCTCCATCTGCTCCTTGTACCAATTG

AlaAlaLysGlylleValGluGlnCysCysThrSerlleCysSerLeuTyrGlnLeu

35 40 45

GAAAACTACTGCAACTAGACGCAGC

GluAsnTyrCysAsn (2) A 31.

SEQ ID NO:

(i) Sequence Characteristics:

(A) Length: 138 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: protein (xi) Sequence description: SEQ ID NO: 31

MetArgPheProSerllePheThrAlaValLeuPheAlaAlaSerSerAlaLeuAla -85 -80 -75 -70

AlaProValAsnThrThrThrGluAspGluThrAlaGlnlleProAlaGluAlaVal -65 -60 -55 -50

IleGlyTyrSerAspLeuGluGlyAspPheAspValAlaValLeuProPheSerAsn -45 -40 -35 -30

SerThrAsnAsnGlyLeuLeuPheIleAsnThrThrlleAlaSerIleAlaLys -25 -20 -15 -10

GluGluGlyValSerMetAlaLysArgPheValAsnGlnHisLeuCysGlySerHis -5 1 5 10 ttu ···· · · · · · · · ·

LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThrAspLys 15 20 25

AiaAlaLysGlylleValGluGlnCysCysThrSerlleCysSerLeuTyrGlnLeu 30 35 40 45

GluAsnTyrCysAsn 5 0 (2) DETAILS OF SEQ ID NO: 32:

(i) Sequence Characteristics:

(A) Length: 516 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: DNA (iii) Hypothetical: no (iii) Antisense: no (vi) Original source :

(A) Organism: Synthetic (ix) Property:

(A) Name / Key: CDS (B) Localization: 133.411 (ix) Property:

(A) Name / Key: sig_peptid (B) Localization: 133..321 (ix) Property:

(A) Name / Key: mat_peptide (B) Localization: 322-411 (xi) Sequence Description: SEQ ID NO: 32

TGTTTGTATTCTTTTCTTGCTTAAATCTATAACTACAAAAAACACATACAGGAATTC

CATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAATATA

AACGACGGTACCAAATA

ATGAAACTGAAAACTGTAAGATCTGCGGTCCTTTCGTCACTCTTTGCATCTCAGGTC MetLvsLeuLysThrValArgSerAlaValLeuSerSerLeuPheAlaSerGlnVal -63 -60 -55 -50 -45

CTTGGCCAACCAATTGACGACACTGAATCTAACACTACTTCTGTCAACTTGATGGCT LeuGlyGlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMetAlá -40 -35 -30

GACGACACTGAATCTATCAACACTACTTTGGTTAACTTGGCTAACGTTGCCATGGCT AspAspThrGluSerIleAsnThrThrLeuValAsnLeuAlaAsnValAlaMetAla -25 -20 -15 -10

CCAGCTCCAGCTAAGAGACATGCTGAAGGTACCTTCAACTCTGACGTCTCGAGTTAC

ProAlaProAlaLysArgHisAlaGluGlyThrPheThrSerAspValSerSerTyr

-5 1 5 10

TTGGAAGGCCAAGCTGCTAAGGAGTTCATCGCTTGGTTGGTTAAGGGCGCTTAGTCT

LeuGluGlyGlnAlaAlaLysGluPhelleAlaTrpLeuValLysGlyAla

20 25 30

AGAAACTAAGATTAATATAATTATATAAAAATATTATCTTCTTTTCTTTATATCTAGTGTTAT

GTAAAATAAATTGATGACTACGGAAAGCTAGCTTTT (2) DETAILS OF SEQ ID NO: 33:

(i) Sequence Characteristics:

(A) Length: 93 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: protein (xi) Sequence description: SEQ ID NO: 33

MetLysLeuLysThrValArgSerAlaValLeuSerSerLeuPheAlaSerGlnVal -63 -60 -55 -50 -45

LeuGlyGlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMetAlá -40 -35 -30 ···· ···· · ·

AspAspThrGluSerlleAsnThrThrLeuValAsnLeuAiaAsnValAlaMetAla -25 -20 -15 -10

ProAlaProAlaLysArgHisAlaGluGlyThrPheThrSerAspValSerSerTyr -5 1 5 10

LeuGluGlvGlnAlaAlaLysGluPheIleAlaTrpLeuValLysGlyAla 15 ”20 25 30 (2) A 34 (i)

SEQ ID NO:

The sequence features:

(A) Length: 10 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear

Asp (ii) Molecule Type: Peptide (iii) Hypothetical: No (iii) Antisense: No (v) Fragment Type: Internal (xi) Sequence Description: 34.

Asp Asp Asp Asp Asp Pro Asp Pro SEQ ID NO 5

Arg (2) DETAILS OF SEQ ID NO: 35: (i) Sequence characteristics:

(A) Length: 6 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no • · · · • (V) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 35

Glu Glu Glu Glu Pro Lys

5 (2) DETAILS OF SEQ ID NO: 36:

(i) Sequence Characteristics:

(A) Length: 5 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: peptide (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: inner (xi) SEQ ID NO: 36

Glu Glu Glu Pro Lys

5 (2) DETAILS OF SEQ ID NO: 37:

(i) Sequence Characteristics:

(A) Length: 6 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: peptide (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: internal (xi) SEQ ID NO: 37

Asp Asp Asp Asp Asp Asp Lys

5 (2) DETAILS OF SEQ ID NO: 38:

(i) Sequence Characteristics:

(A) Length: 61 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: inner (xi) Sequence description:

Glu 1 Glu Ala Glu Ala 5 Glu Ala Lys Ser His Leu With 20 Glu Ala Leu Tyr Phe Tyr Thr 35 Pro Lys Ala Ala Lys 40 Ser Ile 50 Cys Ser Leu Tyr Gin 55 Leu

SEQ ID NO: 38

Phe With 10 Asn Gin His Leu Cys 15 Gly Leu 25 With Cys Gly Glu Arg 30 Gly Phe Gly Ile With Glu Gin 45 Cys Cys Thr Glu Asn Tyr Cys Asn

(2) DETAILS OF SEQ ID NO: 39:

(i) Sequence Characteristics:

(A) Length: 53 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide

(Iii) Hypothetical: no (Iii) antisense: no (v) Fragment type : internal (xi) A sequence description: 39. SEQ ID NO: Phe 1 Val Asn Gin His Leu 5 Cys Gly Ser His 10 Leu Val Glu below Leu 15 Tyr Leu Val Cys Gly Glu Arg 20 Gly Phe Phe 25 Tyr Thr Pro Lys below 30 below Lys Gly Ile Val 35 Glu Gin Cys Cys Thr 40 Ser Ile Cys Ser Leu 45 Tyr Gin Leu Glu Asn Tyr Cys Asn

(2)

asp

DETAILS OF SEQ ID NO: 40:

(i) Sequence Characteristics:

(A) Length: 10 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: inner (xi) SEQ ID NO: 40

Asp Asl Asp Alá Asp Alá Asp 5

Pro Arg 10 ········································································································································································ without linking

(i) Sequence Characteristics:

(A) Length: 74 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: DNA (iii) Hypothetical: no (iv) Antisense: no (v) Fragment type: inner (xi) SEQ ID NO: 41

GGGGTATCCA TGGCTAAGAG AGACGACGCT GACGCTGACG CTGACCCAAG ATTCGTTAAC 60

CAACACTTGT GCG 74

Glu

42. SEQ ID NO: (I) The sequence features: (A) Length: 13 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (Ii) Type of molecule: peptide (tendon! ι Hypothetical: no (Iii! ι Antisense: no (V) Fragment type: internal (Xi) Sequence description: 42. SEQ ID NO: Glu Alá Glu Alá Giu Alá Glu Pro Lys Alá Thr Arg 5 10

(2) DETAILS OF SEQ ID NO: 43:

(i) Sequence Characteristics:

(A) Length: 83 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: DNA (iii) Hypothetical: no (iv) Antisense: no (v) Fragment type: inner (xi) SEQ ID NO: 43

GGGGTATCCA TGGCTAAGAG AGAAGAAGCT GAAGCTGAAG CTGAACCAAA GGCTACAAG

ATTCGTTAACC AACACTTGTG CGG (2) SEQ ID NO: 44:

(i) Sequence Characteristics:

(A) Length: 53 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: inner (xi) Sequence description: SEQ ID NO: 44 • · · · ·

Phe 1 With Asn Gin His 5 Leu Cys Gly Ser His 10 Leu With Glu below Leu 15 Tyr Leu With Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys below below Lys 20 25 30 Gly Ile With Glu Gin Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gin Leu 35 40 45

Glu Asn Tyr Cys Asn 50 (2) DETAILS OF SEQ ID NO: 45:

(i) Sequence Characteristics:

(A) Length: 39 base pairs (B) Type: nucleic acid (0 Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: DNA (iii) Hypothetical: no (iv) Antisense: no (v) Fragment type: internal (xi) SEQ ID NO: 45

GAAGAAGAAG AAGAAGAACC AAAGTTCGTT AACCAACAC 39 (2) DETAILS OF SEQ ID NO: 46:

(i) Sequence Characteristics:

(A) Length: 36 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: DNA (iii) Hypothetical: no (arc) Antisense: no (v) Fragment type: inner (xi) SEQ ID NO: 46

GTTGTTAACT TGATCTCCAT GGCTAAGAGA GAAGAA 36 (2) DETAILS OF SEQ ID NO: 47:

(i) Sequence Characteristics:

(A) Length: 59 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide (iii) Hypothetical: no (iii) Antisense: no

(V) ι Fragmenstype : internal (xi) The sequence description: 47. SEQ ID NO: Glu Glu Glu Glu Pro Lys Phe Val Asn Gin His Leu Cys Gly Ser His 1 5 10 15 Leu With Glu Alá Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr 20 25 30 Thr Pro Lys Alá Alá Lys Gly Ile With Glu Gin Cys Cys Thr Ser Ile 35 40 45

Cys Ser Leu Tyr Gin Leu Glu Asn Tyr Cys Asn 50 55 »· ·· ·· (2) DETAILS OF SEQ ID NO: 48:

(i) Sequence Characteristics:

(A) Length: 58 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: paste (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: internal

(xi ú A sequence description: 48. number s: zekvencia Glu Glu Glu Pro Lys Phe Val Asn Gin His Leu Cys Gly Ser His 1 5 10 15 With Glu below Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr 20 25 30 Pro Lys below Alá Lys Gly Ile Val Glu Gin Cys Cys Thr Ser Ile 35 40 45 Ser Leu Tyr Gin Leu Glu Asn Tyr Cys Asn 50 55

(2) DETAILS OF SEQ ID NO: 49:

(i) Sequence Characteristics:

(A) Length: 10 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: peptide (iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 49

Glu Glu Alá Glu Alá Glu Alá Glu Pro Lys

10 (2) DETAILS OF SEQ ID NO: 50:

(i) Sequence Characteristics:

(THE) Length: 660 bp (B) Type: nucleic (C) Fiber type: single stranded (D) topology: linear

(ii) Molecule Type: DNA (iii) Hypothetical: No (Arc) Antisense: No (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 50

GTTTGTATTC TTTTCTTGCT TAAATCTATA ACTACAAAAA ACACATACAG GAATTCCATT 60 CAAGAATAGT TCAAACAAGA AGATTACAAA CTATCAATTT CATACACAAT ATAAACGATT 120 AAAAGAATGA GATTTCCTTC AATTTTTACT GCAGTTTTAT TCGCAGCATC CTCCGCATTA 180 GCTGCTCCAG TCAACACTAC AACAGAAGAT GAAACGGCAC AAATTCCGGC TGAAGCTGTC 240 ATCGGTTACT CAGATTTAGA AGGGGATTTC GATGTTGCTGT TTTGCCATT TTCCAACAGC 300 ACAAATAACG GGTTATTGTT TATAAATACT ACTATTGCCA GCATTGCTGC TAAAGAAGAA 360 GGGGTATCCA TGGCTAAGAG ATTCGTTAAC CAACACTTGT GCGGTTCCCA CTTGGTTGAA 420 GCTTTGTACT TGGTTTGCGG TGAAAGAGGT TTCTTCTACA CTCCTAAGGC TGCTAGAGGT 480 ATTGTCGAAC AATGCTGTAC CTCCATCTGC TCCTTGTACC AATTGGAAAA CTACTGCAAC 540 TAC ACGCAGC CCGCAGGCTC TAGAAACTAA GATTAATATA ATIATATAAA AATATTATCT 600 rpprpmrrrpprprprp ATATCTAGTG TTATGTAAAA TAAATTGATG ACTACGGAAA GCTAGCTTTT 660

···· ············································································ (· (·

SEQ ID NO: 51 (i) Sequence Characteristics:

(A) Length: 600 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: DNA (iii) Hypothetical: no (iv) Antisense: no (v) Fragment type: inner (xi) SEQ ID NO: 51

TGTTTGTATT CTTTTCTTGG TTAAATCTAT AACTACAAAA AACACATACA GGAATTCCAT oO

TCAAGAATAG TTCAAACAAG AAGATTACAA ACTATCAATT TCATACACAA TATAAACGAC 120

GGTACCAAAA TAATGAAACT GAAAACTGTA AGATCTGCGG TCCTTTCGTC ACTCTTTGCA 180

TCTCAGGTCC TTGGCCAACC AATTGACGAC ACTGAATCTA ACACTACTTC TGTCAACTTG 240

ATGGCTGACG ACACTGAATC TAGATTCGCT ACTAACACT ACTTTGGCTTT GGATGTTGTT 300

AACTTGATCT CCATGGCTAA GAGATTCGTT AACCAACACT TGTGCGGTTC CCACTTGGTT 360

GAGCTTTGT ACTTGGTTTG CGGTGAAAGA GGTTTCTTCT ACACTCCTAA GGCTGCTAAG 42C

GGTATTGTCG AACAATGCTG TACCTCCATC TGCTCCTTGT ACCAATTGGA AAACTACTGC 48C

AACTAGACGC AGCCCGCAGG CTCTAGAAAC TAGATATAT ATATATAT AAAAATATAT 540

TCTTCTTTTC TTTTATATCTA GTGTTATGTA AAATAAATTG ATC-ACTACGG AAAGCTAGCT 600 (2) In the 52. SEQ ID NO:

(i) Sequence Characteristics:

(A) Length: 55 amino acids (B) Type: amino acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: peptide ···· ···· · · · · · · · · · · · · · · · · · (Iii) Hypothetical: no (iii) Antisense: no (v) Fragment type: internal

( xi) The sequence description : 52 . No. sequence Phe Val Asn 1 Gin His Leu Cys 5 Gly Ser His 10 Leu Val Glu Alá Leu Tyr 15 Leu Val Cys Gly 20 Glu Arg Gly Phe Phe 25 Tyr Thr Pro Lys Ser Asp Asp 30 Under Arg Gly 35 He Val Glu Gin Cys Cys 40 Thr Ser lle Cys Ser Leu Tyr 45

Gin Leu Glu Asn Tyr Cys Asn

Claims (2)

PATENT CLAIMS 1. DNA constructs encoding a polypeptide having the following structure: signal peptide -volume peptide-X ¹ -X "-X ³ -X ⁴ -X ⁵ -X ° -X ⁷ -heterologous protein, wherein the heterologous protein may be aprotinin, a tissue factor biosynthesis inhibitor, or other protease inhibitors, insulin-like growth factor I or II, human or bovine growth hormone, interleukin, glucagon, glucagon-like peptide I, factor VH, factor VIII, factor XIII, platelet-derived growth factor, enzymes or functional analogues thereof, and X is Lys or Arg; X is Lys or Arg, x ^L and X together define a yeast processing site; X ³ is Glu or Asp; X ' ¹ represents an amino acid sequence having the following structure: (AB) _{n in} which A is Glu or Asp, B is Ala, Val, Leu or Pro and n is an integer from 0 to 1 to 5, and if n> 2, A and B are the same amino acid or the other from A (k) and B (k) different from amino, or X ¹ is an amino acid sequence of the following structure: in which • · ·· »·» · ·· ·· • 73 C is Glu or Asp and m is 0 or an integer from 1 to 5 X ^J is a peptide bond or one or more amino acids which may be the same or different; X ° represents a peptide bond or an amino acid residue selected from the group consisting of Pro, Asp, Thr, Glu, Al and Gly; and X 'is Lys or Arg, provided that the DNA construct does not encode a polypeptide consisting of a fusion of a signal peptide, a leader peptide, and a heterologous protein or polypeptide, wherein the amino acid sequence of the polypeptide is the N-terminus of the heterologous protein and the leader peptide. In the vicinity of the yeast processing site between its C-terminus, it is modified to provide a processing site that makes the protein accessible for proteolytic cleavage, and the structure of the polypeptide is as follows: signal peptide leader peptide X ¹ -X ² -X ³ -X ⁴ heterologous protein in which X is a peptide bond or one or more amino acids which may be the same or different, X ³ and X ⁴ are the same or different amino acids, and may be basic amino acids at this point, i.e. Lys and Arg, such that X ² and X ³ together define a yeast processing site, X is a peptide bond or one or more amino acids, which may be the same or different, ······· · · · · · · ♦ With the proviso that X and / or X represent one or more amino acids and at least one of the amino acids represented by X ² and / or X ' ¹ is a negatively charged amino acid which may be Glu and Asp. The DNA construct of claim 1, wherein X ³ is Glu. 3. 3. According to claim 1 DNS construction, in which THE report Glu. 4. 1. According to claim 1 DNS construction, in which B meaning Ala. 5. 1. According to claim 1 DNS construction, in which n 2 to 4, more preferably 3. 6th 1. According to claim 1 DNS construction, in which X ⁵ represents a peptide bond, Glu, Asp or Glu-Pro-Lys-Ala 7th 1. According to claim 1 DNS construction, in which x ⁶ means Pro or peptide bond. 8th 1. According to claim 1 DNS construction, in which the s z ignal peptide the α-factor signal peptide, yeast as zparagin protease 2 signal peptide, az mouse salivary glands amylase, the carboxypropeptide or a signal peptide yeast BARI szignálpep- t id. 9th 1. According to claim 1 DNS construction, in which the a leader peptide is a natural leader peptide, such as a ζ-factor leader peptide or a synthetic leader peptide. The DNA construct according to any one of the preceding claims, wherein the heterologous protein is insulin or an insulin precursor or a functional analogue thereof. · · · · · · · · · · · · · · · · · · · · · · · · ··· · 11. The DNA construct according to any one of claims 1 to 6, wherein the X ³ -X amino acid sequence is as follows: Glu Glu below Glu below Glu below Pro Lys, Glu Glu below Glu below Glu below Glu Pro Lys Alá Glu Glu below Glu below Glu below Lys, Glu Glu below Pro Lys, Glu Glu below Glu below Glu below Glu Pro Lys, asp asp below asp below asp below asp Pro Arg, Glu Glu Glu Glu Pro Lys, Glu Glu Glu Pro Lys, asp asp asp asp asp Lys. A recombinant expression vector capable of replication in yeast and carrying the DNA construct of claim 11. A yeast strain capable of expressing a heterologous protein transformed with the vector of claim 12. 14. A method of producing a heterologous protein, comprising culturing a yeast cell of claim 13 in a suitable medium for expressing and secreting the heterologous protein and isolating the protein from the culture medium. 15. The method of claim 14, wherein the X-X amino acid sequence is removed from the recovered heterologous protein by treatment with a proteolytic enzyme specific for a basic amino acid. ···· ····························································································•• 16. The method of claim 15, wherein the proteolytic enzyme is selected from the group consisting of tsinpsin, Achromobacter lyticus protease I, enterokinase, Fusarium oxysporum trypsin-like protease and YAP3. 17. The method of claim 15, wherein the X ³ -X 'amino acid sequence wherein X ⁶ is a peptide bond, Ala or Glu, is removed from the heterologous protein in a medium using a method that comprises a yeast cell under stress. to induce the release of the yeast asparagine protease-3 into the medium, resulting in the cleavage of the X ³ -X 'amino acid sequence. 18. The method of claim 17, wherein the stress effect to which the yeast cell is subjected comprises lowering the pH of the culture medium to below 6.0 or starving the yeast cells under limiting growth conditions. 19. The method of claim 18, wherein the pH of the culture medium is lowered to less than 5. 20. The method of claim 14, wherein the yeast cell is further transformed with one or more protease-encoding genes that are specific for basic amino acids of the protease, and as a result of the culture, the gene or genes are expressed and subsequently produced. providing a much more complete cleavage of X-X 'from the heterologous polypeptide. ··· ···· ·· 21. The method of claim 20, wherein the gene encoding the protease is encoded by the YAP3 protease, therefore the YAP3 gene or genes are overexpressed in the cells upon culturing, the YAP3 overexpressed, thus ensuring a more complete cleavage of X ^j -X heterologous polypeptide. 22. The method of claim 20, wherein the gene encoding the protease encodes the Achromobacter lyticus protease Iet vagl trypsin.