FR2656530A1 - Recombinant gene for expression of a protein such as urate oxidase in eukaryotic cells - Google Patents

Abstract

The invention relates to a recombinant gene for expression in eukaryotic cells. This gene contains a DNA sequence which hybridises with a probe of formula: T C D1 A T D2 T C D3 A A D4 T A D5 T G in which the symbols D1, D2, D3, D4 and D5 represent, respectively, (A, G or T), (T or C), (G or A), (G or A) and (G or A> as well as with a probe of formula: A E1 E2 A A E3 C C C C A E4 A A E5 T G in which the symbols E1, E2, E3, E4 and E5 represent, respectively, (G or A), (G or A), (A, G, C or T), (G or A) and (T or C> and codes for a protein of a current molecular weight of approximately 33 kDa which catalyses degradation of a metabolite. Use: production of proteins, in particular urate oxidase.

Description

Recombinant gene for expression in eukaryotic cells of a protein such as urate oxidase
The invention relates to a novel recombinant gene for expression in eukaryotic cells of a protein such as urate oxidase which catalyzes the degradation of a metabolite, an expression vector carrying this gene, eukaryotic cells transformed with this vector. as well as a novel recombinant protein obtained with this gene and a medicament containing the same.

 Urate oxidase (EC 1.7.3.3.), Also known as uricase, is an enzyme in the purine degradation pathway.

This enzyme does not exist in primates (such as humans), birds, some reptiles or most insects.

Some dogs (like Dalmatian) are also lacking.

acide urique + 02
Le radical 02 . substrat de la superoxyde dismutase, est transformé par cette dernière en peroxyde d'hydrogène.In humans, purine bases, adenine and guanine, are converted to xanthine. Xanthine is oxidized by xanthine oxidase to form uric acid according to the reaction: xanthine + H20 + O2

uric acid + 02
The radical 02. substrate superoxide dismutase, is converted by the latter into hydrogen peroxide.

 Uric acid, a metabolite present in the blood, is normally found essentially as a soluble monosodium salt. However, it can happen that in some people uric acid precipitates and forms stones. Hyperuricemia, an increase in the amount of circulating uric acid in the blood, causes the release of uric acid into the cartilaginous tissues, which causes gout. Hyperuricemia can also have consequences on the kidneys: an excess of uric acid in the urine and in the kidneys can lead to uric acid nephrolithiasis, that is to say to the accumulation of kidney stones which are very painful and can damage the kidney. These calculations are composed of uric acid possibly associated with phosphate salts and oxalates.

The overproduction of uric acid can have various origins: Congenital metabolic defects, Lesch syndrome
Nyhan, excessive intake of purine or protein, treatments with uricosuric drugs etc. (Gutman, AB and VU, TF (1968)
Am. J. Med. 45-756-779).

Urate oxidase, an enzyme that catalyzes the degradation of uric acid to allantoin (a much more soluble compound than
Uric acid, which does not crystallize at the concentrations reached in body fluids, is therefore of therapeutic interest. Used in injection, it has a large number of advantages in the treatment of hyperuricemia and nephrolithiasis: speed of the hypo-uricemic effect (decrease of
The order of 50% of hyperuricemia in less than 24 hours), better protection of the kidney against Lithiases compared to other drugs such as allopurinol (xanthine oxidase inhibitor), etc.

 The urate oxidase currently used as a medicament is obtained according to a process comprising the cultivation of an Aspergillus flavus mycelium and the isolation of urate oxidase by extraction of the culture medium, as well as several steps of purification of this protein. This method, which allows obtaining high purity urate oxidase, however, has disadvantages. Indeed, the physiology and especially the genetics of A. flavus are not readily workable (WOLOSHUK et al., (1989) Applied approx.

Microbiol. flight. 55, p. 86-90). It is therefore not possible to obtain strains that produce this enzyme in large quantities.

On the other hand, A. flavus is likely to produce aflatoxins, which are sometimes difficult to separate. It should therefore be checked that the purified product is free of these toxins.

 there is therefore a need for tools and techniques of genetic engineering to overcome these drawbacks.

 The Applicant has constructed a cDNA library from the messenger RNAs of an A strain. flavus cultivated under urate oxidase production conditions, from which it isolated, using two probes constructed on the basis of the partial sequence of experimentally determined flavus urate oxidase, then sequencing a coding cDNA for urate oxidase. She then constructed an E. coli expression vector comprising this cDNA, transformed an Escherichia coli strain K12 with the latter, cultured it and verified that the cell lysate contained a recombinant protein having urate oxidase activity ( ability to degrade uric acid). These results are the subject of French patent application No. 89 09 550, filed July 13, 1989.

 The Applicant has now constructed several expression vectors in eukaryotic cells comprising a recombinant gene coding for urate oxidase, the sequence of which comprises variations relative to the isolated cDNA, introduced with the aim of setting up customary codons in eukaryotic cells, transformed different eukaryotic cells using these vectors, cultivated it in low volume as well as in larger volume (fermenter) and found that the cell lysates contained a high level of a recombinant protein of your expected molecular weight with urate oxidase activity.

The invention thus relates to a recombinant gene for expression in eukaryotic cells of a protein, characterized in that it comprises a DNA sequence which hybridises with a probe of formula 1 2 3 4 TAD5 TG in which the symbols D1, D2, D3, D4 and D5 respectively represent (A, G or T), (T or C), (G or A) (G or A) and (G or
A) as well as with a probe of formula
A E1 E2 AA E3 CCCCA E4 Y E E5 TG in which the symbols E1, E2, E3, E4 and E5 respectively represent (G or A), (G or A), (A, G, C or T), (G or A) and (T or C) and encodes a protein of apparent molecular weight of about 33 kDa, which catalyzes the degradation of a metabolite.

 Preferably this metabolite is uric acid.

A particularly preferred recombinant gene is that encoding the following primary sequence protein: MetSerAlaValLysAlaAlaArgTyrGly LysAspAsnValArgValTyrLysValHis LysAspGluLysThrGlyValGlnThrVal TyrGluMetThrValCysValLeuLeuGlu
GlyGluIleGluThrSerTyrThrLysAla AspAsnSerValIleValAlaThrAspSer IleLysAsnThrIleTyrIleThrAlaLys GlnAsnProValThrProProGluLeuPhe
GlySerIleLeuGlyThrHisPheIleGlu LysTyrAsnHisIleHisAlaAlaHisVal
AsnIleValCysHisArgTrpThrArgMet AspIleAspGlyLysProHisProHisSer PheIleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGlyLysGly
IleAspIleLysSerSerLeuSerGlyLeu ThrValLeuLysSerThrAsnSerGlnPhe
TrpGlyPheLeuArgAspGluTyrThrThr LeuLysGluThrTrpAspArglleLeuSer
ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGlyLeuGlnGluValArgSer
HisValProLysPheAspAlaThrTrpAla ThrAlaArgGluValThrLeuLysThrPhe
AlaGluAspAsnSerAlaSerValGlnAla ThrMetTyrLysMetAlaGluGlnIleLeu
AlaArgGlnGlnLeuIleGluThrValGlu TyrSerLeuProAsnLysHisTyrPheGlu IleAspLeuSerX1HisLysGlyLeuGln AsnThrGlyLysAsnAlaGluValPheAla
ProGlnSerAspProAsnGlyLeuIleLysCysThrValGlyArgSerSerLeuLysSer
LysLeu in which X1 represents Trp or Gly.

 Preferably X1 represents Trp.

Due to the degeneracy of the genetic code, there are a large number of DNA sequences encoding a protein whose sequence corresponds to the formula given above. Among these, a preferred sequence is the following
ATGTCTGCTG TTAAGGCTGC TAGATACGGT AAGGACAACG TTAGAGTCTA
CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA
CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC
GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT
CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC
TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC
AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA
CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG
ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG
ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA
GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG
ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG
CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT
GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA
AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG
TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA
GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG
ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT
AAATTG.

 The invention also relates to an expression vector for eukaryotic cells, which carries the recombinant gene defined above with the means necessary for its expression, its replication in eukaryotic cells and the selection of transformed cells. Preferably, this vector carries a selection marker, chosen, for example, to complement a mutation of the eukaryotic receptor cells, which allows the selection of cells which have integrated the recombinant gene into a high copy number either in their genome or in a vector. multicopie.

 For expression in animal cells, in particular in CHO Chinese hamster ovary cells, the coding sequence is inserted into a plasmid (for example derived from pBR 322) comprising two expression units, a first unit in which is inserted The recombinant gene in front of an effective promoter (for example the SV40 early promoter). The sequence around the initiation ATG is preferably selected according to the consensus sequence described by KOZAK (M. KOZAK (1978) Cell., 15, 1109-1123). An intronic sequence, for example the intron of mouse-globin, can be inserted upstream of the recombinant gene as well as a sequence comprising a polyadenylation site, for example an SV40 polyadenylation sequence, downstream of the recombinant gene. The second expression unit comprises a selection marker (for example a DNA sequence) coding for dihydrofolate reductase (abbreviated enzyme DHFR). The plasmid is transfected into animal cells, for example CHO DHFR cells (unable to express DHFR). A line is selected for its resistance to methotrexate: it has integrated into its genome a high copy number of the recombinant gene and expresses it at a sufficient level.

 For expression in eukaryotic cells such as yeast, for example Saccharomyces cerevisiae, it is appropriate to insert the coding sequence between, on the one hand, sequences recognized as an effective promoter, on the other hand, a transcription terminator. The promoter-coding sequence-terminator assembly, called expression cassette, is cloned either in a plasmatic vector (monocopy or mimeograph) for the yeast, or integrated in multicopy in the genome of the yeast.

 The invention also relates to eukaryotic cells transformed with the above expression vector. Among these, we appreciate the strains of the Saccharomyces cerevisiae species, in particular those which contain a mutation on one of the genes responsible for the synthesis of leucine or uracil, for example the gene LEU2 or the gene URA3.

The invention also relates to a novel recombinant protein sequence as follows:
SerAlaValLysAlaAlaArgTyrGly LysAspAsnValArgValTyrLysValHis
LysAspGluLysThrGlyValGlnThrVal TyrGluMetThrValCysValLeuLeuGlu GlyGlulleGluThrSerTyrThrLysAla AspAsnSerVallleValAlaThrAspSer IleLysAsnThrIleTyrIleThrAlaLys GlnAsnProValThrProProGluLeuPhe
GlySerIleLeuGlyThrHisPheIleGlu LysTyrAsnHisIleHisAlaAlaHisVal AsnIleValCysHisArgTrpThrArgMet AspIleAspGlyLysProHisProHisSer PhelleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGlyLysGly
IleAspIleLysSerSerLeuSerGlyLeu ThrValLeuLysSerThrAsnSerGlnPhe TrpGlyPheLeuArgAspGluTyrThrlhr LeuLysGluThrTrpAspArgIleLeuSer
ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGlyLeuGlnGluValArgSer
HisValProLysPheAspAlaThrTrpAla ThrAlaArgGluValThrLeuLysThrPhe
AlaGluAspAsnSerAlaSerValGlnAla ThrMetTyrLysMetAlaGluGlnlleLeu AlaArgGlnGlnLeuIleGluThrValGlu TyrSerLeuProAsnLysHisTyrPheGlu
IleAspLeuSerTrpHisLysGlyLeuGln AsnThrGlyLysAsnAlaGluValPheAla ProGlnSerAspProAsnGlyLeulleLys CysThrValGlyArgSerSerLeuLysSer
LysLeu possibly preceded by a methionine.

 Indeed, the protein encoded by the cDNA sequences given above can be processed by methionyl aminopeptidase, which cleaves it from its amino-terminal methionine residue.

 The invention also relates to the medicament containing the protein defined above.

The invention will be better understood using the following examples:
many of the following techniques, well known to those skilled in the art, are described in detail in Maniatis et al: "Molecular cloning: a laboratory manual" published in 1984 by Cold Spring Harbor Press editions
New York.

EXAMPLE 1 Isolation of messenger RNAs from AspergiLLus flavus
The strain of A. Urate oxidase producing flavus was cultured under conditions of urate oxidase production, that is to say in a medium containing uric acid of the following composition: glucose 15 g / l, MgSO 4, 7H 2 O 1 g / l , KH2PO4 0.75 g / l, CaCO3 1.2 g / l, uric acid 1.2 g / l, KOH 0.5 g / l, soybean oil 0.66 ml / l, FeSO4.7H20 10 mg / l 1, CuSO 4 · 5H 2 O 1 mg / l, ZnSO 4 · 7H 2 O 3 mg / l, MnSO 4, H 2 O 1 mg / l. The medium is adjusted to pH 7 with 1M H2SO4 and is sterilized at 1200C for 80 min.

 In a 5-liter Erlenmeyer flask, 1.5 l medium is seeded with about 1 to 3 × 10 7 spores.

 The culture is incubated for about 40 hours at 300 ° C. with stirring (120 rpm). The mycelium is recovered by filtration on gauze, washed with water and frozen in liquid nitrogen.

 15 g of mycelium (wet weight) are thawed and resuspended in 45 ml of lysis buffer and then taken up in the same volume of beads (0.45 μm in diameter). The lysis buffer consists of 4M guanidine thiocyanate, 10mM Tris-HCl pH 7.6, 10mM EDTA, 50mg / l mercaptoethanol. The mycelial suspension is ground in a Zellmühler mill (vibrogene) for 5 min.

 The ground material is recovered and the logs are decanted. The supernatant is removed (approximately 45 ml) and brought back to the final 3 M lithium chloride and stored at OOC.

 After two days, it is centrifuged for 60 minutes at 10,000 rpm. The supernatant is discarded and the pellet is taken up in 40 ml of 3M LiCl and recentrifuged at 10,000 rpm for 1 h 30 min.

Proteinase K (SIGMA) was added at 40 μg / ml SDS (0.1% w / v) and EDTA at 20 mM. Incubated at 370C for 3 h. Precipitate with 2 volumes of ethanol, then wash with
Ethanol 70%. The pellet is taken up in 0.5 ml of TE buffer (tris
10 mM EDTA HCl, 1 mM pH 7.5), extracted twice with chloroform, precipitated with ethanol. RNAs are stored at -800C in alcohol.

EXAMPLE 2 Purification of the Poly A RNA Fraction
About 1 mg of RNA is precipitated for 20 minutes at 40 ° C. (15,000 rpm), then washed with 70% ethanol and then dried. The pellet is taken up in 1 ml of TE buffer and resuspended by vortexing. The oligo dT-cellulose type 3 (marketed by Collaborative Research Inc., Biomedicals Product Division) is prepared according to the manufacturer's recommendations. The RNA is deposited on the oligo dT, gently stirred to resuspend the beads, and then heated for 1 min at 650C.

The suspension is adjusted to 0.5 M NaCl and then stirred gently for 10 min. The suspension is then centrifuged for 1 min at 1000 rpm, the supernatant is removed, the pellet is washed twice with 1 ml of TE buffer containing 0.5 M NaCl. Supernatants are eliminated. Elution of the polyadenylated fraction of the RNAs (consisting of the messenger RNAs) is obtained by suspending the beads in 1 ml of TE buffer, then heating this suspension at 600C for 1 min, followed by stirring for 10 min on a tilting plate. . Then centrifuged for 1 min at 1000 rpm, which allows to recover on the one hand the supernatant containing
Free mRNA in solution and secondly the pellet of cellulose beads. All of the above operations (from elution) are repeated. The supernatants thus obtained are combined, the excess beads are removed by centrifugation and the supernatant is precipitated with ethanol containing NaCl according to the usual techniques. (Maniatis: op.cit.

EXAMPLE 3 Constitution of the cDNA library
From the isolated messenger RNAs as described in the previous example, a cDNA library was made in the pTZ19R vector (marketed by PHARMACIA). This vector is a plasmid comprising a polylinker containing unique restriction sites.

The cloning technique used is that described by
Caput et al., (Primer-adapter technique) (Caput et al, Proc Natl Acad Sci (USA) (1986) 83, 16701674)).

It consists on the one hand in digesting the vector with Pst1, adding a polydC tail on the protruding 3 'end, and digesting the plasmids thus obtained with BamHI. The fragment corresponding to the vector is purified on a column of Sepharose CL4B (Pharmacia). It therefore comprises a polydC tail at one end, the other end being cohesive, of the BamHI type. On the other hand,
Messenger RNAs are reverse transcribed from a primer whose sequence is as follows: ## STR2 ##

Thus, the cDNAs at their 5 'end show the sequence
GATCC complementary to the BamHI cohesive end.

The RNA-DNA hybrids obtained by the action of the reverse transcriptase are subjected to an alkaline hydrolysis which makes it possible to get rid of the RNA. The single-stranded cDNAs are then purified by 2 cycles on a column of Sepharose CL4B and subjected to treatment with the transferase terminal so as to add 3 'polydGs. The
CDNA are inserted as a single-stranded form in the vector prepared as described above. A second oligonucleotide "adapt" complementary to the primer is necessary to generate a site
BamHI "open" at the 5 'end of the cDNAs. After hybridization of the vector, the cDNA and the "adapter", the recombinant molecules are circularized by the action of T4 phage ligase. The single-stranded regions are then repaired by means of phage T4 DNA polymerase.

 The pool of plasmids thus obtained serves to transform the MC 1061 strain for ampicillin resistance (Casabadan Chou and Cohen J. Bact (1980) 143 pages 9971-980).

EXAMPLE 4 Determination of the partial sequence of urate
oxidase
A urate oxidase preparation of A. flavus (SIGMA) was repurified by chromatography on a column Red-agarose 120 (SIGMA), followed by filtration on an acrylamide-agarose gel
Ultrogel Aca 44 (IBF).

 In order to obtain information on the amino acid sequence of the purified urate oxidase, allowing the synthesis of the probes necessary for the cloning of the cDNA, a direct aminoterminal sequencing of the protein was attempted. The latter did not succeed, probably because of an amino-terminal blockage of the protein.

 The following strategy was therefore developed for obtaining the partial sequence of urate oxidase - cleavage of the protein by proteolytic enzymes (using the trypsin and V8 protease enzymes of Staphylococcus aureus) - separation of the polypeptides obtained by reverse phase HPLC - sequencing of the purified peptides.

1) Hydrolysis of urate oxidase by trypsin, purification and
sequencing of peptides
urate oxidase at 9 mg / ml in 100 mM ammonium carbonate buffer pH 8.9 was digested with trypsin (Worthington,
TPCK) with a urate oxidase / trypsin ratio of 30/1 by weight at 300C for 24 h. After the tryptic hydrolysis, 60 μg of digested urate oxidase was directly injected onto a Brownlee G18 grafted silica reverse phase HPLC column (column 10 × 0.2 cm), equilibrated with acetonitrile 1 Z (v / v), acidic. The peptides were then eluted by a linear gradient of acetonitrile in a solution of trifluoroacetic acid (0.1% v / v) in water varying from 0.1 to 0.1% (v / v). 1 Z to 60 X acetonitrile in 60 min, with a flow rate of 150 pl / min. The peptides at the outlet of the column were detected by measuring the optical density at 218 nm.

 The elution profile is shown in FIG. 1, in which the numbers following the letter T (Trypsin) correspond to the identified peaks.

 Each peak was collected and stored at -200C until analysis on a protein sequencer (Applied Biosystems Model 470A), equipped with a chromatograph (Applied Biosystems model 430A) that analyzed continuously formed phenyl thiohydantoic derivatives, after each cycle of degradation.

 Table (1) below shows the peptide sequences of the 9 identified peaks.

2) Hydrolysis of urate oxidase by V8 protease, purification and
sequencing of peptides
Urate oxidase, at a concentration of 2 mg / ml in 100 mM ammonium acetate buffer pH 6.8, was digested with Staphylococcus aureus V8 protease (Boehringer-Mannheim) with a urate oxidase / V8 protease ratio. from 60/1 to 300C for 72 hours.

160 μg of digested urate oxidase was then injected onto a Brownlee G18 grafted silica reverse phase HPLC column (10 x 0.2 cm column); particles (7 x 0.03 μm) equilibrated with 1% acetonitrile, 0.1% trifluoroacetic acid (v / v) in water. The peptides were then eluted by a linear gradient of acetonitrile in a solution of trifluoroacetic acid in water (0.1% (v / v)) ranging from 1 to 60% of acetonitrile in 60 min. a flow rate of 150 μl / ml. The peptides at the outlet of the column were detected by measuring the optical density at 218 nm.

 The elution profile is shown in FIG. 2, in which the numbers following the letter V (protease V8) correspond to the identified peaks.

 Each peak was collected and stored at -200C until analysis on the protein sequencer already mentioned.

 Table (1) below shows the peptide sequences of the 5 identified peaks.

TABLE (1)

<SEP> Sequencing <SEP> of <SEP> products <SEP> obtained <SEP> by <SEP> hydrolysis
<tb><SEP> T <SEP> 17 <SEP> Asn-Val-Gln-Valley-Asp-Val-Val-Glu-Gly-Lys
<tb><SEP> T <SEP> 20 <SEP> Asn-Phe-Ser-Gly-Leu-Gln-Glu-Val
<tb><SEP> T <SEP> 23 <SEP> Phe-Asp-Ala Thr-Trp-Ala
<tb> A <SEP> The aid <SEP> of <SEP> T <SEP> 27 <SEP> His-Tyr-Phe-Glu-Ile-Asp-Leu-Ser
<tb><SEP> trypsin <SEP> T <SEP> 28 <SEP> Ile-Leu-Ser-Thr-Asp-VsI-Asp-Ala-Thr-Trp-Gln-Trp-Lys
<tb><SEP> T <SEP> 29 <SEP> His-Tyr-Phe-Glu-Ile-Asp-Leu-Ser-Trp-His-Lys
<tb><SEP> T <SEP> 31 <SEP> Ser-Thr-Asn-Ser-Gln-Phe-Trp-Gly-Phe-Leu-Arg
<tb><SEP> T <SEP> 32 <SEP> Gln-Asn-Pro-Val-Pro-Thr-Pro-Glu-Leu-Phe-Gly-Ser-Ile
<SEP> Leu-Gly-Thr
<tb><SEP> T <SEP> 33 <SEP> Gln-Asn-Pro-Val-Pro-Thr-Pro-Glu-Leu-Phe-Gly-Ser-Ile
<SEP> Leu-Gly-Thr
<tb><SEP> V <SEP> 1 <SEP> Tyr-Ser-Leu-Pro-Asn-Lys-His-Tyr-Phe-Glu-Ile-Asp-Leu
<SEP> Ser-Trp-His-Lys
<tb> A <SEP> The <SEP> Aid of <SEP> V <SEP> 2 <SEP> Val-Thr-Leu-Lys-Thr-Phe-Ala-Glu-Asp-Asn-Ser-Ala-Ser
<SEP> Val-Gin-Ala
<tb> The <SEP> protease <SEP> V <SEP> 3 <SEP> Thr-Ser-Tyr-Thr-Lys-Ala-Asp-Asn-Ser-Val-Ile-Val-Asp
<SEP> Thr-Asp-Ser-Ile-Lys-Asn-Thr-Ile-Tyr-Ile-Thr
## EQU1 ##
<SEP> Thr-Val-Leu-Lys-Ser-Thr-Asn-Ser-Gln-Phe-Trp-Gly-Phe
<SEP> Leu-Arg
<tb><SEP> V <SEP> 6 <SEP> Gly-Lys-Gly-Ile-Asp-Ile-Lys-Ser-Ser-Leu-Ser-Gly-Leu
<SEP> Thr-Val-Leu-Lys
<Tb>
EXAMPLE 5 Screening of the bacteria 1) Preparation of the labeled probes
Two probe pools deduced from amino acid sequences of the protein were synthesized using a DNA synthesizer
Biosearch 4600. The first pool corresponds to the residue sequence
His-Tyr-Phe-Glu-Ile-Asp (part of the sequence of T 27), ie from 5 'to 3'
ATGGG
TCGAT TC AA TA TG
TCAAA
This pool consists of 24 x 3 = 48 different oligonucleotides representing all possible combinations.

The second pool corresponds to the sequence of amino acid residues Gln-Phe-Trp-Gly-Phe-Leu (part of the V5 sequence), ie from 5 'to 3'
GG AGT
AAGCCCCA AA TG
AA CAC
T
This pool consists of 24 x 4 = 64 combinations.

 The probes are labeled with the terminal deoxynucleotide transferase (TdT) (marketed by IBI, Inc.).

 The reaction is carried out on 100 ng of a mixture of oligonucleotides in solution (100 mg / ml) in "Cobalt" reaction buffer (supplied 10 times concentrated by IBI inc .: 1.4 M potassium cocodylate). pH 7.2, 300 mM dithiothreitol, 1 μl deoxynucleotidyl-terminal-transferase enzyme (IBI Inc) and 50 μCi P32-labeled dCTP deoxycytidyltriphosphate.

 The reaction is carried out at 370 ° C. for 10 minutes and then is stopped by adding 1 μl of 0.5 M EDTA.

 It is extracted with phenol and dialyzed on Biogel P 10 polyacrylamide column (Biorad: 150-1050).

2) Hybridization and colony detection containing the cDNA of
urate oxidase
About 40,000 colonies are screened by the in situ hybridization technique developed by Grunstein and Hogness (1975,
Proc. Natl. Acad. Sci. (USA), 72,396). About 6,000 bacteria are plated on Petri dishes to obtain isolated colonies. After incubation for 24 h at 37 ° C., each dish is replicated on 2 filters, each filter being intended to be treated with one of the 2 probe pools, so that all the colonies obtained are tested with the 2 probe pools in parallel.

The filters are hybridized with one of the 2 probe pools in buffer containing 6 x SSC, 10 x Denhardt's and 100 μg / ml of sonicated and denatured salmon sperm DNA (SIGMA). The hybridization temperature is 420C and the duration of 16 hours. The 6 x SSC solution is obtained by diluting a 20 x SSC solution. The preparation of the 20 x SSC buffer is described in Maniatis, Fritsch and
Sambrook (op.cit.). In summary, this buffer contains 175.3 g / l of
NaCl; 88.2 g / l of sodium citrate and is adjusted to pH 7 by a few drops of 10N NaOH. The 10 x Denhardt's solution contains 1 g of Ficoll, 1 g of polyvinylpyrrolidone, 1 g of human serum albumin per 500 ml of final volume.

 After washing in the 6 x ssC solution at 42 ° C. for 3 h with 5 bath changes, the filters are wiped with Joseph paper and subjected to autoradiography. The filters are revealed after 16 hours. It appeared that about 0.5% of the colonies hybridized with the 2 pools of probes.

 5 of these colonies were taken and purified.

The plasmid DNA of each of these colonies was prepared, and this DNA was analyzed by digestion with either BamHI or HindIII, or both BamHI and HindIII.

 After analysis on agarose gel, it appeared that the plasmids obtained are linearized with BamHI and HindIII. The double digestions make it possible to release a fragment corresponding to the integrality of the cloned CDNA. The size of this fragment is about 1.2 Kb in 3 cases, about 0.9 Kb in the other 2 cases. For the determination below, one of the 0.9 Kb fragments and one of the 1.2 Kb fragments which were recloned were selected (see Example 6 below).

EXAMPLE 6 Determination of the sequence of the urate cDNA
oxidase
One of the 0.9 Kb fragment (9A clone) and one 1.2 Kb fragment (9C clone) was recloned into the DNA of the single-stranded phage replicative form. M13. The DNA of the M13 clones containing, on the one hand, the 0.9 Kb fragment and, on the other hand, the 1.2 Kb fragment, was subjected to exonuclease digestion so as to generate a series of overlapping M13 clones (procedure " Cyclone I Biosystem "from IBI). These were sequenced by the dideoxyribonucleotide method (Sanger et al,
PNAS-USA-1977, 14, 5463-5467).

 The nucleotide sequence of clone 9C is shown in FIG. 3 which also indicates by arrow the beginning of clone 9A and by a nucleotide symbol provided with an asterisk the sequenced nucleotides of clone 9A not identical to those of clone 9C (when correspond to the two sequences and the restriction sites Accl and BamHI used in the subsequent constructions (see Example 7).

We observe that
the nucleotide sequence of the longest fragment (clone 9C) overlaps that of the shortest fragment (clone 9A), with two differences (v FIG. 3). One of the differences is silent, the other is a change from a tryptophan residue to a glycine residue. These differences may be due either to differences in the isolated messenger RNAs (see Example 2 above), or to the reverse transcriptase errors used in the constitution of the cDNA library (see Example 3 above).

 In the case of the longest fragment, an ATG codon (at position 109 in FIG. 3) opens an open phase corresponding to a polypeptide of 302 amino acids, with a molecular mass of about 34240 Da, whose sequence corresponds to the partial sequence of Urate oxidase of A. purified flavus (see Example 4).

 FIG. 4 shows the open DNA sequence by the ATG codon and the coded polypeptide, as well as by arrows in relation to the polypeptide encoded with the sequenced peptides (Cf.

Example 4) obtained by hydrolysis of A urate oxidase. flavus using trypsin and V8 protease.

 It is found that the polypeptide sequence ends with the Ser-Lys-Leu triplet, typical of peroxisomal localization enzymes (Gould S.J. et al., J. Cell, Biology 108 (1989) 1657-1664).

EXAMPLE 7 Construction of Three Expression Vectors of the cDNA
of urate oxidase in yeast, Plasmids
pEMR469, pEMR473 and pEMR515
The strategy used uses fragments obtained from publicly available pre-existing plasmids and fragments prepared by synthesis according to the techniques now commonly used. The cloning techniques employed are those described by T. MANIATIS, EF. FRITSCH and J.

SAMBROOK in "Molecular Cloning, a laboratory manual" (Cold Spring
Harbor Laboratory, 1984). The synthesis of the oligonucleotides is carried out using a Biosearch DNA synthesizer 4,600.

 The following description will be better understood on reading FIGS. 5, 6 and 7 which respectively represent restriction maps of plasmid pEMR414, and plasmids pEMR469 and pEMR473. The symbols used in these figures will be specified in the following description. In the case where a site has been made free by the Kleenow polymerase, it is assigned the index ""; when the sites have been removed by ligation, they are indicated in parentheses.

1) Construction of the plasmid pEMR469
This plasmid was constructed from the shuttle vector
E. coli-yeast pEMR414, constructed by successive ligations of the elements hereafter
the PstI-HindIII fragment - symbolized by ++++ in Figure 5 - of the plasmid pJDB207 (BEGGS, 1978: Gene cloning in yeast-p.175-203 in: Genetic Engineering vol 2 - WILLIAMSON
Academic Press - London UK) comprising the upstream portion of the Amp R ampicillin resistance gene of pBR322 (Sutcliffe 1979 Cold
Spring Symp. Quart.Biol. 43, 779) and an endogenous 2 P fragment of form B bearing the LEU2 gene of S. cerrevisiae partially deleted from its promoter (called LEU2d), the STB locus (REP3) and the 2 p replication origin (HARTLEY and DONELSON). 1980, Nature 286, 860-865). The HindIII end of this fragment was made blunt by the action of Kleenow polymerase. It is denoted HindIII in FIG.

sur la figure 5 - du chromosome V de levure contenant le gène URA3 avec son promoteur (ROSE et al., 1984, Gene, 29, p. 113-124). Ce fragment HindIII-SmaI provient du plasmide pFL1 (CHEVALLIER et al., 1980, Gene 11, 11-19)). L'extrémité HindIII de ce plasmide a été rendue franche par l'action de la polymérase de Kleenow.the HindIII-SmaI fragment - represented by

Figure 5 - V yeast chromosome containing the URA3 gene with its promoter (ROSE et al., 1984, Gene, 29, pp. 113-124). This HindIII-SmaI fragment comes from plasmid pFL1 (CHEVALLIER et al., 1980, Gene 11, 11-19)). The HindIII end of this plasmid was made blunt by the action of Kleenow polymerase.

sur la figure 5 - contenant une version synthétique du promoteur du gène
ADH2 ne différant de la version naturelle décrite par RUSSEL et
SMITH (RUSSEL et al., 1983). J. Biol. Chem. 258, 2674-2682) que par quelques paires de bases destinées à introduire des sites de restriction. (La séquence naturelle pourrait être utilisée avec des résultats peu différents).La séquence de ce fragment est donnée ci-après :
S M
m I
a u
I I
VGGGACGCGTCTCCTCTGCCGGAACACCGGGCATCTCCAACTTATAAGTTGGAG
-------±--------±--------±--------±--------±----
CCCTGCGCAGAGGAGACGGCCTTGTGGCCCGTAGRGGTTGAATATTCAACCTC
AAATAAGAGAATTTCAGATTGAGAGAATGAAAAAAAAAAAAAAAAAAAAGGCAGRGGAGA ---±--------±------±----------±---------±-------±----
TTTATTCTCTTAAAGTCTAACTCTCTTACTTTTTTTTTTTTTTTTTTTTCCGTCTCCTCT
S
P
h
I
GCATAGAAATGGGGTTCACTTTTTGGTAAAGCTATAGCATGCCTATCACATATAAATAGA ---±--------±--------±--------±--------±--------±----
CGTATCTTTACCCCAAGTGAAAAACCATTTCGATATCGTACGGATAGTGTATATTTATCT
GTGCCAGTAGCGACTTTTTTCACACTCGAGATACTCTTACTACTGCTCTCTTGTTGTTTT ---±--------±--------±--------±--------±--------±----
CACGGTCATCGCTGAAAAAAGTGTGAGCTCTATGAGAATGATGACGAGAGAACAACAAAA
TATCACTTCTTGTTTCTTCTTGGTAAATAGAATATCAAGCTACAAAAAGCATACAATCAA ---±--------±--------±--------±--------±--------±----
ATAGTGAAGAACAAAGAAGAACCATTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTT
B
C a
l m
a H
l l
CTATCAACTATTAACTATATCGATACCATATGGATCCGTCGACTCTAGAGGATCGTC ---±--------±--------±--------±--------±--------±-
GATAGTTGATAATTGATATAGCTATGGTATACCTAGGCAGCTGAGATCTCCTAGCAG
B
a
m
H
GACTCTAGAG
--------+
CTGAGATCTCCTAG - le fragment BgIII-HindIII - symbolisé par

sur la figure 5 - portant L'extrémité 3' du gène PGK de levure. Ce fragment provient de la digestion complète à l'aide de BgIII du fragment HindIII de l'ADN chromosomique de levure, portant le gène
PGK décrit par HITZEMAN et al. (1982 Nucleic Acids Res., 10, 7791-7808) lequel ne présente qu'un site BgIII. Cette digestion permet d'obtenir deux fragments HindIII-BgIII, dont le plus petit d'environ 0,4 Kb, qui porte l'extrémité 3' du gène PGK de levure est retenu. La séquence de ce dernier fragment est décrite par
HITZEMANN et al. (référence citée ci-dessus). Le site BgIII est cloné dans le site BamHI du fragment précédent (les sites BamHI et
BgIII disparaissent donc) et le site Hindîli, rendu franc par action de la polymérase de Kleenow, est cloné dans le site PvuII du fragment de PvuII-PstI pBR322 décrit ci-après.- a fragment SamI-BamhI - symbolized by

in Figure 5 - containing a synthetic version of the gene promoter
ADH2 does not differ from the natural version described by RUSSEL and
SMITH (RUSSEL et al., 1983). J. Biol. Chem. 258, 2674-2682) only by a few base pairs to introduce restriction sites. (The natural sequence could be used with little different results). The sequence of this fragment is given below:
SM
m I
the
II
VGGGACGCGTCTCCTCTGCCGGAACACCGGGCATCTCCAACTTATAAGTTGGAG
------- ± -------- ± -------- ± -------- ± -------- ± ----
CCCTGCGCAGAGGAGACGGCCTTGTGGCCCGTAGRGGTTGAATATTCAACCTC
AAATAAGAGAATTTCAGATTGAGAGAATGAAAAAAAAAAAAAAAAAAAAGGCAGRGGAGA --- ± -------- ± ------ ± ---------- ± --------- ± ------- ± ----
TTTATTCTCTTAAAGTCTAACTCTCTTACTTTTTTTTTTTTTTTTTTTTCCGTCTCCTCT
S
P
h
I
GCATAGAAATGGGGTTCACTTTTTGGTAAAGCTATAGCATGCCTATCACATATAAATAGA --- ± -------- ± -------- ± -------- ± -------- ± -------- ± ----
CGTATCTTTACCCCAAGTGAAAAACCATTTCGATATCGTACGGATAGTGTATATTTATCT
GTGCCAGTAGCGACTTTTTTCACACTCGAGATACTCTTACTACTGCTCTCTTGTTGTTTT --- ± -------- ± -------- ± -------- ± -------- ± -------- ± ----
CACGGTCATCGCTGAAAAAAGTGTGAGCTCTATGAGAATGATGACGAGAGAACAACAAAA
TATCACTTCTTGTTTCTTCTTGGTAAATAGAATATCAAGCTACAAAAAGCATACAATCAA --- ± -------- ± -------- ± -------- ± -------- ± -------- ± ----
ATAGTGAAGAACAAAGAAGAACCATTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTT
B
C a
lm
a H
It
CTATCAACTATTAACTATATCGATACCATATGGATCCGTCGACTCTAGAGGATCGTC --- ± -------- ± -------- ± -------- ± -------- ± -------- ± -
GATAGTTGATAATTGATATAGCTATGGTATACCTAGGCAGCTGAGATCTCCTAGCAG
B
at
m
H
GACTCTAGAG
-------- +
CTGAGATCTCCTAG - the BgIII-HindIII fragment - symbolized by

in Figure 5 - carrying the 3 'end of the yeast PGK gene. This fragment comes from the complete digestion with BgIII of the HindIII fragment of the chromosomal yeast DNA, carrying the gene
PGK described by HITZEMAN et al. (1982 Nucleic Acids Res., 10, 7791-7808) which has only one BglII site. This digestion makes it possible to obtain two HindIII-BglII fragments, of which the smallest of about 0.4 Kb, which carries the 3 'end of the yeast PGK gene is retained. The sequence of this latter fragment is described by
HITZEMANN et al. (reference cited above). The BglII site is cloned into the BamHI site of the previous fragment (the BamHI and
BglII therefore disappear) and the HindIII site, rendered free by the action of Kleenow polymerase, is cloned into the PvuII site of the PvuII-PstI fragment pBR322 described hereinafter.

the PvuII-PstI fragment symbolized by amar in FIG. 5 of pBR322 containing the origin of replication and the downstream part of the ampicillin resistance gene Amp R
The plasmid pEMR414 thus constituted thus comprises the following elements:
-an origin of repetition and a gene of resistance to
Ampicillin AmpR allowing replication and selection of the plasmid in E. coli cells. These elements allow transformation into E. coli cells.

- an origin of replication for yeast (ARS), the locus
STB and the S. cerevisiae gene LEU2 without promoter and the URA3 gene with its S. cerevisiae promoter. These elements allow the replication and selection of the plasmid in the cells of
S. cerevisiae and sufficient partitioning efficiency in cells containing the endogenous 2p plasmid.

 Plasmid pEMR414 was fully digested with restriction enzymes NheI and ClaI. The small NheI-ClaI fragment containing the URA3 gene, hereinafter called fragment A, was purified.

 Plasmid pEMR414 was subjected to complete digestion with NheI and BamHI enzymes. The large NheI-BamHI fragment containing, in particular, the LEU2d gene and the origin of replication of the plasmid pBR322, hereinafter called fragment B, was purified.

On the other hand, the synthetic fragment was prepared
ClaI-AccI containing the beginning of a gene coding for the protein deduced from the urate oxidase cDNA sequence (clone 9C). This fragment has modifications relative to clone 9C, introduced in order to set up customary codons in yeast (see SHARP et al., 1986, Nucl Ac Res, Vol 14, 13, pp. 5125). -5143) without changing the encoded amino acids. The sequence of this fragment, hereinafter referred to as fragment C, is the following (the underlined nucleotides are those modified with respect to clone 9C).

IT
I cc
II
CGATATACACAATGTCTGCTGTTAAGGCTGCTAGATACGGTAAGGACAACGTTAGAGT + + + +
TATATGTGTTACAGACGACAATTCCGACGATCTATGCCATTCCTGTTGCAATCTCAGA
The plasmid of clone 9C (see FIG. 3) was digested with the enzymes AccI and BamHI. The AccI-BamHI fragment which contains the end of the urate oxidase cDNA, hereinafter called fragment D, has been purified. This fragment has the following sequence:
accl
CTACAAGGTTCACAAGGACGAGAAG
- ± -------- ± -------- +
TGTTCCAAGTGTTCCTGCTCTTC
ACCGGTGTCCAGACGGTGTACGAGATGACC GTCTGTGTGCTTCTGGAGGGTGAGATTGAG --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
TGGCCACAGGTCTGCCACATGCTCTACTGG CAGACACACGAAGACCTCCCACTCTAACTC
ACCTCTTACACCAAGGCCGACAACAGCGTC ATTGTCGCAACCGACTCCATTAAGAACACC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
TGGAGAATGTGGTTCCGGCTGTTGTCGCAG TAACAGCGTTGGCTGAGGTAATTCTTGTGG
ATTTACATCACCGCCAAGCAGAACCCCGTT ACTCCTCCCGAGCTGTTCGGCTCCATCCTG --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
TAAATGTAGTGGCGGTTCGTCTTGGGGCAA TGAGGAGGGCTCGACAAGCCGAGGTAGGAC
GGCACACACTTCATTGAGAAGTACAACCAC ATCCATGCCGCTCACGTCAACATTGTCTGC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
CCGTGTGTGAAGTAACTCTTCATGTTGGTG TAGGTACGGCGAGTGCAGTTGTAACAGACG
CACCGCTGGACCCGGATGGACATTGACGGC AAGCCACACCCTCACTCCTTCATCCGCGAC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
GTGGCGACCTGGGCCTACCTGTAACTGCCG TTCGGTGTGGGAGTGAGGAAGTAGGCGCTG
AGCGAGGAGAAGCGGAATGTGCAGGTGGAC GTGGTCGAGGGCAAGGGCATCGATATCAAG --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
TCGCTCCTCTTCGCCTTACACGTCCACCTG CACCAGCTCCCGTTCCCGTAGCTATAGTTC
TCGTCTCTGTCCGGCCTGACCGTGCTGAAG AGCACCAACTCGCAGTTCTGGGGCTTCCTG --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
AGCAGAGACAGGCCGGACTGGCACGACTTC TCGTGGTTGAGCGTCAAGACCCCGAAGGAC
CGTGACGAGTACACCACACTTAAGGAGACC TGGGACCGTATCCTGAGCACCGACGTCGAT --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
GCACTGCTCATGTGGTGTGAATTCCTCTGG ACCCTGGCATAGGACTCGTGGCTGCAGCTA
GCCACTTGGCAGTGGAAGAATTTCAGTGGA CTCCAGGAGGTCCGCTCGCACGTGCCTAAG --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
CGGTGAACCGTCACCTTCTTAAAGTCACCT GAGGTCCTCCAGGCGAGCGTGCACGGATTC
TTCGATGCTACCTGGGCCACTGCTCGCGAG GTCACTCTGAAGACTTTTGCTGAAGATAAC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
AAGCTACGATGGACCCGGTGACGAGCGCTC CAGTGAGACTTCTGAAAACGACTTCTATTG
AGTGCCAGCGTGCAGGCCACTATGTACAAG ATGGCAGAGCAAATCCTGGCGCGCCAGCAG --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
TCACGGTCGCACGTCCGGTGATACATGTTC TACCGTCTCGTTTAGGACCGCGCGGTCGTC
CTGATCGAGACTGTCGAGTACTCGTTGCCT AACAAGCACTATTTCGAAATCGACCTGAGC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
GACTAGCTCTGACAGCTCATGAGCAACGGA TTGTTCGTGATAAAGCTTTAGCTGGACTCG
TGGCACAAGGGCCTCCAAAACACCGGCAAG AACGCCGAGGTCTTCGCTCCTCAGTCGGAC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
ACCGTGTTCCCGGAGGTTTTGTGGCCGTTC TTGCGGCTCCAGAAGCGAGGAGTCAGCCTG
CCCAACGGTCTGATCAAGTGTACCGTCGGC CGGTCCTCTCTGAAGTCTAAATTGTAAACC --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
GGGTTGCCAGACTAGTTCACATGGCAGCCG GCCAGGAGAGACTTCAGATTTAACATTTGG
AACATGATTCTCACGTTCCGGAGTTTCCAA GGCAAACTGTATATAGTCTGGGATAGGGTA --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
TTGTACTAAGAGTGCAAGGCCTCAAAGGTT CCGTTTGACATATATCAGACCCTATCCCAT
TAGCATTCATTCACTTGTTTTTTACTTCCA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA --------- ± -------- ± -------- + --------- ± -------- ± - ------- +
ATCGTAAGTAAGTGAACAAAAAATGAAGGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT A ~ GGGCCCG

2) Construction du plasmide pEMR473 :
Le plasmide pEMR469 a été soumis à une digestion complète par les enzymes MluI et SphI. Le grand fragment MluI-SphI contenant le gène de l'urate oxydase a ensuite été ligué au fragment synthétique, de séquence donnée ci-après, correspondant à une partie (200 pb) de la séquence en amont de l'élément TATA du promoteur
GAL 7 de S. cerevisiae, laquelle comprend les séquences d'activation amont (upstream activation sequences : UAS).BamHI --------- ± -------- ± ------
TTTTTTTTTTTTTTTTTTTTTCCCGGGCCT AG
Fragments A, B, C and D were ligated to obtain the plasmid pEMR469 shown in FIG. 6, in which the symbols have the same meaning as in FIG. 5, the new Clai-Acc1 and AccI-BamHI fragments being symbolized by

2) Construction of the plasmid pEMR473
Plasmid pEMR469 was subjected to complete digestion by the MluI and SphI enzymes. The large MluI-SphI fragment containing the urate oxidase gene was then ligated to the synthetic fragment, of sequence given below, corresponding to a portion (200 bp) of the sequence upstream of the TATA element of the promoter.
GAL 7 of S. cerevisiae, which comprises the upstream activation sequences (UAS).

3) Construction du plasmide pEMR515 :
Le plasmide pEMR473 a été soumis à une digestion partielle par l'enzyme XbaI et à une digestion totale par l'enzyme MluI. Le grand fragment XbaI-MluI a été purifié. Ce fragment contient notamment les séquences de l'origine de réplication et le
Locus STB du 2 , le gène LEU2d, Le gène de résistance à L'ampicil
Line AmpR, L'origine de réplication du pBR322 et La cassette d'expression de l'urate oxydase. Il ne contient en revanche ni le gène URA3, ni la partie du 2 comprise entre lessites XbaI et
NheI.M
l
u
l
CGCGTCTATACTTCGGAGCACTGTTGAGCGAAGGCTCATTAGATATATTTTCTCTCAT
- ± ± ------- -------- --------- ± -------- ± -------- ± ± - -
AGATATGAAGCCTCGTGACAACTCGCTTCCGAGTAATCTATATAAAAGACAGTA
TTTCCTTAACCCAAAAATAAGGGAGAGGGTCCAAAAAGCGCTCGGACAACTGTTGACCGT
---- ± -------- ± -------- ± ---------- ------ ± -------- ± ± ---
AAAGGAATTGGGTTTTTATTCCCTCTCCCAGGTTTTTCGCGAGCCTGTTGACAACTGGCA
GATCCGAAGGACTGGCTATACAGTGTTCACAAAATAGCCAAGCTGAAAATAATGTGTAGC
---- ± -------- ± -------- ± -------- ± -------- ± -------- ± ---
CTAGGCTTCCTGACCGATATGTCACAAGTGTTTTATCGGTTCGACTTTTATTACACATCG
s
p
h
1
CTTTAGCTATGTTCAGTTAGTTTGGCATG
---- ± -------- ± -------- ± -
GAAATCGATACAAGTCAATCAAACC
The plasmid pEMR473 thus obtained is represented in FIG. 7, in which the symbols have the same meaning as in FIG. 6, the new MluI-SphI fragment introduced being symbolized by

3) Construction of the plasmid pEMR515
Plasmid pEMR473 was partially digested with the enzyme XbaI and digested to completion with the enzyme MluI. The large XbaI-MluI fragment has been purified. This fragment contains in particular the sequences of the origin of replication and the
STB locus 2, the LEU2d gene, the ampicil resistance gene
Line AmpR, the origin of replication of pBR322 and the expression cassette of urate oxidase. On the other hand, it contains neither the URA3 gene nor the part of the 2 between XbaI and
NheI.

The large XbaI-MluI fragment was recircularized via the following sequence adapter comprising modified XbaI and MluI cohesive ends:
XbaI modified
tCTAGGCTAGCGGGCCCGCATGCA
CGATCGCCCGGGCGTACGTGCGCÂ
MluI
The plasmid pEMR515 thus obtained has only one of the three elements of the target FRT site of the recombinase encoded by the FLP gene of 2p.

EXAMPLE 8 Transformation of the yeast strain EMY761 by the
plasmids pEMR469, pEMR473 and pEMR515 - Transformation
strains of yeasts EMY500 and GRF18 by the plasmid
pEMR515 - Transformation with selection for either the
prototrophy of uracil, either for prototrophy
leucine
As recipient strains, three strains of
Non-isogenic Saccharomyces cerevisiae: strain EMY761 (Mata, leu2, ura3, his3, gal) - strain EMY500 (Mata, leu2, ura3, pep4) - strain GRF18 (Mata, leu2, his3);
The GRF18 strain is well known to those skilled in the art (Gerry FINK, MIT, USA). The EMY761 and EMY500 strains are related to the GRF18 strain. They were obtained by successive crosses of strain GRF18 with a strain ura3 derived from strain FL100 (deposited with ATCC under No. 28383) and with strain 20B12 (Mata, tspl, pep4) described by EW JONES (EW JONES et al.

(1977) Genetics, 85, 23).

The strain GRF18 can be obtained by dissection of the plasmid pEMR515 of the strain GRF18 pEMR515 (Leu +) deposited at the CNCM under the reference No. I-920, on December 28, 1989 and the strain EMV5OO by dissection of the plasmid pEMR515 of the EMYSOO strain pEMR515 ( Leu +)
o filed with the CNCM under the reference No. I-919, on December 28, 1989.

 These strains contain mutations (Leu2 and ura3), which can be complemented by the defective selection marker LEU2d and the selection marker URA3, present in each of the plasmids pEMR469 and pEMR473.

1) Transformation with selection for the prototrophy of
Uracil:
A colony of the EMY761 strain was used to inoculate 100 ml of a medium called YPG liquid medium (see Table 1 below). When obtaining a cell density of 107 cells per ml, the cells were treated with 0.2 M lithium acetate for the transformation according to a technique well known to those skilled in the art, described by ITO et al. (ITO et al., 1983, J. Bacteriology 153, 163-168).

The EMY761 cells were transformed in parallel with about 1 μg of each of plasmids pEMR469 and pEMR473. The transformed cells are selected for the auxotrophic character of uracil (ura) on a medium called solid medium without uracil, (see Table I below). We thus retained a transformed
EMY761 pEMR469 (ura) and an EMY761 pEMR473 (ura +) transformant.

2) Transformation with selection for Leucine prototrophy:
The transformation technique used is a variant of that described by Beggs et al. (Beggs et al (1978), Nature 275, 104-109). It consists in subjecting the yeasts to protoplastisation treatment in the presence of an osmotic stabilizer, sorbitol in 1M concentration.

The precise transformation protocol is specified below:
a) 200 ml of the liquid YPG medium (see Table I) are inoculated with approximately 5 × 10 6 cells of a stationary phase culture and the culture thus inoculated is placed overnight with stirring at 30 ° C.

 b) When the culture reaches about 107 cells per ml, the cells are centrifuged at 4000 rpm for 5 min and the pellet is washed with 1 M sorbitol.

 c) The cells are suspended in 5 ml of 1M sorbitol solution containing 25 mM EDTA and 50 mM dithiothreitol and incubated for 10 min at 300C.

 d) The cells are washed once with 10 ml of 1 M sorbitol and suspended in 20 ml of sorbitol. Zymolase-100T (preparation obtained by partial purification on an affinity column of the Arthobacter luteus culture supernatant and containing p-1,3-glucan-laminaripentahydrolase, marketed by SEYKAGAKU KOGYO Co. Ltd) is added to a final concentration of 20 μg / ml and the suspension is incubated at room temperature for about 15 minutes.

 e) The cells are resuspended in 20 ml of a medium containing sorbitol called YPG sorbitol oof medium. Table I below) and incubated for 20 min at 30 C with gentle shaking.

 f) Centrifugation for 3 min at 2500 rpm.

 g) Resuspend in 9 ml of transformation buffer (1 M sorbitol, tris-HCl pH 7.5 10 mM and 10 mM CaCl 2).

 h) 0.1 ml of cells and 5 .mu.l of DNA solution (about 5 .mu.g) are added and the resulting suspension is left for 10-15 min at room temperature.

i) 1 ml of the solution is added: polyethylene glycol
20% PEG 4000, 10 mM pH 7.5 tris-HCl and 10 mM CaCl 2.

 j) 0.1 ml of the suspension obtained in 9) is poured into a tube containing regeneration solid medium without leucine (cf.

Table I below) previously melted and kept liquid at approximately 450C. The suspension is poured onto a petri dish containing a solidified layer of 15 ml of solid regeneration medium without Leucine.

 k) Step j) is repeated with the rest of the cell suspension obtained in 9 h).

 The transformed ones begin to appear after three days.

 The transformants EMY761 pEMR469 (Leu +), EMY761 pEMR473 (leu), EMY761 pEMR515 (Leu +), GRF18 pEMR515 (leu +) and EMY500 pEMR515 (Leu +) were thus retained.

TABLE I
Main Media Used in Examples 8, 9, 10 and 11 - Solid Medium Without Uracil
6.7 g yeast nitrogen base without amino acids
(Yeast nitrogen base with Amino Acids from DIFCO)
5.0 g of casein hydrolyzate (Casamino acids from DIFCO)
10 g of glucose
20 g of agar
mix all ingredients in distilled water, complete
the final volume at 1 I with distilled water. Autoclave 15 min
at 12O0C.

- liquid medium without uracil
Use the solid mitieu formula without uracil by omitting
Agar-Autoclaver 15 min at 120 C.

- solid medium without leucine
6.7 g yeast nitrogen base without amino acids
(Yeast nitrogen base with Amino Acids from DIFCO)
20 mg of adenine
20 mg of uracil
20 mg of l-tryptophan
20 mg of l-histidine
20 mg of l-arginine
20 mg of 1-methionine
30 mg of l-tyrosine
30 mg of l-isoleucine
30 mg l-lysine
50 mg of l-phenylalanine
100 mg glutamic acid
150 mg of l-valine
400 mg leucine
20 g of glucose
20 g of agar
mix all the ingredients in the distilled water.Complete the
final volume at 1 I with distilled water - Autoclave 15 min at
1200C. After autoclaving, add 200 mg of 1-threonine and 100 mg
of l-aspartic acid.

solid regeneration medium without leucine
use the solid medium formula without leucine by mixing
30 g of agar instead of 20 and adding to the mixture 182 g of
sorbitol.

- liquid medium without leucine
use the solid medium formula without leucine omitting
agar - Autoclave 15 min at 1200C. After autoclaving, add
200 mg of 1-threonine and 100 mg of l-aspartic acid.

- YP liquid medium
10 g of yeast extract (Bacto-yeast extract from DIFCO)
20 g of peptone (Bacto-peptone from DIFCO)
mix the ingredients in distilled water. Complete the
final volume at 1 liter with distilled water - autoclave 15 min.
1200C.

- liquid YPG medium
use the formula of the liquid YP medium to which one adds, after
autoclaving, glucose at a concentration of 20 g / l.

- YPG sorbitol medium
use your formula of the liquid YPG medium to which one adds, after
autoclaving, sorbitol at a concentration of 1 M.

YP ethanol-glycerol medium
use the formula of the liquid YP medium. After autoclaving,
add 10 ml of 100% ethanol (1% final) and 30 g of glycerol.

- YP ethanol-glycerol-galactose medium
use the formula of the liquid YP medium. After autoclaving,
add 10 ml of 100% ethanol, 30 g of glycerol and 30 g of galac
tose.

EXAMPLE 9 Erlenmeyer Expression of the Urate Oxidase cDNA
by EMY761 strains pEMR469 (ura +), EMY761 pEMR473
(ura +), EMY761 pEMR469 (Leu +) and EMY761 pEMR473 (Leu +)
- Western blot immunodetection, assaying the activity
urate oxidase and soluble proteins
I) Expression of urate oxidase cDNA:
a) Selected strains on medium without uracil
A colony of each of the EMY761 pEMR469 (ura) and EMY761 pEMR473 (ura +) strains was cultured in 20 ml of liquid medium without uracil (see Table I, Example 8). After one night at 300C with stirring, the two cultures were centrifuged for 10 min at 7000 rpm. The pellets were taken up in 10 ml of sterile distilled water and further centrifuged for 10 min at 7000 rpm. . Expression of urate oxidase was induced by resuming the cells in 20 ml of YP ethanol-glycerol medium (see Table I, Example 8) for EMY761 strain pEMR469 (ura +) and 20 ml of YP ethanol-glycerol medium. galactose (see Table I, Example 8) for EMY761 strain pEMR473 (ura). The cultures were returned to 30 ° C. with stirring for 22 h.

b) Selected strains on medium without leucine
Firstly, a colony of each of the EMY761 pEMR469 (leu) and EMY761 pEMR473 (leu) strains was cultured in 20 ml of liquid medium without leucine (see Table I, Example 8). This made it possible to obtain and maintain a high number of plasmid copies by selecting for the complementation of the Leu2 mutation by the LEU2d gene carried by
Plasmids pEMR469 and pEMR473.

 After one night at 30 ° C. with stirring, the two cultures were centrifuged for 10 minutes at 7000 rpm. The pellets were taken up in 10 ml of sterile distilled water and again centrifuged for 10 min at 7000 rpm. The expression of urate oxidase was induced by taking up the cells in 20 ml of YP ethanol-glycerol medium for EMY761 strain pEMR469 (leu +) and 20 ml of YP ethanol-glycerol-galactose medium (see Table I, example 8) for the strain EMY761 pEMR473 (leu). The cultures were returned to 300C with stirring for 22 h.

c) Control strain
The untransformed EMY761 strain, i.e. without plasmid, was cultured as above. It was firstly induced in 10 ml of YP ethanol-glycerol liquid medium and, on the other hand, induction in 10 ml of YP ethanol-glycerol galactose medium.

2) Sample preparation:
a) The cells grown in la), 1b) and 1c) were centrifuged and the supernatant was removed. The pellets were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The pellets thus washed were taken up in approximately 1 ml of TEA triethyleneamine buffer of pH 8.9. About 300 μl of cells thus recovered were read in the presence of glass beads (400 to 500 μm in diameter) representing about half of the final volume. This mixture was vortexed vigorously for 1 min, 4 times, the samples being placed for 30 s in ice between each grinding. The liquid was removed from the tubes with a pasteur pipette and transferred to a microtube. The glass beads were washed once with about 200 μl of TEA buffer of pH 8.9. The beads were vortexed for 1 min, 1 time, and the liquid was removed by pipette pasteur to be added to the previous lysate. The lysate was then centrifuged in a microtube for 5 min at 7000 rpm. The supernatant was carefully removed and stored at -20 ° C. for the Western Blot, the urate oxidase activity assay and the protein assay. The pellet of the lysed cells was stored separately at -20 ° C for Western
Blot (see 3) below).

 On the other hand, culture samples taken in la) and lb) were carried out as follows before induction: 2 ml of culture were centrifuged for 10 min at 7000 rpm. The pellets were taken up in 500 ul of distilled water and again centrifuged for 5 min at 7000 rpm. The pellets were taken up in about 200 μl of TEA buffer of pH 8.9 and lysed as above in the presence of glass beads. The supernatants and pellets of the lysed cells were stored at -200C separately.

3) Immunodetection of urate oxidase by Western Blot:
a) Operating mode
The pellets and the supernatants of the various samples were subjected to a Western Blot, a technique well known to those skilled in the art, which comprises the following steps: - solubilization of the pellet by boiling for 10 min in a
buffer called loading buffer consisting of 0.125 M tris-HCl
pH 6.8 SDS 4X, bromophenol blue 0.002X, 20X glycerol,
p-mercaptoethanol 10 X (according to the protocol described by LAEMMLI
(UK LAEMMLI, Nature, 227 (1970), 680-685)), (step
only for pellets), - electrophoretic separation of the various proteins contained
in the solubilisate according to the protocol described by LAEMMLI (UK

LAEMMLI, Nature, 227 (1970), 680-685), transfer of said proteins contained in the gel to a filter
nitrocellulose (according to the technique of H. TOWBIN et al Proc.

Natl. Acad. Sci. USA 76 (1979) 4350-4354),
Immunodetection, carried out according to the technique of
BURNETTE (WW BURNETTE Ana Biochem 112 (1981) 195-203) successively implies:
Rinse the nitrocellulose filter for 10 min with
A buffer (10 mM Tris-HCl, 170 mM NaCl, 1 mM KI).

The contacting of the nitrocellulose filter during
30 min at 370 ° C. with buffer B (buffer A with added
bovine serum albumin at a rate of 3 g per 100 ml).

The contacting of the nitrocellulose filter for 1 hour
at 370C with antiserum (polyclonal antibodies
recognizing the urate oxidase of A. flavus).

 Rinsing the nitrocellulose filter with buffer B.

The contacting of the nitrocellulose filter for 1 hour
at 370C with 125 I-labeled G protein solution
at 0.1 microcurie / ml.

 Rinsing the filter with buffer A.

 The drying of the filter between two absorbent sheets.

 The contacting of an X-ray film.

 . The revelation of the film.

b) Results
It is found that the EMY761 pEMR469 (ura +), EMY761 pEMR473 (ura +), EMY761 pEMR469 (leu +) and EMY761 pEMR473 (leu +) strains produce an apparent molecular weight protein of approximately 33 KDa which is recognized by the antibodies directed against the urate oxidase of A. flavus and is absent from the control strain.

 It is also found that the uninduced strains do not produce or very little of the protein described above.

 Comparison between the quantities of this protein for the pellets and the supernatants makes it possible to deduce that about 80% of this protein is in soluble form in the lysate.

4) Determination of urate oxidase activity
The urate oxidase activity was measured on the supernatants of the lysed cells.

a) Principle
The transformation of uric acid to allantoin is followed by the decrease in absorbance at 292 nm. The reaction is as follows:

<tb><SEP> Urate <SEP> Oxidase <SEP> H2NCt <SEP> N
<tb>"" y "\ g
<tb><SEP> H20 <SEP> + <SEP> 2 <SEP> H20 <SEP> * <SEP> C02
<Tb>
Uric acid Allantoine
(absorbing at 292 nm)
b) Reagents
a) 0.05 M TEA buffer pH 8.9 / EDTA - dissolve 7.5 g of TEA (reagent for analysis-Prolabo ref.

287.46.266) in 400 ml of distilled water, dissolve 0.372 g of Complexon III (Merck-ref 8418) in 50 ml of distilled water, combine the two solutions and make up to 500 ml (solution 1), adjust the pH of this solution to 8.9 with 0.2N HCl, - make up to 1000 ml with distilled water (solution 2).

 b) Uric acid Stock solution - dissolve 100 mg of uric acid (Carbiochem No. 6671) in 50 ml of solution 1, - adjust with 0.2N HCl to pH 8.9, - make up to 100 ml with distilled water.

 The solution obtained can be kept one week at 4 C.

 c) Uric acid Solution Substrate - withdraw 1.5 ml uric acid stock solution (carbiochem ref.

6671) and dilute to 100 ml with TEA buffer / reagent for analysis
Prolabo ref. 287.46.266).

 This solution should be used during the day.

c) Operating procedure
The following volumes are introduced into the quartz vat of a spectrophotometer set at 292 nm and thermostated at 30 ° C.: 600 μl of uric acid solution substrate (preheated to 300 ° C.), 100 μl of the above supernatants to which 200 l of TEA pH 8.9 (preheated to 30 ° C.) were added.

 The optical density change, hereinafter sometimes abbreviated as OD, is mixed and read every 30 seconds for 5 minutes. We deduce #E, variation of the optical density per minute.

d) Results
The enzymatic activity A urate oxidase expressed in U / ml is calculated from the measurement of #E using the formula:
A = #E x Vr xd
SI x VpE in which the symbols Vr, d, sI and VpE respectively represent the reaction volume (0.9 ml), the dilution ratio (2), the extinction coefficient of uric acid at 292 nm (12, 5) and the volume of the test portion (0.1 ml).

 The results obtained are collated in Table (II) below. This specifies for each glycerol-ethanol induced strain, induced with glycerol-ethanol-galactose or uninduced, urate oxidase activity in U / ml.

TABLE II
Strain / Inducer Activity urate oxidase
(U / ml)
EMY761 / YP ethanol-glycerol-galactose <0.1
EMY761 / YP ethanol-glycerol <0.1
EMY761 pEMR469 (ura) / (uninduced) 0.4
EMY761 pEMR469 (ura) / YP ethanol-glycerol 12
EMV76 pEMR469 (leu) / (uninduced) 0.17
EMY761 pEMR469 (leu) / YP ethanol-glycerol 36
EMY761 pEMR473 (ura) / (uninduced) <0.1
EMY761 pEMR473 (ura +) / YP ethanol
glycerol-galactose 12.5
EMY761 pEMR473 (leu) / (uninduced) <0.1
EMY761 pEMR473 (leu +) / YP ethanol
glycerol-galactose 15.3
It is clear from the table above that the yeast cells transformed with these plasmids pEMR469 and pEMR473 are capable after induction of producing an urate oxidase activity.

5) Determination of Total Proteins Soluble in Lysates:
The protein assay kit from BIORAD was used to assay the total proteins present in the supernatant of the lysed cells. It is based on the observation that the maximum absorbance for an acidic solution of Coomassie brilliant blue g-250 goes from 465 nm to 595 nm when proteins are attached to it (cf.

Reisner et al., Anal Biochem, 64, 509- (1975)).

a) Operating mode
The following volumes are introduced into the tank of a spectrophotometer set at 595 nm - 10 μl of sample to which 790 μl of water have been added
distilled - 200 l of concentrated "Dye reagent" (Biorad).

The optical density is mixed and read at 595 nm. A standard range with increasing concentrations of BSA (Bovine
Serum Albumin) was performed as well. The unknown concentration of the total proteins of the lysates is read on the standard curve obtained -
b) Results
The main results obtained are summarized in Table III below. This specifies for each glycerol-ethanol induced strain, induced with glycerol-ethanol-galactose or uninduced, the amount (in mg / ml) of total soluble proteins as well as the percentage of urate oxidase in the total soluble proteins ( it is admitted here that the specific activity of the recombinant protein is identical to that of the urate oxidase obtained from A. flavus: 30 U / mg).

TABLE III
Z urate protein
total oxidase in the
Soluble strain / inducer total protein
soluble mg / ml
EMY761 / glycerol-ethanol 5.3 <0.05
EMY761 / glycerol-ethanol-galactose 5.8 <0.05
EMY761 pEMR469 (ura) / non-induced 8.5 0.25
EMY761 pEMR469 (ura +) / g Lycerol-Ethanol 5.3 4.7
EMY761 pEMR469 (leu) / non-induced 1.7 0.3
EMY761 pEMR469 (leu) / glycerol-ethanol 5.9 20
EMY761 pMMR473 (ura +) / non-induced 10.3 <0.05
EMY761 pEMR473 (ura +) / g lycerol-ethanol-galactose 6.5 6.4
EMY761 pEMR473 (leu) / non-induced 0.5 <0.05
EMY761 pEMR473 (leu +) / glycerol-ethanot-ga lactose 3.9 13
It is found that the production rate of urate oxidase varies from 5 to 20 × depending on the transformants and the mode of selection of the transformants (Leu).

EXAMPLE 10: Fermenter expression of 2.5 l of cDNA
urate oxidase for EMY761 strain pEMR473 (ura) 1) Fermentation protocol
a) Environments
Inoculum medium
A colony of the strain EMY761 pEMR473 (ura +) was cultured in 200 ml of liquid medium without uracil (cf.

Table I, Example 8). The culture is continued overnight with stirring to an OD of about 3.

Culture medium A
for 1 I of purified water
on a Milli-q glucose-type device 30 g glycerol 30 g casein hydrolyzate 30 g (Casamino-DIFCO acids) nitrogenous base of yeast 15 g (Yeast Nitrogen Base DIFCO) yeast extract 2.5 g (Yeast extract of DIFCO)
K2HP04 3 g MgSO4.7H2O 0.5 g
Additional medium B
per 100 ml of purified water
on a Milli-Q glycerol-type apparatus 30 g peptone hydrolyzate 30 g (G. Sheffield Primatone) nitrogen-based yeast 15 g (Yeast Nitrogen Base DIFC0) yeast extract 5 g (Yeast extract from DIFCO)
K2HP04 3 g
MgSO4.7H2O 0.5 g
b) Fermentation parameters
Bioreactor 2.5 l total volume equipped with two turbines
temperature = 30 0C
pH = 5
oxygen partial pressure = 30 mmHg
air flow = 1 I / min.

 The bioreactor is filled with 1.5 l of medium A and is inoculated with 150 ml of the inoculum.

 Once glucose is depleted at OD 2.5 to OD 17, induction occurs by adding a volume of 150 ml galaxose at 20 w / v. The growth is continued, then the additional medium B is added in the vicinity of OD 30.

 The growth is prolonged about fifteen hours and the harvest was carried out at an OD 104.

2) Preparation and analysis of samples:
The samples were prepared as described in Example 9 (2) (a) from the fermentor culture. Two samples were taken: the first after 7 hours of induction, the second after 22 hours of induction.

 On these two lysates obtained after lysis of the cells, the following tests described in Example 9 were carried out: - Western blot immunodetection - assay of the biological activity - total protein assay.

 The results obtained are as follows.

a) Western blot immunodetection
The EMY761 strain pEMR473 (ura +) grown in a 2-liter fermentor was found to produce a protein of apparent molecular weight of 33 KDa which is recognized by the antibodies directed against A urate oxidase. flavus: (prepared in rabbits according to techniques well known to those skilled in the art: see VAITUKAITIS et al (1981) "Methods in Enzymology" Academic Press, New York, vol.73, p.46) and which is absent in the control strain.

b) Assay of biological activity
The results obtained are summarized in Table IV below:
TABLE IV

<tb><SEP> Strain <SEP> 1 <SEP><SEP> induction time <SEP> U / ml
<tb> EMY761 <SEP> pEMR473 <SEP> (ura +) / 7 <SEP> h <SEP> 9
<tb> EMY761 <SEP> pEMR473 <SEP> (ura +) / 22 <SEP> h <SEP> 12.5
<Tb>
It is found that the strain EMY761 pEMR473 (ura + cultivated as a fermenter, is capable, after induction, of producing an urate oxidase activity.

c) Determination of soluble total protein
The results are summarized in Table V below:
TABLE V

<tb><SEP> Proteins <SEP> X <SEP> of urate <SEP> oxidase
<tb><SEP> Strain <SEP> / <SEP><SEP> Time of Total <SEP> Induction <SEP> in <SEP><SEP> Proteins
<tb><SEP> soluble <SEP> total <SEP> soluble
<tb><SEP> mg / mL
<tb> EMY761 <SEP> pEMR473 <SEP> (ura +) / 7 <SEP> h <SEP> 5.2 <SEP> 5.7
<tb> EMY761 <SEP> pEMR473 <SEP> (ura +) / 21 <SEP> h <SEP> 6.2 <SEQ> 6.6
<Tb>
These results indicate that the urate oxidase synthesis rate of the EMY761 pEMR473 strain (ura +) cultured in a fermenter is approximately 5% of total proteins of the cell after 7 hours and 22 hours of induction.
EXAMPLE II Erlenmeyer Expression of the Urate Oxidase cDNA
by EMY761 strains pEMR515 (Leu +), EMY500 pEMR515
(Leu +) and GRF18 pEMR515 (Leu +)
A colony of each of the above three strains was cultured in 20 ml of liquid medium without leucine.
After one night at 300C with stirring, the three cultures were centrifuged for 10 min at 7000 rpm. The cell pellets were taken up in 10 ml of sterile distilled water and again centrifuged for 10 min. The expression of urate oxidase was induced by taking up the cells in 20 ml of YP ethanol-glycerol-galactose medium (see Table I, Example 8). The cultures were returned to 300C with shaking for about 20h. As a control, one culture of each untransformed host strain was performed.

The cells of each of the six cultures are back-turned by centrifugation and the supernatant is removed. The pellets were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The washed pellets were taken up in about
1 ml of TEA buffer of pH 8.9 and the grinding and the removal of the particles by centrifugation were carried out as described in Example 9, 2). The supernatant of each culture serves as previously for an urate oxidase and total protein assay. The main results obtained are collated in Table VI below:
TABLE VI

<tb><SEP><SEP>%<SEP> activity of urate <SEP> oxidase
<tb><SEP> Strain / Conditions <SEP> of <SEP> urate <SEP> oxidase <SEP>#<SEP> Total <SEP> Proteins <SEP>#<SEP> in <SEP><SEP> Proteins
<tb><SEP> soluble <SEP> (U / ml) <SEP><SEP> Cmg / ml) <SEP> cultures
<tb> GRF18 <SEP> pEMR515 <SEP> (Leu +) / a) <SEP><0.1<SEP> 2.2 <SEP><0.05
<tb> EMYSOO <SEP> pEMR515 <SEP> (Leu +) / a) <SEP><0.1<SEP> 0.9 <SEP><<SEP> 0.05
<tb> GMY761 <SEP> pEMR515 <SEP> (Leu +) / a) <SEP><0.1<SEP> 1.8 <SEP><0.05
<tb> GRF18 <SEP> pEMR515 <SEP> (Leu +) / b) <SEP> 38 <SEP> 5.4 <SEP> 23%
<tb> EMY500 <SEP> pEMR515 <SEP> (Leu +) / b) <SEP> 20 <SEP> 2.5 <SEP> 26%
<tb> EMY761 <SEP> pEMR515 <SEP> (Leu +) / b) <SEP> 33 <SEP> 4.2 <SEP> 26%
<tb> a): the strains are cultured in the presence of glucose (conditions
non-induction) (b): the strains are cultured in the absence of glucose and
presence of galactose (induction).

 These results show that a high level of urate oxidase expression can be obtained with three non-isogenic receptor strains transformed with the expression vector according to the invention.

Claims (14)

A recombinant gene for expression in eukaryotic cells, characterized in that it comprises a DNA sequence which hybridises with a probe of formula:  Wherein D1, D2, D3, D4 and D5 respectively represent (A, G or T), (T or C), (G or A), (G or A) and (G or A) as well as with a probe of formula  A E1E2A A E3 CCCCA E4 Y E E5 TG in which the symbols E1, E2, E3, E4 and E5 respectively represent (G or A), (G or A), (A, G, C or T), (G or A ) and (T or C) and encodes a protein of an apparent molecular weight of about 33 kDa, which catalyzes the degradation of a metabolite. 2. Recombinant gene according to claim 1, characterized in that the metabolite is uric acid. 3. Recombinant gene according to one of claims 1 or 2, characterized in that the protein has the following sequence: MetSerAlaValLysAlaAlaArgTyrGly LysAspAsnValArgValTyrLysValHis LysAspGluLysThrGlyValGlnThrVal TyrGluMetThrValCysValLeuLeuGlu GlyGluIleGluThrSerTyrThrLysAla AspAsnSerValIleValAlaThrAspSer IleLysAsnThrIleTyrIleThrAlaLys GlnAsnProValThrProProGluLeuPhe GlySerIleLeuGlyThrHisPheIleGlu LysTyrAsnHisIleHisAlaAlaHisVal AsnIleValCysHisArgTrpThrArgMet AspIleAspGlyLysProHisProHisSer PheIleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGlyLysGly IleAspIleLysSerSerLeuSerGlyLeu ThrValLeuLysSerThrAsnSerGlnPhe TrpGlyPheLeuArgAspGluTyrThrThr LeuLysGtuThrTrpAspArgIleLeuSer ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGlyLeuGlnGluValArgSer HisValProLysPheAspAlaThrTrpAla ThrAlaArgGluValThrLeuLysThrPhe AlaGluAspAsnSerAlaSerValGlnAla ThrMetTyrLysMetAlaGluGlnileLeu AlaArgGlnGlnLeuIleGluThrValGlu TyrSerLeuProAsnLysHisTyrPheGlu IleAspLeuSerX1HisLysGlyLeuGln AsnThrGlyLysAsnAlaGluValPheAla ProGlnSerAspProAsnGlyLeuIleLys CysThrValGlyArgSerSerLeuLysSer LysLeu in which X1 represents Trp or Gly. 4. Recombinant gene according to claim 3, characterized in that X1 represents Trp. 5. Recombinant gene according to any one of claims 1 to 4, characterized in that said DNA sequence contains the following sequence: ATGTCTGCTG TTAAGGCTGC TAGATACGGT AAGGACAACG TTAGACTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG. 6. Expression vector for eukaryotic cells, characterized in that it carries, with the means necessary for its expression, its replication and the selection of transformed cells, a recombinant gene according to any one of claims 1 to 5. . 7. Expression vector according to claim 6, characterized in that it carries at least one selection marker. 8. Expression vector according to claim 7, characterized in that it has the characteristics of one of the plasmids pEMR469, pEMR473 and pEMR515. 9. Eukaryotic cells, characterized in that they are transformed by one of the expression vectors according to one of claims 6 and 7. 10. Saccharomyces cerevisiae strain, characterized in that it is transformed with one of the expression vectors according to one of Claims 6 to 8. 11. Strain according to claim 10, characterized in that it carries a mutation on at least one of the genes responsible for the synthesis of leucine or uracil. 12. Strain according to claim 11, characterized in that it carries a mutation on at least one of the LEU2 genes and URA3. 13. Recombinant protein, characterized in that it has the following sequence:  SerAlaValLysAlaAlaArgTyrGly LysAspAsnValArgValTyrLysValHis LysAspGluLysThrGlyValGlnThrVal TyrGluMetThrValCysValLeuLeuGlu  GlyGluIleGluThrSerTyrThrLysAla AspAsnSerValIleValAlaThrAspSer IleLysAsnThrIleTyrIleThrAlaLys GlnAsnProValThrProProGluLeuPhe  GlySerIleLeuGlyThrHisPheIleGlu LysTyrAsnHisIleHisAlaAlaHisVal  AsnIleValCysHisArgTrpThrArgMet AspIleAspGlyLysProHisProHisSer  PheIleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGlyLysGly  IleAspIleLysSerSerLeuSerGlyLeu ThrValLeuLysSerThrAsnSerGlnPhe TrpGlyPheLeuArgAspGluTyrThrThr LeuLysGluThrTrpAspArgIleLeuSer  ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGlyLeuGlnGluValArgSer  HisValProLysPheAspAlaThrTrpAla ThrAlaArgGluValThrLeuLysThrPhe  AlaGluAspAsnSerAlaSerValGlnAla ThrMetTyrLysMetAlaGluGlnIleLeu  AlaArgGlnGlnLeuIleGluThrValGlu TyrSerLeuProAsnLysHisTyrPheGlu  IleAspLeuSerTrpHisLysGlyLeuGln AsnThrGlyLysAsnAlaGluValPheAla  ProGlnSErAspProAsnGlyLeuIleLys CysThrValGlyArgSerSerLeuLysSer  LysLeu possibly preceded by a methionine. 14. Medicament, characterized in that it contains the recombinant protein according to claim 13.