EP4237428A2 - Escherichia coli zusammensetzungen und verfahren dafür - Google Patents

Escherichia coli zusammensetzungen und verfahren dafür

Info

Publication number
EP4237428A2
EP4237428A2 EP21802007.1A EP21802007A EP4237428A2 EP 4237428 A2 EP4237428 A2 EP 4237428A2 EP 21802007 A EP21802007 A EP 21802007A EP 4237428 A2 EP4237428 A2 EP 4237428A2
Authority
EP
European Patent Office
Prior art keywords
formula
seq
coli
polypeptide
saccharide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP21802007.1A
Other languages
English (en)
French (fr)
Inventor
Annaliesa Sybil Anderson
Laurent Oliver CHORRO
Robert George Konrad DONALD
Jacqueline Marie LYPOWY
Rosalind PAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pfizer Inc
Original Assignee
Pfizer Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pfizer Inc filed Critical Pfizer Inc
Publication of EP4237428A2 publication Critical patent/EP4237428A2/de
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/025—Enterobacteriales, e.g. Enterobacter
    • A61K39/0258—Escherichia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/025—Enterobacteriales, e.g. Enterobacter
    • A61K39/0266—Klebsiella
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/26—Klebsiella (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6037—Bacterial toxins, e.g. diphteria toxoid [DT], tetanus toxoid [TT]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the .txt file contains a sequence listing entitled "PC72671_ST25.txt” created on October 26, 2020 and having a size of 160 KB.
  • the sequence listing contained in this .txt file is part of the specification and is incorporated herein by reference in its entirety.
  • Urinary tract infections most often present as a cystitis that in some individuals can recur repeatedly following resolution. Left untreated, they can progress to pylonephritis and blood stream infections. E. coli infections are associated with high levels of antibiotic resistance [Al-Hasan MN, et al. The Journal of antimicrobial chemotherapy 2009; 64:169-74] with many strains being resistant to multiple antibiotics including antibiotics of last resort such as carbapenems and polymyxins [Zowawi HM, et al.
  • FIG. 2A-2T - depict maps of exemplary expression vectors.
  • FIG. 5 - depicts results from expression.
  • FIG. 13B An immunoblot of a replicate gel probed with 025- specific sera (Statens Serum Institut) is shown in FIG. 13B. O25a AwxxB (Knock out) background associated with Lanes 1-7; O25b 2401 AwzzB (Knock out) background associated with Lanes 8-15.
  • FIG. 14 - depicts long chain O-antigen expression conferred by E. coli and Salmonella fepE plasmids in host O25K5H1 AwzzB.
  • FIG. 16A-16B - depict plasmid-mediated Arabinose-inducible Expression of O25b Long O- antigen LPS in O25b O-antigen knock-out host strain. Results from an SPS PAGE are shown in FIG. 16A and results from an 025 Immuno-Blot are shown in FIG. 16B, wherein Lane 1 is from Clone 1 , no arabinose; Lane 2 is from Clone 1 , 0.2% arabinose; Lane 3 is from Clone 9, no Arabinose; Lane 4 is from Clone 9, 0.2% Arabinose; Lane 5 is from 055 E. coli LPS Standard; and Lane 6 is from O111 E. coli LPS Standard, in both FIG. 16A and in FIG. 16B.
  • FIG. 17 - depicts plasmid-mediated Arabinose-inducible Expression of Long O-antigen LPS in common host strain.
  • tResponder rates are % mice with titers > 2x unvaccinated baseline.
  • FIG. 35A-35B - depict E. coli serotpye 09 O-antugen immune sera is bactericidal against an invasive K. pneumoniae 03 isolate.
  • Rabbit immune sera elicited by an E. coli serotype O9a O-antigen CRMI 97 conjugate was evaluated in opsonophagocytic assays (OPAs) with an E. coli O9a strain (FIG. 35A) and a K. pneumoniae O3b strain (FIG. 35B).
  • SEQ ID NO: 1 sets forth an amino acid sequence for a wild type type 1 fimbriae D-mannose specific adhesin [Escherichia coli FimH J96],
  • SEQ ID NO: 7 sets forth an amino acid sequence for a fragment of a polypeptide derived from E. coli FimH (pSB02083 FimH Lectin Domain Wild Type construct)
  • SEQ ID NO: 9 sets forth an amino acid sequence for a fragment of a polypeptide derived from E. co// FimG (FimG A1 ..K14)
  • SEQ ID NO: 13 sets forth an amino acid sequence for a 6 aa linker.
  • SEQ ID NO: 21 sets forth an amino acid sequence for a polypeptide derived from E. coli FimG.
  • SEQ ID NO: 22 sets forth an amino acid sequence for the signal peptide of SEQ ID NO: 6 (PSB02307 - FimH mlgK signal pept I F22..Q300 J96 FimH N28S N91 S N249Q I His8 in pcDNA3.1 (+)).
  • SEQ ID NO: 23 sets forth an amino acid sequence for a polypeptide derived from E.
  • SEQ ID NO: 24 sets forth an amino acid sequence for a polypeptide derived from E. coli FimH according to SEQ ID NO: 7 (mature protein of pSB02083 FimH Lectin Domain Wild Type construct).
  • SEQ ID NO: 33 sets forth a K12 W3110 WzzB amino acid sequence.
  • SEQ ID NO: 38 sets forth a 0157 FepE amino acid sequence.
  • SEQ ID NO: 46 sets forth a primer sequence forwzzB P3_S.
  • SEQ ID NO: 50 sets forth a primer sequence for pBAD33_adaptor_S.
  • SEQ ID NO: 51 sets forth a primer sequence for pBAD33_adaptor_AS.
  • SEQ ID NO: 53 sets forth a primer sequence for gnd_f.
  • SEQ ID NO: 56 sets forth an amino acid sequence for a human IL10 protein signal peptide.
  • SEQ ID NO: 57 sets forth an amino acid sequence for a human respiratory syncytial virus A (strain A2) fusion glycoprotein F0 signal peptide.
  • SEQ ID NOs: 102-109 set forth SignalP 4.1 (DTU Bioinformatics) sequences from various species used for signal peptide predictions.
  • SignalP 4.1 DTU Bioinformatics
  • SEQ ID NO: 111 sets forth an amino acid sequence for a polypeptide derived from E. coli FimH (PSB02158 - FimHLD-LM (mlgK signal pept, N28S N91S V48C L55C)).
  • the invention includes a composition including the FimH polypeptide or fragment thereof described herein.
  • the composition may include a polypeptide or fragment thereof that is suitable for in vivo administration.
  • the polypeptide or fragment thereof in such a composition may have a purity of at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, by mass.
  • the polypeptide in such a composition may have a purity of at least 95% by mass.
  • the invention includes a composition for use in inducing an immune response against E. coli or E.coli infection.
  • a composition for use in inducing an immune response against E. coli or E.coli infection Use of the composition described herein for inducing an immune response against E. coli or E.coli infection and use of the composition described herein in the manufacture of a medicament for inducing an immune response against E. coli or E.coli infection, are also disclosed.
  • “Fragment” with reference to an amino acid sequence (peptide or protein), relates to a part of an amino acid sequence, i.e. a sequence which represents the amino acid sequence shortened at the N-terminus and/or C-terminus.
  • a fragment shortened at the C- terminus is obtainable e.g. by translation of a truncated open reading frame that lacks the 3'-end of the open reading frame.
  • a fragment shortened at the N-terminus (C-terminal fragment) is obtainable e.g. by translation of a truncated open reading frame that lacks the 5'-end of the open reading frame, as long as the truncated open reading frame comprises a start codon that serves to initiate translation.
  • Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insertion, one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible.
  • Amino acid addition variants comprise amino- and/or carboxy-termin al fusions of one or more amino acids, such as 1 , 2, 3, 5, 10, 20, 30, 50, or more amino acids.
  • Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1 , 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein.
  • Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.
  • conservative amino acid substitutions include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • the degree of similarity, preferably identity between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid sequence will be at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • the degree of similarity or identity is given preferably for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence.
  • Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence) and multiplying this result by 100.
  • a fragment or variant/mutant of an amino acid sequence is preferably a "functional fragment” or "functional variant".
  • the term "functional fragment” or “functional variant/mutant” of an amino acid sequence relates to any fragment or variant/mutant exhibiting one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, i.e., it is functionally equivalent.
  • one particular function is one or more immunogenic activities displayed by the amino acid sequence from which the fragment or variant is derived.
  • the function of the functional fragment or functional variant may be reduced but still significantly present, e.g., immunogenicity of the functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the parent molecule or sequence. However, in other embodiments, immunogenicity of the functional fragment or functional variant may be enhanced compared to the parent molecule or sequence.
  • immunogenicity of the functional fragment or functional variant may be enhanced compared to the parent molecule or sequence.
  • isolated means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated", but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • a glycosylation site in the polypeptide derived from E. coli or a fragment thereof is removed by a mutation within the sequence of the polypeptide derived from E. coli or a fragment thereof.
  • the Asn residue of a glycosylation motif (Asn-Xaa-Ser/Thr) may be mutated, preferably by a substitution.
  • the residue substitution is selected from any one of Ser, Asp, Thr, and Gin.
  • coli or a fragment thereof includes the amino acid sequence having at least 99% identity to any one of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 110, SEQ ID NO: 11 1 , SEQ ID NO: 1 12, and SEQ ID NO: 113.
  • composition includes a polypeptide having at least 50 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, or at least 250 consecutive amino acid residues of the amino acid sequence of any one of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 110, SEQ ID NO: 111 , SEQ ID NO: 112 and SEQ ID NO: 113.
  • the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 1. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 1. In some embodiments, the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 2. In some embodiments, the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 2.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 2. In some embodiments, the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 2. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 2. In some embodiments, the composition includes a polypeptide having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 3.
  • the composition includes a polypeptide having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 4.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 4.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 4.
  • the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 4.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 5. In some embodiments, the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 5. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 5.
  • the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 6. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 6. In some embodiments, the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 20.
  • the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 26.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 26.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 26.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 27. In some embodiments, the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 27. In some embodiments, the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 27. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 27.
  • the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 28.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 28.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 28.
  • the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 110. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 110. In some embodiments, the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 111.
  • the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 112. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 112. In some embodiments, the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 113.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 113. In some embodiments, the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 113. In some embodiments, the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 113. In some embodiments, the composition includes a polypeptide as set forth at SEQ ID NO: 113. Another example of a suitable polypeptide and fragments thereof derived from E. coli FimH described herein is shown as SEQ ID NO: 2, which lacks the wild-type N- terminal signal sequence, and corresponds to amino acid residues 22-300 of SEQ ID NO: 1 . Another example of a FimH fragment includes the entire N- terminal signal sequence and the mature protein, such as set forth in SEQ ID NO: 1 .
  • a glycosylation site in the polypeptide derived from E. coli or a fragment thereof is removed by a mutation within the sequence of the polypeptide derived from E. coli or a fragment thereof.
  • the Asn residue at position 7 of a mature E. coli FimH polypeptide (e.g., according to the numbering of SEQ ID NO: 2) may be mutated, preferably by a substitution.
  • the Asn residue at position 7 of a lectin domain of an E. coli FimH polypeptide (e.g., according to the numbering of SEQ ID NO: 3) may be mutated, preferably by a substitution.
  • the residue substitution is selected from any one of Ser, Asp, Thr, and Gin.
  • the Thr residue at position 10 of a mature E. coli FimH polypeptide may be mutated, preferably by a substitution.
  • the Thr residue at position 7 of a lectin domain of an E. coli FimH polypeptide may be mutated, preferably by a substitution.
  • the residue substitution is selected from any one of Ser, Asp, and Gin.
  • the Asn residue at position 70 of a mature E. coli FimH polypeptide may be mutated, preferably by a substitution.
  • the Asn residue at position 70 of a lectin domain of an E. coli FimH polypeptide may be mutated, preferably by a substitution.
  • the residue substitution is selected from any one of Ser, Asp, Thr, and Gin.
  • the Ser residue at position 72 of a mature E. coli FimH polypeptide may be mutated, preferably by a substitution.
  • the Ser residue at position 72 of a lectin domain of an E. coli FimH polypeptide may be mutated, preferably by a substitution.
  • the residue substitution is selected from any one of Asp, Thr, and Gin.
  • fragment refers to a polypeptide and is defined as any discrete portion of a given polypeptide that is unique to or characteristic of that polypeptide.
  • the term as used herein also refers to any discrete portion of a given polypeptide that retains at least a fraction of the activity of the full-length polypeptide. In certain embodiments, the fraction of activity retained is at least 10% of the activity of the full-length polypeptide. In certain embodiments, the fraction of activity retained is at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the full-length polypeptide.
  • the fraction of activity retained is at least 95%, 96%, 97%, 98% or 99% of the activity of the full-length polypeptide. In certain embodiments, the fraction of activity retained is 100% or more of the activity of the full-length polypeptide. In some embodiments, a fragment includes at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more consecutive amino acids of the full-length polypeptide.
  • the polypeptide derived from E. coli FimH or fragment thereof is present in a complex with polypeptide derived from E. coli FimC or fragment thereof.
  • the polypeptide derived from E. coli FimH or fragment thereof and the polypeptide derived from E. coli FimC or fragment thereof are present in a complex, preferably in a 1 :1 ratio in the complex.
  • the full length FimH may be stabilized in an active conformation by the periplasmic chaperone FimC, thereby making it possible to purify full-length FimH protein.
  • the polypeptide or fragment thereof includes full length FimH and full length FimC.
  • the polypeptide or fragment thereof includes a fragment of FimH and a fragment of FimC. In some embodiments, the polypeptide or fragment thereof includes full length FimH and a fragment of FimC.
  • An exemplary sequence for E. coli FimC is set forth in SEQ ID NO: 10. In some embodiments, the polypeptide derived from E. coli or a fragment thereof includes complex-forming fragments of FimH.
  • a complex-forming fragment of FimH may be any part or portion of the FimH protein that retain the ability to form a complex with FimC or a fragment thereof.
  • a suitable complexforming fragment of FimH may also be obtained or determined by standard assays known in the art, such as co-immunoprecipitation assay, cross-linking, or co-localization by fluorescent staining, etc. SDS-PAGE or western blot mayalso be used (e.g., by showing that the FimH fragment and FimC or fragment thereof are in a complex as evidenced by gel electrophoresis).
  • the polypeptide derived from E. coli or a fragment thereof includes full length FimH, wherein the FimH is not complexed with FimC. In further embodiments, the polypeptide or fragment thereof includes a fragment of FimH, wherein the fragment is not complexed with FimC. In some embodiments, the polypeptide derived from E. coli or a fragment thereof FimC includes SEQ ID NO: 10. In some embodiments, the the complex may be expressed from the same plasmid, preferably under the the control of separate promoters for each polypeptide or fragment thereof.
  • the polypeptide derived from E. coli FimH or a fragment thereof may be expressed by the appropriate donor strand complemented version of FimH, wherein the amino acid sequence of FimC that interacts with FimH in the FimCH complex is itself engineered at the C-terminal end of FimH to provide the native conformation without the need for the remainder of the FimC molecule to be present.
  • the polypeptide derived from E. coli FimH or a fragment thereof may be expressed in the form of a complex that includes isolated domains thereof, such as the lectin binding domain and the piling domain, and such domains may be linked together covalently or non-covalently.
  • the linking segment may include amino acid sequences or other oligomeric structures, including simple polymer structures.
  • compositions of the invention may include complexes described herein, in which said polypeptides or fragements thereof derived from E. coli are co-expressed or formed in a combined state.
  • the polypeptide derived from E. coli or a fragment thereof includes the lectin domain of an E. coli FimH.
  • Exemplary sequences for a lectin domain include any one of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 110, and SEQ ID NO: 111.
  • the lectin domain of an E. coli FimH includes cysteine substitutions.
  • the lectin domain of an E. coli FimH includes cysteine substitutions within the first 50 amino acid residues of the lectin domain.
  • the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 8.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 8.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 8.
  • the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 24.
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 24.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 24.
  • the composition includes a polypeptide having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 111 .
  • the composition includes a polypeptide having at least 90% identity to SEQ ID NO: 111.
  • the composition includes a polypeptide having at least 95% identity to SEQ ID NO: 111.
  • the composition includes a polypeptide having at least 99% identity to SEQ ID NO: 111.
  • the composition includes a polypeptide as set forth at SEQ ID NO: 111.
  • the composition includes a polypeptide having at least 150 consecutive amino acid residues of any one of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 110, and SEQ ID NO: 111 . In some embodiments, the composition includes a polypeptide having at least 250 consecutive amino acid residues of the amino acid sequence of any one of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 110, and SEQ ID NO: 111.
  • the N-terminal wild type signal sequence of full-length FimH is cleaved in a host cell to produce a mature FimH polypeptide.
  • the FimH expressed by the host cell may lack the N-terminal signal sequence.
  • the polypeptide derived from E. coli or a fragment thereof may be encoded by a nucleotide sequence that lacks the coding sequence for the wild type N-terminal signal sequence.
  • a single nucleic acid construct encodes the lectin domain and pilin domain of an E. coli FimH.
  • one nucleic acid construct encodes the lectin domain and a second nucleic acid construct encodes the pilin domain of an E. coli FimH.
  • genomic integration is achieved.
  • the nucleic acid construct may comprise genomic DNA that comprises one or more introns, or cDNA. Some genes are expressed more efficiently when introns are present. In some embodiments, the nucleic acid sequence is suitable for the expression of exogenous polypeptides in said mammalian cell.
  • the nucleic acid construct includes a signal sequence that encodes a peptide that directs secretion of the polypeptide derived from E. coli or a fragment thereof.
  • the nucleic acid includes the native signal sequence of the polypeptide derived from E. coli FimH.
  • the nucleic acid sequence encoding the signal sequence may be codon optimized to increase the level of expression of the protein in a host cell.
  • the endogenous signal sequence naturally associated with the polypeptide may be replaced with a signal sequence not associated with the wild type polypeptide to improve the level of expression of the polypeptide or fragment thereof in cultured cells.
  • the nucleic acid does not include the native signal sequence of the polypeptide derived from E. coli or a fragment thereof. In some embodiments, the nucleic acid does not include the native signal sequence of the polypeptide derived from E. coli FimH. In some embodiments, the polypeptide derived from E.
  • the signal sequence is an IgK signal sequence.
  • the nucleic acid encodes the amino acid sequence SEQ ID NO: 18.
  • the nucleic acid encodes the amino acid sequence SEQ ID NO: 19.
  • the nucleic acid encodes the amino acid sequence SEQ ID NO: 22.
  • the signal sequence is a mouse IgK signal sequence.
  • the nucleic acid includes the native signal sequence of the polypeptide derived from E. coli or a fragment thereof. In some embodiments, the signal sequence is not an IgK signal sequence. In some embodiments, the signal sequence includes a hemagglutinin signal sequence.
  • vectors that include the coding sequences for the polypeptide derived from E. coli or a fragment thereof.
  • Exemplary vectors include plasmids that are able to replicate autonomously or to be replicated in a mammalian cell.
  • Typical expression vectors contain suitable promoters, enhancers, and terminators that are useful for regulation of the expression of the coding sequence(s) in the expression construct.
  • the vectors may also include selection markers to provide a phenotypic trait for selection of transformed host cells (such as conferring resistance to antibiotics such as ampicillin or neomycin).
  • the 2A peptide allows translation of multiple proteins in a single open reading frame into a polyprotein that is subsequently cleaved into individual proteins through a ribosome-skipping mechanism.
  • 2A peptide mayprovide more balanced expression of multiple protein products.
  • Exemplary IRES sequences include, e.g., EV71 IRES, EMCV IRES, HCV IRES.
  • the integration may be site-specific or random. Site-specific recombination may be achieved by introducing homologous sequence(s) into the nucleic acid constructs described herein. Such homologous sequence substantially matches the endogenous sequence at a specific target site in the host genome. Alternatively, random integration may be used.
  • the expression level of a protein may vary depending upon the integration site. Therefore, it may be desirable to select a number of clones according to recombinant protein expression level to identify a clone that achieves the desired level of expression.
  • nucleic acid constructs are further described in the figures, such as any one of FIG. 2A-2T.
  • mammalian host cells include mouse Sertoli (TM4), buffalo rat liver (BRL 3A), mouse mammary tumor (MMT), rat hepatoma (HTC), mouse myeloma (NSO), murine hybridoma (Sp2/0), mouse thymoma (EL4), Chinese Hamster Ovary (CHO) and CHO cell derivatives, murine embryonic (NIH/3T3, 3T3 Li), rat myocardial (H9c2), mouse myoblast (C2C12), and mouse kidney (miMCD-3).
  • TM4 mouse Sertoli
  • MMT mouse mammary tumor
  • HTC rat hepatoma
  • HTC mouse myeloma
  • NSO mouse myeloma
  • EL4 murine hybridoma
  • EL4 mouse thymoma
  • CHO Chinese Hamster Ovary
  • CHO murine embryonic (NIH/3T3, 3T3 Li)
  • the cell culture method of the invention comprises a growth phase and a production phase and step (ii) is applied during the growth phase. In some embodiments, the cell culture method of the invention comprises a growth phase and a production phase and step (ii) is applied during a part of the growth phase. In some embodiments, the cell culture method of the invention comprises a growth phase and a production phase and step (ii) is applied during the growth phase and the production phase.
  • Titer refers, for example, to the total amount of recombinantly expressed protein produced by a cell culture in a given amount of medium volume. Titer is typically expressed in units of grams of protein per liter of medium.
  • the composition includes an O- antigen from 5 different E. coli serotypes. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 6 different E. coli serotypes. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 7 different E. coli serotypes. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 8 different E. coli serotypes.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 18 different serotypes. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 19 different serotypes. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 20 different serotypes.
  • the saccharides are conjugated to a carrier protein to form glycoconjugates as described herein.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 12 different serotypes, wherein each O-antigen is conjugated to a carrier protein. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 13 different serotypes, wherein each O-antigen is conjugated to a carrier protein. In one embodiment, the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 14 different serotypes, wherein each O-antigen is conjugated to a carrier protein. In one embodiment, the composition includes a polypeptide derived from E.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 15 different serotypes, wherein each O-antigen is conjugated to a carrier protein.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 16 different serotypes, wherein each O-antigen is conjugated to a carrier protein.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-antigen from 17 different serotypes, wherein each O-antigen is conjugated to a carrier protein.
  • the composition includes a polypeptide derived from E.
  • the composition includes an O-polysaccharide from at least one E. coli serotype.
  • the composition includes an O-polysaccharide from more than 1 E. coli serotype.
  • the composition may include an O-polysaccharide from two different E. coli serotypes to 12 different E. coli serotypes.
  • the composition includes an O-polysaccharide from 3 different E. coli serotypes.
  • the composition includes an O-polysaccharide from 4 different E. coli serotypes.
  • the composition includes an O-polysaccharide from 5 different E. coli serotypes.
  • the composition includes an O-polysaccharide from 8 different E. coli serotypes, wherein each O- polysaccharide is conjugated to a carrier protein. In one embodiment, the composition includes an O-polysaccharide from 9 different E. coli serotypes, wherein each O- polysaccharide is conjugated to a carrier protein. In one embodiment, the composition includes an O-polysaccharide from 10 different E. coli serotypes, wherein each O- polysaccharide is conjugated to a carrier protein. In one embodiment, the composition includes an O-polysaccharide from 11 different E.
  • the composition includes an O-polysaccharide from 7 different E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, and wherein the O- polysaccharide includes the O-antigen and core saccharide.
  • the composition includes an O-polysaccharide from 8 different E. coli serotypes, wherein each O-polysaccharide is conjugated to a carrier protein, and wherein the O- polysaccharide includes the O-antigen and core saccharide.
  • the composition includes an O-polysaccharide from 14 different serotypes, wherein each O- polysaccharide is conjugated to a carrier protein, and wherein the O-polysaccharide includes the O-antigen and core saccharide. In one embodiment, the composition includes an O-polysaccharide from 15 different serotypes, wherein each O- polysaccharide is conjugated to a carrier protein, and wherein the O-polysaccharide includes the O-antigen and core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula 017, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula 015, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula O18A, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula 075, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula 04, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O- polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula 016, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula O13, wherein n is at least 40, and the core saccharide.
  • the composition further includes an O-polysaccharide conjugated to CRM197, wherein the O-polysaccharide includes Formula 07, wherein n is at least 40, and the core saccharide.
  • the O-polysaccharide includes Formula 09, wherein n is 1-20, preferably 4-8, more preferably 5. Formula 09 is shown, e.g., in FIG. 10B. In another embodiment, the O- polysaccharide includes Formula O9a, wherein n is 1-20, preferably 4-8, more preferably 5. Formula O9a is shown, e.g., in FIG. 10B.
  • the O-polysaccharide includes selected from any one of Formula O20ab, Formula O20ac, Formula 052, Formula 097, and Formula 0101 , wherein n is 1-20, preferably 4-8, more preferably 5. See, e.g., FIG. 10B.
  • the composition may include a polypeptide derived from E. coli or a fragment thereof; and any combination of conjugated O-polysaccharides (antigens).
  • the composition includes a polysaccharide that includes Formula O25b, a polysaccharide that includes Formula O1A, a polysaccharide that includes Formula 02, and a polysaccharide that includes Formula 06.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-polysaccharide from 7 different E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM 197, and wherein the O-polysaccharide includes the O-antigen and core saccharide.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O- polysaccharide from 7 different E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM 197, and wherein the O-polysaccharide includes the O-antigen and core saccharide.
  • the composition includes a polypeptide derived from E.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-polysaccharide from 11 different E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM197, and wherein the O-polysaccharide includes the O- antigen and core saccharide.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-polysaccharide from 11 different E. coli serotypes, wherein each O-polysaccharide is conjugated to CRM197, and wherein the O-polysaccharide includes the O- antigen and core saccharide.
  • the composition includes a polypeptide derived from E.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O-polysaccharide from 19 different serotypes, wherein each O-polysaccharide is conjugated to CRMI 97 , and wherein the O-polysaccharide includes the O-antigen and core saccharide.
  • the composition includes a polypeptide derived from E. coli or a fragment thereof; and an O- polysaccharide from 19 different serotypes, wherein each O-polysaccharide is conjugated to CRMI 97 , and wherein the O-polysaccharide includes the O-antigen and core saccharide.
  • the composition includes a polypeptide derived from E.
  • the immunogenic composition elicits functional antibodies in humans, said antibodies being capable of killing E. coli serotype O25B as determined by in vitro opsonophagocytic assay.
  • the immunogenic composition of the invention increases the proportion of responders against E. coli serotype O25B (i.e., individual with a serum having a titer of at least 1 :8 as determined by in vitro OPA) as compared to the preimmunized population.
  • the immunogenic composition elicits a titer of at least 1 :8 against E.
  • the immunogenic composition of the invention elicits a titer of at least 1 :8 against E. coli serotype O25B in at least 60%, 70%, 80%, or at least 90% of the subjects as determined by in vitro opsonophagocytic killing assay.
  • the immunogenic composition of the invention significantly increases the proportion of responders against E. coli serotypes O25B (i.e., individual with a serum having a titer of at least 1 :8 as determined by in vitro OPA) as compared to the pre-immunized population.
  • the immunogenic composition of the invention significantly increases the OPA titers of human subjects against E. coli serotype O25B as compared to the pre-immunized population.
  • the immunogenic composition elicits IgG antibodies in humans, said antibodies being capable of binding an E. coli serotype O1 A polysaccharide at a concentration of at least 0.2 pg/ml, 0.3 pg/ml, 0.35 pg/ml, 0.4 pg/ml or 0.5 pg/ml as determined by ELISA assay. Therefore, comparison of OPA activity of pre- and post-immunization serum with the immunogenic composition of the invention can be conducted and compared for their response to serotype O1A to assess the potential increase of responders.
  • the immunogenic composition elicits IgG antibodies in humans, said antibodies being capable of killing E.
  • the invention relates to a composition that includes a polypeptide derived from E. coli or a fragment thereof; and a conjugate including a saccharide covalently bound a carrier protein, wherein the saccharide includes Formula 02, wherein n is 43 ⁇ 2.
  • the invention relates to a composition that includes a polypeptide derived from E. coli or a fragment thereof; and a conjugate including a saccharide covalently bound a carrier protein, wherein the saccharide includes Formula 02, wherein n is 47 ⁇ 2.
  • the immunogenic composition elicits functional antibodies in humans, said antibodies being capable of killing E. coli serotype 02 as determined by in vitro opsonophagocytic assay.
  • the immunogenic composition of the invention increases the proportion of responders against E. coli serotype 02 (i.e., individual with a serum having a titer of at least 1 :8 as determined by in vitro OPA) as compared to the pre-immunized population.
  • the immunogenic composition elicits a titer of at least 1 :8 against E.
  • the conjugate is prepared by reductive amination chemistry, preferably in DMSO buffer.
  • the saccharide is conjugated to the carrier protein through a (2-((2- oxoethyl)thio)ethyl) carbamate (eTEC) spacer.
  • the composition further includes a pharmaceutically acceptable diluent.
  • the immunogenic composition elicits functional antibodies in humans, said antibodies being capable of killing E. coli serotype 06 as determined by in vitro opsonophagocytic assay.
  • the immunogenic composition of the invention increases the proportion of responders against E. coli serotype 06 (i.e., individual with a serum having a titer of at least 1 :8 as determined by in vitro OPA) as compared to the pre-immunized population.
  • the immunogenic composition elicits a titer of at least 1 :8 against E.
  • the saccharide further includes the E. coli R1 core saccharide moiety. In one embodiment, the saccharide further includes the E. coli R2 core saccharide moiety. In one embodiment, the saccharide further includes the E. coli R3 core saccharide moiety. In another embodiment, the saccharide further includes the E. coli R4 core saccharide moiety. In one embodiment, the saccharide further includes the E. coli K12 core saccharide moiety. In another embodiment, the saccharide further includes the KDO moiety.
  • the carrier protein is CRMI 97 . In one embodiment, the conjugate is prepared by single end linked conjugation.
  • saccharide refers to a single sugar moiety or monosaccharide unit as well as combinations of two or more single sugar moieties or monosaccharide units covalently linked to form disaccharides, oligosaccharides, and polysaccharides.
  • the saccharide may be linear or branched.
  • the bacterium is not E. coli GAR2401 . This genetic approach towards saccharide production allows for efficient production of O-polysaccharides and O-antigen molecules as vaccine components.
  • the wzz family protein is any one of wzzB, wzz, WZZSF, WZZST, fepE, wzzf eP E, wzzl and wzz2, most preferably wzzB, more preferably fepE.
  • a modified saccharide (modified as compared to the corresponding wild-type saccharide) may be produced by expressing (not necessarily overexpressing) a wzz family protein (e.g., fepE) from a Gram-negative bacterium in a Gramnegative bacterium and/or by switching off (i.e., repressing, deleting, removing) a second wzz gene (e.g., wzzB) to generate high molecular weight saccharides, such as lipopolysaccharides, containing intermediate or long O-antigen chains.
  • a wzz family protein e.g., fepE
  • a second wzz gene e.g., wzzB
  • the modified saccharides may be produced by expressing (not necessarily overexpressing) wzz2 and switching off wzzl.
  • the modified saccharides may be produced by expressing (not necessarily overexpressing) wzzfepE and switching off wzzB.
  • the modified saccharides may be produced by expressing (not necessarily overexpressing) wzzB but switching off wzzfepE.
  • the modified saccharides may be produced by expressing fepE.
  • the wzz family protein is derived from a strain that is heterologous to the host cell.
  • the saccharide includes any one Formula selected from Table 1 , wherein the number of repeat units n in the saccharide is greater than the number of repeat units in the corresponding wild-type O-polysaccharide by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38,
  • the saccharide includes an increase of at least 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 repeat units, as compared to the corresponding wild-type O-polysaccharide. See, for example, Table 24.
  • Methods of determining the length of saccharides are known in the art. Such methods include nuclear magnetic resonance, mass spectroscopy, and size exclusion chromatography, as described in Example 13.
  • the invention relates to a saccharide produced in a recombinant E. coli host cell, wherein the gene for an endogenous wzz O-antigen length regulator (e.g., wzzB) is deleted and is replaced by a (second) wzz gene from a Gram-negative bacterium heterologous to the recombinant E. coli host cell (e.g., Salmonella fepE) to generate high molecular weight saccharides, such as lipopolysaccharides, containing intermediate or long O-antigen chains.
  • the recombinant E. coli host cell includes a wzz gene from Salmonella, preferably from Salmonella enterica.
  • An exemplary culture medium for the recombinant host cell includes an element selected from any one of KH 2 PO 4 , K 2 HPO 4 , (NH 4 ) 2 SO 4 , sodium citrate, Na 2 SO 4 , aspartic acid, glucose, MgSO 4 , FeSO 4 -7H 2 O, Na 2 Mo0 4 -2H 2 0, H3BO3, CoCI 2 -6H 2 0, CuCI 2 -2H 2 O, MnCI 2 -4H 2 O, ZnCI 2 and CaCI 2 -2H 2 O.
  • the medium includes KH 2 PO 4 , K 2 HPO 4 , (NH 4 ) 2 SO 4 , sodium citrate, Na 2 SO 4 , aspartic acid, glucose, MgSO 4 , FeSO 4 - 7H 2 O, Na 2 Mo0 4 -2H 2 0, H3BO3, CoCI 2 -6H 2 0, CuCI 2 -2H 2 O, MnCI 2 -4H 2 O, ZnCI 2 and CaCI 2 -2H 2 O.
  • the medium used herein may be solid or liquid, synthetic (i.e. man-made) or natural, and may include sufficient nutrients for the cultivation of the recombinant host cell.
  • the medium is a liquid medium.
  • the medium may further include suitable inorganic salts. In some embodiments, the medium may further include trace nutrients. In some embodiments, the medium may further include growth factors. In some embodiments, the medium may further include an additional carbon source. In some embodiments, the medium may further include suitable inorganic salts, trace nutrients, growth factors, and a supplementary carbon source. Inorganic salts, trace nutrients, growth factors, and supplementary carbon sources suitable for culturing E. coli are known in the art.
  • the medium may include additional components as appropriate, such as peptone, N-Z Amine, enzymatic soy hydrosylate, additional yeast extract, malt extract, supplemental carbon sources and various vitamins. In some embodiments, the medium does not include such additional components, such as peptone, N-Z Amine, enzymatic soy hydrosylate, additional yeast extract, malt extract, supplemental carbon sources and various vitamins.
  • the medium includes an inorganic salt.
  • suitable inorganic salts include, but are not limited to salts of potassium, calcium, sodium, magnesium, manganese, iron, cobalt, zinc, copper, molybdenum, tungsten and other trace elements, and phosphoric acid.
  • the modified saccharide (as compared to the corresponding wild-type saccharide) described herein is synthetically produced, for example, in vitro. Synthetic production or synthesis of the saccharides may facilitate the avoidance of cost- and time-intensive production processes.
  • the saccharide is synthetically synthesized, such as, for example, by using sequential glycosylation strategy or a combination of sequential glycosylations and [3+2] block synthetic strategy from suitably protected monosaccharide intermediates. For example, thioglycosides and glycosyl trichloroacetimidate derivatives may be used as glycosyl donors in the glycosylations.
  • the individual polysaccharides are typically purified (enriched with respect to the amount of polysaccharide-protein conjugate) through methods known in the art, such as, for example, dialysis, concentration operations, diafiltration operations, tangential flow filtration, precipitation, elution, centrifugation, precipitation, ultra-filtration, depth filtration, and/or column chromatography (ion exchange chromatography, multimodal ion exchange chromatography, DEAE, and hydrophobic interaction chromatography).
  • the polysaccharides are purified through a method that includes tangential flow filtration.
  • any of the serotypes listed above refers to a serotype that encompasses a repeating unit structure (O-unit, as described below) known in the art and is unique to the corresponding serotype.
  • O-unit repeating unit structure
  • the term “O25a” serotype also known in the art as serotype “025” refers to a serotype that encompasses Formula 025 shown in Table 1 .
  • the term “O25b” serotype refers to a serotype that encompasses Formula O25b shown in Table 1 .
  • the serotypes are referred generically herein unless specified otherwise such that, for example, the term Formula “018” refers generically to encompass Formula O18A, Formula O18ac, Formula 18A1 , Formula O18B, and Formula O18B1 .
  • O1 refers generically to encompass the species of Formula that include the generic term “O1 ” in the Formula name according to Table 1 , such as any one of Formula O1A, Formula O1A1 , Formula O1 B, and Formula O1C, each of which is shown in Table 1.
  • an “O1 serotype” refers generically to a serotype that encompasses any one of Formula O1A, Formula O1A1 , Formula O1 B, and Formula O1 C.
  • an “06 serotype” refers generically to a serotype that encompasses any one of Formula O6:K2; K13; K15; and O6:K54.
  • O-antigen refers to a saccharide that encompasses the formula labeled with the corresponding serotype name.
  • O25B O-antigen refers to a saccharide that encompasses Formula O25B shown in Table 1.
  • O1 O-antigen generically refers to a saccharide that encompasses a Formula including the term “O1 such as the Formula O1 A, Formula O1A1 , Formula O1 B, and Formula O1 C, each of which are shown in Table 1.
  • 06 O-antigen generically refers to a saccharide that encompasses a Formula including the term “06,” such as Formula O6:K2; Formula O6:K13; Formula O6:K15 and Formula O6:K54, each of which are shown in Table 1.
  • the O-polysaccharide refers to a structure that consists of the O-antigen, in which case, the O-polysaccharide is synonymous with the term O- antigen.
  • the O-polysaccharide refers to a structure that includes repeating units of the O-antigen, without the core saccharide. Accordingly, in one embodiment, the O-polysaccharide does not include an E. coli R1 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli R2 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli R3 core moiety.
  • the O-polysaccharide does not include an E. coli R4 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli K12 core moiety. In another preferred embodiment, the O-polysaccharide refers to a structure that includes an O-antigen and a core saccharide. In another embodiment, the O-polysaccharide refers to a structure that includes an O-antigen, a core saccharide, and a KDO moiety.
  • O-polysaccharide which includes the core oligosaccharide
  • purified LPS may be hydrolyzed by heating in 1 % (v/v) acetic acid for 90 minutes at 100 degrees Celsius, followed by ultracentrifugation at 142,000 x g for 5 hours at 4 degrees Celsius. The supernatant containing the O-polysaccharide is freeze-dried and stored at 4 degrees Celsius.
  • deletion of capsule synthesis genes to enable simple purification of O-polysaccharide is described.
  • the O-polysaccharide can be isolated by methods including, but not limited to mild acid hydrolysis to remove lipid A from LPS. Other embodiments may include use of hydrazine as an agent for O-polysaccharide preparation. Preparation of LPS can be accomplished by known methods in the art.
  • the O-polysaccharides purified from wild-type, modified, or attenuated Gram-negative bacterial strains that express (not necessarily overexpress) a Wzz protein are provided for use in conjugate vaccines.
  • a Wzz protein e.g., wzzB
  • the O-polysaccharide chain is purified from the Gram-negative bacterial strain expressing (not necessarily overexpressing) wzz protein for use as a vaccine antigen either as a conjugate or complexed vaccine.
  • the O-polysaccharide has a molecular weight that is increased by at least 1-fold and at most 5-fold, as compared to the corresponding wild-type O-polysaccharide. In another embodiment, the O-polysaccharide has a molecular weight that is increased by at least 2-fold and at most 4-fold, as compared to the corresponding wild-type O-polysaccharide.
  • An increase in molecular weight of the O- polysaccharide, as compared to the corresponding wild-type O-polysaccharide is preferably associated with an increase in number of O-antigen repeat units. In one embodiment, the increase in molecular weight of the O-polysaccharide is due to the wzz family protein.
  • the O-polysaccharide of the invention has a molecular weight that is increased by at least 1 and at most 200 kDa, as compared to the corresponding wild-type O-polysaccharide. In one embodiment, the molecular weight is increased by at least 5 and at most 200kDa.
  • the molecular weight is increased by at least 10 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 12 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 15 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 18 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 20 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 21 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 22 and at most 200kDa. In one embodiment, the molecular weight is increased by at least 30 and at most 200kDa.
  • the molecular weight is increased by at least 1 and at most 100kDa. In one embodiment, the molecular weight is increased by at least 5 and at most 100kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 100kDa. In one embodiment, the molecular weight is increased by at least 12 and at most 100kDa. In one embodiment, the molecular weight is increased by at least 15 and at most 100kDa. In one embodiment, the molecular weight is increased by at least 20 and at most 10OkDa. In one embodiment, the molecular weight is increased by at least 1 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 5 and at most 75kDa.
  • the molecular weight is increased by at least 10 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 12 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 15 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 18 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 20 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 30 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 90kDa. In one embodiment, the molecular weight is increased by at least 12 and at most 85kDa.
  • the molecular weight is increased by at least 10 and at most 75kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 70kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 60kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 50kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 49kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 48kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 47kDa. In one embodiment, the molecular weight is increased by at least 10 and at most 46kDa.
  • the O-polysaccharide includes any one Formula selected from Table 1 , wherein the number of repeat units n in the O-polysaccharide is greater than the number of repeat units in the corresponding wild-type O-polysaccharide by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58,
  • the O-antigen is part of the lipopolysaccharide (LPS) in the outer membrane of Gramnegative bacteria.
  • LPS lipopolysaccharide
  • the O-antigen is on the cell surface and is a variable cell constituent.
  • the variability of the O-antigen provides a basis for serotyping of Gram-negative bacteria.
  • the current E. co// serotyping scheme includes O-polysaccharides 1 to 181.
  • the saccharide of the invention may be one oligosaccharide unit. In one embodiment, the saccharide of the invention is one repeating oligosaccharide unit of the relevant serotype. In such embodiments, the saccharide may include a structure selected from any one of Formula O1a, Formula 02, Formula 06, Formula 08, Formula O9a, Formula 09, Formula O20ab, Formula O20ac, Formula O25b, Formula 052, Formula 097, and Formula O101 . In a further embodiment, the saccharide may include a structure selected from any one of Formula O1 a, Formula 02, Formula 06, and Formula O25b.
  • all of the saccharides of the present invention and in the immunogenic compositions of the present invention are polysaccharides.
  • High molecular weight polysaccharides may induce certain antibody immune responses due to the epitopes present on the antigenic surface.
  • the isolation and purification of high molecular weight polysaccharides are preferably contemplated for use in the conjugates, compositions and methods of the present invention.
  • the number of repeat O units in each individual O-antigen polymer depends on the wzz chain length regulator, an inner membrane protein. Different wzz proteins confer different ranges of modal lengths (4 to >100 repeat units).
  • modal length refers to the number of repeating O-units. Gram-negative bacteria often have two different Wzz proteins that confer two distinct OAg modal chain lengths, one longer and one shorter.
  • the number of repeat units may be calculated by dividing the molecular weight of the polysaccharide (without the molecular weight of the core saccharide or KDO residue) by the molecular weight of the repeat unit (i.e., molecular weight of the structure in the corresponding Formula, shown for example in Table 1 , which may be theoretically calculated as the sum of the molecular weight of each monosaccharide within the Formula).
  • the molecular weight of each monosaccharide within the Formula is known in the art.
  • the molecular weight of a repeat unit of Formula O25b for example, is about 862 Da.
  • the molecular weight of a repeat unit of Formula O1 a is about 845 Da.
  • the molecular weight of a repeat unit of Formula 02 for example, is about 829 Da.
  • the molecular weight of a repeat unit of Formula 06 for example, is about 893 Da.
  • n refers to the number of repeating units (represented in brackets in Table 1) in a polysaccharide molecule.
  • repeating structures may be interspersed with regions of imperfect repeats, such as, for example, missing branches.
  • polysaccharides isolated and purified from natural sources such as bacteria may be heterogenous in size and in branching. In such a case, n may represent an average or median value for n for the molecules in a population.
  • the saccharide includes an O-antigen wherein n in any of the O-antigen formulas (such as, for example, the Formulas shown in Table 1 (see also FIG. 9A-9C and FIG. 10A-10B)) is an integer of at least 1 , 2, 3, 4, 5, 10, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, and at most 200, 100,
  • n is at least 31 to at most 90. In a preferred embodiment, n is 40 to 90, more preferably 60 to
  • the saccharide includes an O-antigen wherein n in any one of the O-antigen Formulas is at least 1 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 5 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 10 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 25 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 50 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 75 and at most 200.
  • n in any one of the O-antigen Formulas is at least 100 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 125 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 150 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 175 and at most 200. In one embodiment, n in any one of the O-antigen Formulas is at least 1 and at most 100. In one embodiment, n in any one of the O-antigen Formulas is at least 5 and at most 100. In one embodiment, n in any one of the O-antigen Formulas is at least 10 and at most 100.
  • n in any one of the O- antigen Formulas is at least 25 and at most 75. In one embodiment, n in any one of the O- antigen Formulas is at least 30 and at most 75. In one embodiment, n in any one of the O- antigen Formulas is at least 40 and at most 75. In one embodiment, n in any one of the O- antigen Formulas is at least 50 and at most 75. In one embodiment, n in any one of the O- antigen Formulas is at least 30 and at most 90. In one embodiment, n in any one of the O- antigen Formulas is at least 35 and at most 85. In one embodiment, n in any one of the O- antigen Formulas is at least 35 and at most 75.
  • n in any one of the O- antigen Formulas is at least 36 and at most 45. In one embodiment, n in any one of the O- antigen Formulas is at least 37 and at most 44. In one embodiment, n in any one of the O- antigen Formulas is at least 38 and at most 43. In one embodiment, n in any one of the O- antigen Formulas is at least 39 and at most 42. In one embodiment, n in any one of the O- antigen Formulas is at least 39 and at most 41 .
  • n is at least 35 to at most 60.
  • n is any one of 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47,
  • n is at least 55 to at most 75.
  • n is 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, or 69, most preferably 60.
  • the purified polysaccharide before conjugation has a molecular weight of between 5 kDa and 400 kDa.
  • the saccharide has a molecular weight of between 10 kDa and 400 kDa; between 5 kDa and 400 kDa; between 5 kDa and 300 kDa; between 5 kDa and 200 kDa; between 5 kDa and 150 kDa; between 10 kDa and 100 kDa; between 10 kDa and 75 kDa; between 10 kDa and 60 kDa; between 10 kDa and 40 kDa; between 10 kDa and 100 kDa; 10 kDa and 200 kDa; between 15 kDa and 150 kDa; between 12 kDa and 120 kDa; between 12 kDa and 75 kDa; between 12 kDa and 50 kDa; between 12 and 60 k
  • the polysaccharide has a molecular weight of between 7 kDa to 15 kDa; 8 kDa to 16 kDa; 9 kDa to 25 kDa; 10 kDa to 100; 10 kDa to 60 kDa; 10 kDa to 70 kDa; 10 kDa to 160 kDa;
  • molecular weight of polysaccharide or of carrier protein- polysaccharide conjugate refers to molecular weight calculated by size exclusion chromatography (SEC) combined with multiangle laser light scattering detector (MALLS).
  • E. coli serogroups/serotypes and O-unit moieties f P-D-6dmanHep2Ac is 2-0-acetyl-6-deoxy-p-D-manno-heptopyranosyl.
  • the core oligosaccharide is positioned between Lipid A and the O-antigen outer region in wild-type E. coli LPS. More specifically, the core oligosaccharide is the part of the polysaccharide that includes the bond between the O-antigen and the lipid A in wild type E. coli. This bond includes a ketosidic bond between the hemiketal function of the innermost 3-deoxy-d- manno-oct-2-ulosonic acid (KDO)) residue and a hydroxyl-group of a GIcNAc-residue of the lipid A.
  • the core oligosaccharide region shows a high degree of similarity among wild-type E. coli strains. It usually includes a limited number of sugars.
  • the core oligosaccharide includes an inner core region and an outer core region.
  • the core oligosaccharides of wild-type E. coli are categorized in the art based on the structures of the distal oligosaccharide, into five different chemotypes: E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. coli K12.
  • the compositions described herein include glycoconjugates in which the O-polysaccharide includes a core oligosaccharide bound to the O-antigen.
  • the composition induces an immune response against at least any one of the core E. coli chemotypes E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. coli K12.
  • the composition induces an immune response against at least two core E. coli chemotypes.
  • the composition induces an immune response against at least three core E. coli chemotypes.
  • the composition induces an immune response against at least four core E. coli chemotypes.
  • the composition induces an immune response against all five core E. coli chemotypes.
  • compositions described herein include glycoconjugates in which the O-polysaccharide does not include a core oligosaccharide bound to the O-antigen.
  • such a composition induces an immune response against at least any one of the core E. coli chemotypes E. coli R1, E. coli R2, E. coli R3, E. coli R4, and E. coli K12, despite the glycoconjugate having an O- polysaccharide that does not include a core oligosaccharide.
  • E. coli serotypes may be characterized according to one of the five chemotypes. Table 2 lists exemplary serotypes characterized according to chemotype. The serotypes in bold represent the serotypes that are most commonly associated with the indicated core chemotype. Accordingly, in a preferred embodiment, the composition induces an immune response against at least any one of the core E. coli chemotypes E. coli R1 , E. coli R2, E. coli R3, E. coli R4, and E. coli K12, which includes an immune response against any one of the respective corresponding E. coli serotypes.
  • the composition includes a saccharide that includes a structure derived from a serotype having an R3 chemotype, e.g., selected from a saccharide having Formula O25b, Formula 015, Formula 0153, Formula 021 , Formula 017, Formula O11 , Formula 0159, Formula 022, Formula 086, and Formula 093, wherein n is 1 to 100, preferably 31 to 100, preferably from 31 to 90, more preferably 35 to 90, most preferably 35 to 65.
  • the saccharide in said composition further includes an E. coli R3 core moiety, e.g., shown in FIG. 24.
  • the composition includes a saccharide that includes a structure derived from a serotype having an R4 chemotype, e.g., selected from a saccharide having Formula 02, Formula O1 , Formula 086, Formula 07, Formula 0102, Formula 0160, and Formula 0166, wherein n is 1 to 100, preferably 31 to 100, preferably from 31 to 90, more preferably 35 to 90, most preferably 35 to 65.
  • the saccharide in said composition further includes an E. coli R4 core moiety, e.g., shown in FIG. 24.
  • the saccharide includes the core saccharide. Accordingly, in one embodiment, the O-polysaccharide further includes an E. coli R1 core moiety. In another embodiment, the O-polysaccharide further includes an E. coli R2 core moiety. In another embodiment, the O-polysaccharide further includes an E. coli R3 core moiety.
  • the O-polysaccharide further includes an E. coli R4 core moiety.
  • the O-polysaccharide further includes an E. coli K12 core moiety.
  • the saccharide does not include the core saccharide. Accordingly, in one embodiment, the O-polysaccharide does not include an E. coli R1 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli R2 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli R3 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli R4 core moiety. In another embodiment, the O-polysaccharide does not include an E. coli K12 core moiety.
  • O-antigens or preferably O-polysaccharides to protein carriers may improve the immunogenicity of the O-antigens or O-polysaccharides.
  • variability in polymer size represents a practical challenge for production.
  • the size of the saccharide can influence the compatibility with different conjugation synthesis strategies, product uniformity, and conjugate immunogenicity.
  • Controlling the expression of a Wzz family protein chain length regulator through manipulation of the O- antigen synthesis pathway allows for production of a desired length of O-antigen chains in a variety of Gram-negative bacterial strains, including E. coli.
  • the purified saccharides are chemically activated to produce activated saccharides capable of reacting with the carrier protein. Once activated, each saccharide is separately conjugated to a carrier protein to form a conjugate, namely a glycoconjugate.
  • a glycoconjugate refers to a saccharide covalently linked to a carrier protein.
  • a saccharide is linked directly to a carrier protein.
  • a saccharide is linked to a protein through a spacer/linker.
  • Conjugates may be prepared by schemes that bind the carrier to the O-antigen at one or at multiple sites along the O-antigen, or by schemes that activate at least one residue of the core oligosaccharide.
  • each saccharide is conjugated to the same carrier protein.
  • the present invention further relates to activated polysaccharides produced from any of the embodiments described herein wherein the polysaccharide is activated with a chemical reagent to produce reactive groups for conjugation to a linker or carrier protein.
  • the saccharide of the invention is activated prior to conjugation to the carrier protein.
  • the degree of activation does not significantly reduce the molecular weight of the polysaccharide. For example, in some embodiments, the degree of activation does not cleave the polysaccharide backbone.
  • the degree of activation does not significantly impact the degree of conjugation, as measured by the number of lysine residues modified in the carrier protein, such as, CRMI 97 (as determined by amino acid analysis).
  • the degree of activation does not significantly increase the number of lysine residues modified (as determined by amino acid analysis) in the carrier protein by 3-fold, as compared to the number of lysine residues modified in the carrier protein of a conjugate with a reference polysaccharide at the same degree of activation.
  • the degree of activation does not increase the level of unconjugated free saccharide.
  • the degree of activation does not decrease the optimal saccharide/protein ratio.
  • the activated saccharide has a percentage of activation wherein moles of thiol per saccharide repeat unit of the activated saccharide is between 1 -100%, such as, for example, between 2-80%, between 2-50%, between 3-30%, and between 4-25%.
  • the degree of activation is at least 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, > 20%, > 30%, > 40%, > 50%, > 60%, > 70%, > 80%, or > 90%, or about 100%.
  • the degree of activation is at most 50%, more preferably at most 25%. In one embodiment, the degree of activation is at most 20%. Any minimum value and any maximum value may be combined to define a range.
  • the polysaccharide is activated with 1 -cyano-4- dimethylamino pyridinium tetrafluoroborate (CDAP) to form a cyanate ester.
  • CDAP 1 -cyano-4- dimethylamino pyridinium tetrafluoroborate
  • the activated polysaccharide is then coupled directly or via a spacer (linker) group to an amino group on the carrier protein (preferably CRMI 97 or tetanus toxoid).
  • the cyanate ester (optionally made by CDAP chemistry) is coupled with hexane diamine or adipic acid dihydrazide (ADH) and the amino-derivatised saccharide is conjugated to the carrier protein (e.g., CRM197) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier.
  • ADH hexane diamine or adipic acid dihydrazide
  • the amino-derivatised saccharide is conjugated to the carrier protein (e.g., CRM197) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier.
  • the carrier protein e.g., CRM197
  • carbodiimide e.g., EDAC or EDC
  • Conjugation may involve a carbonyl linker which may be formed by reaction of a free hydroxyl group of the saccharide with CDI followed by reaction with a protein to form a carbamate linkage. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate and coupling the CDI carbamate intermediate with an amino group on a protein (CDI chemistry).
  • a carbonyl linker which may be formed by reaction of a free hydroxyl group of the saccharide with CDI followed by reaction with a protein to form a carbamate linkage. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate and coupling the CDI carbamate intermediate with an amino group on a protein
  • the glycoconjugate comprises a saccharide having a molecular weight of between 10 kDa and 2,000 kDa. In other embodiments, the saccharide has a molecular weight of between 50 kDa and 1 ,000 kDa. In other embodiments, the saccharide has a molecular weight of between 70 kDa and 900 kDa. In other embodiments, the saccharide has a molecular weight of between 100 kDa and 800 kDa. In other embodiments, the saccharide has a molecular weight of between 200 kDa and 600 kDa.
  • the saccharide has a molecular weight of 100 kDa to 1000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1 ,000 kDa; 150 kDa to 900 kDa; 150 kDa to 800 kDa; 150 kDa to 700 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 200 kDa to 1 ,000 kDa; 200 kDa to 900 kDa; 200 kDa to 800 kDa; 200 kDa
  • the glycoconjugate of the invention has a molecular weight of between 400 kDa and 15,000 kDa; between 500 kDa and 10,000 kDa; between 2,000 kDa and 10,000 kDa; between 3,000 kDa and 8,000 kDa; or between 3,000 kDa and 5,000 kDa.
  • the glycoconjugate has a molecular weight of between 500 kDa and 10,000 kDa.
  • glycoconjugate has a molecular weight of between 1 ,000 kDa and 8,000 kDa.
  • the glycoconjugate has a molecular weight of between 2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000 kDa. In further embodiments, the glycoconjugate of the invention has a molecular weight of between 200 kDa and 20,000 kDa; between 200 kDa and 15,000 kDa; between 200 kDa and 10,000 kDa; between 200 kDa and 7,500 kDa; between 200 kDa and 5,000 kDa; between 200 kDa and 3,000 kDa; between 200 kDa and 1 ,000 kDa; between 500 kDa and 20,000 kDa; between 500 kDa and 15,000 kDa; between 500 kDa and 12,500 kDa; between 500 kDa and 10,000 kDa; between 500 kDa and 7,500 kDa; between 500 kDa and 6,000 kDa; between 500 kDa and
  • the glycoconjugate having such a molecular weight is produced by eTEC conjugation described herein. In another embodiment, the glycoconjugate having such a molecular weight is produced by reductive amination chemistry (RAC). In another embodiment, the glycoconjugate having such a molecular weight is produced by reductive amination chemistry (RAC) prepared in DMSO.
  • RAC reductive amination chemistry
  • the glycoconjugate of the invention has a molecular weight of between 1 ,000 kDa and 20,000 kDa; between 1 ,000 kDa and 15,000 kDa; between 2,000 kDa and 10,000 kDa; between 2000 kDa and 7,500 kDa; between 2,000 kDa and 5,000 kDa; between 3,000 kDa and 20,000 kDa; between 3,000 kDa and 15,000 kDa; between 3,000 kDa and 12,500 kDa; between 4,000 kDa and 10,000 kDa; between 4,000 kDa and 7,500 kDa; between 4,000 kDa and 6,000 kDa; or between 5,000 kDa and 7,000 kDa.
  • the glycoconjugate having such a molecular weight is produced by reductive amination chemistry (RAC). In another embodiment, the glycoconjugate having such a molecular weight is produced by reductive amination chemistry (RAC) prepared in DMSO. In another embodiment, the glycoconjugate having such a molecular weight is produced by eTEC conjugation described herein.
  • the molecular weight of the glyco conjugate may be measured by SEC-MALLS. Any whole number integer within any of the above ranges is contemplated as an embodiment of the disclosure.
  • the glycoconjugates of the invention may also be characterized by the ratio (weight/weight) of saccharide to carrier protein.
  • the ratio of polysaccharide to carrier protein in the glycoconjugate is between 0.5 and 3 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1 .0, about 1.1 , about 1 .2, about 1 .3, about 1 .4, about 1 .5, about 1 .6, about 1 .7, about 1 .8, about 1 .9, about 2.0, about 2.1 , about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0).
  • the saccharide to carrier protein ratio is between 0.5 and 2.0, between 0.5 and 1 .5, between 0.8 and 1 .2, between 0.5 and 1 .0, between 1 .0 and 1 .5 or between 1 .0 and 2.0. In further embodiments, the saccharide to carrier protein ratio (w/w) is between 0.8 and 1.2. In a preferred embodiment, the ratio of polysaccharide to carrier protein in the conjugate is between 0.9 and 1.1. In some such embodiments, the carrier protein is CRMl97.
  • the glycoconjugates may also be characterized by their molecular size distribution (Kd).
  • Size exclusion chromatography media CL-4B
  • SEC Size Exclusion Chromatography
  • SEC Size Exclusion Chromatography
  • V o the fraction at which molecules are fully excluded
  • Vi the fraction representing the maximum retention
  • the glycoconjugates and immunogenic compositions of the invention may include free saccharide that is not covalently conjugated to the carrier protein, but is nevertheless present in the glycoconjugate composition.
  • the free saccharide may be non- covalently associated with (i.e., non-covalently bound to, adsorbed to, or entrapped in or with) the glycoconjugate.
  • the glycoconjugate comprises at most 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% of free polysaccharide compared to the total amount of polysaccharide.
  • the glycoconjugate comprises less than about 25% of free polysaccharide compared to the total amount of polysaccharide.
  • the glycoconjugate comprises at most about 20% of free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glycoconjugate comprises at most about 15% of free polysaccharide compared to the total amount of polysaccharide. In another preferred embodiment, the glyco conjugate comprises at most about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1 % of free polysaccharide compared to the total amount of polysaccharide.
  • the glycoconjugate comprises less than about 8% of free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glyco conjugate comprises at most about 6% of free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment the glyco conjugate comprises at most about 5% of free polysaccharide compared to the total amount of polysaccharide. See, for example, Table 19, Table 20, Table 21 , Table 22, Table 23, Table 24, and Table 25.
  • the carrier protein is CRM197.
  • at least one linkage between carrier protein and saccharide occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or 25 saccharide repeat units of the polysaccharide.
  • the carrier protein is CRM197. Any whole number integer within any of the above ranges is contemplated as an embodiment of the disclosure.
  • Lysine residues Another way to characterize the glycoconjugates of the invention is by the number of lysine residues in the carrier protein (e.g., CRM197) that become conjugated to the saccharide which can be characterized as a range of conjugated lysines (degree of conjugation).
  • the evidence for lysine modification of the carrier protein, due to covalent linkages to the polysaccharides, can be obtained by amino acid analysis using routine methods known to those of skill in the art. Conjugation results in a reduction in the number of lysine residues recovered, compared to the carrier protein starting material used to generate the conjugate materials.
  • the degree of conjugation of the glycoconjugate of the invention is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15 or between 10 and 12.
  • the degree of conjugation of the glycoconjugate of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 1 1 , about 12, about 13, about 14 or about 15.
  • the degree of conjugation of the glycoconjugate of the invention is between 4 and 7.
  • the carrier protein is CRM197.
  • the saccharides of the invention are O- acetylated.
  • the glycoconjugate comprises a saccharide which has a degree of O-acetylation of between 10-100%, between 20-100%, between 30-100%, between 40-100%, between 50-100%, between 60-100%, between 70-100%, between 75-100%, 80- 100%, 90-100%, 50- 90%, 60-90%, 70-90% or 80-90%.
  • the degree of O-acetylation is > 10%, > 20%, > 30%, > 40%, > 50%, > 60%, > 70%, > 80%, or > 90%, or about 100%.
  • % of O-acetylation it is meant the percentage of a given saccharide relative to 100% (where each repeat unit is fully acetylated relative to its acetylated structure).
  • the glycoconjugate is prepared by reductive amination.
  • the glycoconjugate is a single-end-linked conjugated saccharide, wherein the saccharide is covalently bound to a carrier protein directly.
  • the glycoconjugate is covalently bound to a carrier protein through a (2-((2-oxoethyl)thio)ethyl) carbamate (eTEC) spacer.
  • the saccharide is conjugated to the carrier protein by reductive amination (such as described in U.S. Patent Appl. Pub. Nos. 2006/0228380, 2007/0231340, 2007/0184071 and 2007/0184072, WO 2006/110381 , WO 2008/079653, and WO 2008/143709).
  • Reductive amination includes (1) oxidation of the saccharide, (2) reduction of the activated saccharide and a carrier protein to form a conjugate. Before oxidation, the saccharide is optionally hydrolyzed. Mechanical or chemical hydrolysis may be employed. Chemical hydrolysis may be conducted using acetic acid. The oxidation step may involve reaction with periodate.
  • periodate refers to both periodate and periodic acid. The term also includes both metaperiodate (IO 4 ‘) and orthoperiodate (IO 6 5- ) and the various salts of periodate (e.g., sodium periodate and potassium periodate).
  • the polysaccharide is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIC ).
  • the polysaccharide is oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.
  • the saccharide is said to be activated and is referred to as “activated” herein below.
  • the activated saccharide and the carrier protein may be lyophilised (freeze-dried), either independently (discrete lyophilization) or together (co-lyophilized). In one embodiment the activated saccharide and the carrier protein are co-lyophilized. In another embodiment the activated polysaccharide and the carrier protein are lyophilized independently.
  • the lyophilization takes place in the presence of a nonreducing sugar
  • non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.
  • the next step of the conjugation process is the reduction of the activated saccharide and a carrier protein to form a conjugate (so-called reductive amination), using a reducing agent.
  • Suitable reducing agents include the cyanoborohydrides, such as sodium cyanoborohydride, sodium triacetoxyborohydride or sodium or zinc borohydride in the presence of Bronsted or Lewis acids), amine boranes such as pyridine borane, 2-Picoline Borane, 2,6-diborane-methanol, dimethylamine-borane, t- BuMe'PrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylpyridine borane (PEMB), borane-pyridine, or borohydride exchange resin.
  • the reducing agent is sodium cyanoborohydride.
  • the glycoconjugates may be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by a variety of techniques known to the skilled person. These techniques include dialysis, concentration/diafiltration operations, tangential flow filtration precipitation/elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.
  • these techniques include dialysis, concentration/diafiltration operations, tangential flow filtration precipitation/elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.
  • the glycoconjugates maybe purified by diafiltration and/or ion exchange chromatography and/or size exclusion chromatography. In an embodiment, the glycoconjugates are purified by diafiltration or ion exchange chromatography or size exclusion chromatography. In one embodiment the glyco conjugates are sterile filtered.
  • a glycoconjugate from an E. co// serotype is selected from any one of O25B, O1 , 02, and 06 is prepared by reductive amination.
  • the glycoconjugates from E. coli serotypes O25B, O1 , 02, and 06 are prepared by reductive amination.
  • n is an integer of at least 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, and at most 200, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91 , 90, 89, 88, 87, 86, 81 , 80, 79, 78, 77, 76, 75, 74, 73, 72, 71 , 70, 69, 68, 67, 66, 65, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51 , or 50. Any minimum value and any maximum value may be combined to define a range.
  • Exemplary ranges include, for example, at least 1 to at most 1000; at least 10 to at most 500; and at least 20 to at most 80.
  • n is at least 31 to at most 90, more preferably 40 to 90, most preferably 60 to 85.
  • the invention relates to a conjugate that includes a carrier protein, e.g., CRM 197, linked to a saccharide having any one of the following structures shown in Table 1 (see also FIG. 9A-9C and FIG. 10A-10B), wherein n is an integer greater than or equal to 1 .
  • a carrier protein e.g., CRM 197
  • n is an integer greater than or equal to 1 .
  • a stable conjugate is believed to require a level of saccharide antigen modification that is balanced against preserving the structural integrity of the critical immunogenic epitopes of the antigen.
  • the saccharide of the invention is activated and results in the formation of an aldehyde.
  • the percentage (%) of activation (or degree of oxidation (DO)) refers to moles of a saccharide repeat unit per moles of aldehyde of the activated polysaccharide.
  • the saccharide is activated by periodate oxidation of vicinal diols on a repeat unit of the polysaccharide, resulting in the formation of an aldehyde. Varying the molar equivalents (meq) of sodium periodate relative to the saccharide repeat unit and temperature during oxidation results in varying levels of degree of oxidation (DO).
  • the saccharide and aldehyde concentrations are typically determined by colorimetric assays.
  • An alternative reagent is TEMPO (2,2,6,6-tetramethylpiperidine 1 - oxyl radical)-N-chlorosuccinimide (NCS) combination, which results in the formation of aldehydes from primary alcohol groups.
  • the activated saccharide has a degree of oxidation wherein the moles of a saccharide repeat unit per moles of aldehyde of the activated saccharide is between 1-100, such as, for example, between 2-80, between 2-50, between 3-30, and between 4-25.
  • the degree of activation is at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, > 20, > 30, > 40, > 50, > 60, > 70, > 80, or >
  • the degree of oxidation is at least 5 and at most 50, more preferably at least 10 and at most 25. In one embodiment, the degree of activation is at least 10 and at most 25. Any minimum value and any maximum value may be combined to define a range.
  • a degree of oxidation value may be represented as percentage (%) of activation.
  • a DO value of 10 refers to one activated saccharide repeat unit out of a total of 10 saccharide repeat units in the activated saccharide, in which case the DO value of 10 may be represented as 10% activation.
  • the saccharide may be a polysaccharide or an oligosaccharide.
  • the eTEC linked glycoconjugates and immunogenic compositions of the invention may include free sulfhydryl residues.
  • the activated thiolated saccharides formed by the methods provided herein will include multiple free sulfhydryl residues, some of which may not undergo covalent conjugation to the carrier protein during the conjugation step.
  • Such residual free sulfhydryl residues are capped by reaction with a athiol-reactive capping reagent, for example, iodoacetamide (IAA), to cap the potentially reactive functionality.
  • a athiol-reactive capping reagent for example, iodoacetamide (IAA)
  • Other thiol-reactive capping reagents e.g., maleimide containing reagents and the like are also contemplated.
  • the invention provides a method of preventing, treating or ameliorating a bacterial infection, disease or condition in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention, wherein said immunogenic composition comprises an eTEC linked glycoconjugate comprising a saccharide described herein.
  • said immunogenic composition comprises an eTEC linked glycoconjugate comprising a saccharide described herein.
  • the saccharide is derived from E. coli.
  • a component of the glycoconjugate of the invention is a carrier protein to which the saccharide is conjugated.
  • the terms "protein carrier” or “carrier protein” or “carrier” may be used interchangeably herein. Carrier proteins should be amendable to standard conjugation procedures.
  • the carrier protein of the conjugates is independently selected from any one of TT, DT, DT mutants (such as CRMI 97 ), H. influenzae protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO 01/98334 and WO 03/54007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, toxin A or B of C. Difficile and PsaA.
  • the carrier protein of the conjugates of the invention is DT (Diphtheria toxoid).
  • the carrier protein of the conjugates of the invention is TT (tetanus toxoid).
  • the saccharides are conjugated to CRMI 97 protein.
  • the CRM is? protein is a nontoxic form of diphtheria toxin but is immunologically indistinguishable from the diphtheria toxin.
  • CRMI 97 is produced by C. diphtheriae infected by the nontoxigenic phage p197tox _ created by nitrosoguanidine mutagenesis of the toxigenic corynephage beta.
  • the CRM i 97 protein has the same molecular weight as the diphtheria toxin but differs therefrom by a single base change (guanine to adenine) in the structural gene. This single base change causes an amino acid substitution glutamic acid for glycine) in the mature protein and eliminates the toxic properties of diphtheria toxin.
  • the CRMI 97 protein is a safe and effective T-cell dependent carrier for saccharides.
  • meningitidis serogroup B - EP0372501 PorB (from N. meningitidis), PorB (from N. meningitidis), PD (Haemophilus influenzae protein D - see, e.g., EP 0 594 610 B), or immunologically functional equivalents thereof, synthetic peptides (EP0378881 , EP0427347), heat shock proteins (WO 93/17712, WO 94/03208), pertussis proteins (WO 98/58668, EP0471 177), cytokines, lymphokines, growth factors or hormones (WO 91/01146), artificial proteins comprising multiple human CD4+ T cell epitopes from various pathogen derived antigens (Falugi et al (2001 ) Eur J Immunol 31 ; 3816-3824) such as N19 protein (Baraldoi et al (2004) Infect Immun 72; 4884-7) pneumococcal surface protein PspA (WO 02/091998), iron
  • PsaA pneumococcal adhesion protein
  • PsaA pneumococcal adhesion protein
  • Pseudomonas aeruginosa exotoxin A in particular non-toxic mutants thereof (such as exotoxin A bearing a substitution at glutamic acid 553 (Uchida Cameron DM, RJ Collier. 1987. J. Bacteriol. 169:4967-4971)
  • Other proteins such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or purified protein derivative of tuberculin (PPD) also can be used as carrier proteins.
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • PPD purified protein derivative of tuberculin
  • Suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., as described in Int'l Patent Application No. WO 2004/083251), E. coli LT, E. coli ST, and exotoxin A from Pseudomonas aeruginosa.
  • inactivated bacterial toxins such as cholera toxoid (e.g., as described in Int'l Patent Application No. WO 2004/083251), E. coli LT, E. coli ST, and exotoxin A from Pseudomonas aeruginosa.
  • the carrier protein is detoxified Pseudomonas exotoxin (EPA). In another embodiment, the carrier protein is not detoxified Pseudomonas exotoxin (EPA). In one embodiment, the carrier protein is flagellin. In another embodiment, the carrier protein is not flagellin.
  • the carrier protein of the glycoconjugates is SCP (Streptococcal C5a Peptidase). All human isolates of p-hemolytic streptococci produce a highly conserved cell-wall protein SCP (Streptococcal C5a Peptidase) that specifically inactivates C5a.
  • SCP Streptococcal C5a Peptidase
  • the scp genes encode a polypeptide containing between 1 ,134 and 1 ,181 amino acids (Brown et al., PNAS, 2005, vol. 102, no. 51 pages 18391-18396). The first 31 residues are the export signal presequence and are removed upon passing through the cytoplasmic membrane.
  • the carrier protein of the glycoconjugates of the invention is an SCP from GBS (SCPB).
  • SCPB GBS
  • An example of SCPB is provided at SEQ. ID. NO: 3 of W097/26008. See also SEQ ID NO: 3 of WOOO/34487.
  • the carrier protein of the glycoconjugate of the invention is an SCP from GAS (SCPA). Examples of SCPA can be found at SEQ.ID.NO:1 and SEQ.ID.NO:2 of W097/26008. See also SEQ ID NOs: 1 , 2 and 23 of WOOO/34487.
  • Dosage regimens may be adjusted to provide the optimum desired response. For example, a single dose of the polypeptide derived from E. coli or fragment thereof may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the exigencies of the situation. It is to be noted that dosage values may vary with the type and severity of the condition to be alleviated, and may include single or multiple doses. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition. Determining appropriate dosages and regimens for administration of the therapeutic protein are well-known in the relevant art and would be understood to be encompassed by the skilled artisan once provided the teachings disclosed herein.
  • the amount of the polypeptide derived from E. coli or fragment thereof in the composition may range from about 10 pg to about 300 pg of each protein antigen. In some embodiments, the amount of the polypeptide derived from E. coli or fragment thereof in the composition may range from about 20 pg to about 200 pg of each protein antigen.
  • the amount of a particular glycoconjugate in an immunogenic composition can be calculated based on total polysaccharide for that conjugate (conjugated and nonconjugated). For example, a glycoconjugate with 20% free polysaccharide will have about 80 pg of conjugated polysaccharide and about 20 pg of non-conjugated polysaccharide in a 100 pg polysaccharide dose.
  • the amount of glycoconjugate can vary depending upon the E. coli serotype.
  • the saccharide concentration can be determined by the uronic acid assay.
  • the "immunogenic amount" of the different polysaccharide components in the immunogenic composition may diverge and each may comprise about 1 .0 pg, about 2.0 pg, about 3.0 pg, about 4.0 pg, about 5.0 pg, about 6.0 pg, about 7.0 pg, about 8.0 pg, about 9.0 pg, about 10.0 pg, about 15.0 pg, about 20.0 pg, about 30.0 pg, about 40.0 pg, about 50.0 pg, about 60.0 pg, about 70.0 pg, about 80.0 pg, about 90.0 pg, or about 100.0 pg of any particular polysaccharide antigen.
  • each dose will comprise 0.1 pg to 100 pg of polysaccharide for a given serotype, particularly 0.5 pg to 20 pg, more particularly 1 pg to 10 pg, and even more particularly 2 pg to 5 pg. Any whole number integer within any of the above ranges is contemplated as an embodiment of the disclosure.
  • each dose will comprise 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, 15 pg or 20 pg of polysaccharide for a given serotype.
  • Carrier protein amount Generally, each dose will comprise 5 pg to 150 pg of carrier protein, particularly 10 pg to 100 pg of carrier protein, more particularly 15 pg to 100 pg of carrier protein, more particularly 25 pg to 75 pg of carrier protein, more particularly 30 pg to 70 pg of carrier protein, more particularly 30 pg to 60 pg of carrier protein, more particularly 30 pg to 50 pg of carrier protein and even more particularly 40 pg to 60 pg of carrier protein.
  • said carrier protein is CRMI 97 .
  • the immunogenic compositions disclosed herein may further comprise at least one, two or three adjuvants. In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one adjuvant. In some embodiments, the immunogenic compositions disclosed herein may further comprise one adjuvant. In some embodiments, the immunogenic compositions disclosed herein may further comprise two adjuvants.
  • adjuvant refers to a compound or mixture that enhances the immune response to an antigen. Antigens may act primarily as a delivery system, primarily as an immune modulator or have strong features of both. Suitable adjuvants include those suitable for use in mammals, including humans.
  • Suitable immune modulatory type adjuvants include, but are not limited to, saponin extracts from the bark of the Aquilla tree (QS21 , Quil A), TLR4 agonists such as MPLA (Monophosphoryl Lipid A), 3DMPL (3-0- deacylated MPL) or GLA-AQ, LT/CT mutants, cytokines such as the various interleukins (e.g., IL-2, IL-12) or GM-CSF, AS01 , and the like.
  • saponin extracts from the bark of the Aquilla tree QS21 , Quil A
  • TLR4 agonists such as MPLA (Monophosphoryl Lipid A), 3DMPL (3-0- deacylated MPL) or GLA-AQ
  • LT/CT mutants cytokines such as the various interleukins (e.g., IL-2, IL-12) or GM-CSF, AS01 , and the like.
  • ISCOMS see, e.g., Sjblander et al. (1998) J. Leukocyte Biol. 64:713; WO 90/03184, WO 96/11711 , WO 00/48630, WO 98/36772, WO 00/41720, WO 2006/134423 and WO 2007/026190
  • GLA-EM which is a combination of a TLR4 agonist and an oil-in-water emulsion.
  • Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl- normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutarninyl-L- alanine-2-(1 '-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.
  • thr-MDP N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • nor-MDP N-25 acetyl- normuramyl-L-alanyl-D-isoglutamine
  • the adjuvant is a liposomal QS21 formulation as set forth in Example 35.
  • the adjuvant is a liposomal MPLA formulation as set forth in Example 35.
  • the adjuvant is a liposomal MPLA/QS21 formulation as set forth in Example 35.
  • CpG immunostimulatory oligonucleotides may comprise one or more palindromes that in turn may encompass the CpG dinucleotide.
  • CpG oligonucleotides have been described in a number of issued patents, published patent applications, and other publications, including U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371 ; 6,239,116; and 6,339,068.
  • the immunogenic compositions as disclosed herein comprise any of the CpG Oligonucleotide described at page 3, line 22, to page 12, line 36, of WO 2010/125480.
  • the nanostructure includes a single assembly including a plurality of identical first nanostructure-related polypeptides.
  • the nanostructures are typically ball-like shaped, and/or have rotational symmetry (e.g., with 3-fold and 5-fold axis), e.g., with an icosahedral structure exemplified herein.
  • the nanostructure includes (a) a plurality of first assemblies, each first assembly comprising a plurality of identical first nanostructure-related polypeptides, wherein the first nanostructure-related polypeptides comprise the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOS: 59-92; and (b) a plurality of second assemblies, each second assembly comprising a plurality of identical second nanostructure-related polypeptides, wherein the second nanostructure-related polypeptides comprise the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOS: 59-92, and wherein the second nanostructure-related polypeptide differs from the first nanostructure-related polypeptide; wherein the plurality of first assemblies non-covalently interact with the plurality of second assemblies to form a nanostructure.
  • SEQ ID NOS: 59-92 provide the amino acid sequence of exemplary nanostructure-related polypeptides.
  • the number of interface residues for the exemplary nanostructure-related polypeptides of SEQ ID NO:59-92 range from 4-13 residues.
  • the nanostructure-related polypeptides comprise an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical over its length, and identical at least at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, or 13 identified interface positions (depending on the number of interface residues for a given nanostructure-related polypeptide), to the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOS: 59-92.
  • the nanostructure-related polypeptides comprise an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical over its length, and identical at least at 20%, 25%, 33%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 100% of the identified interface positions, to the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOS: 59-92.
  • the nanostructure-related polypeptides include a nanostructure-related polypeptide having the amino acid sequence of a nanostructure-related polypeptide selected from the group consisting of SEQ ID NOS: 59-98.
  • the nanostructure-related polypeptides can be modified to facilitate covalent linkage to a “cargo” of interest.
  • the nanostructure-related polypeptides can be modified, such as by introduction of various cysteine residues at defined positions to facilitate linkage to one or more antigens of interest, such that a nanostructure of the nanostructure-related polypeptides would provide a scaffold to provide a large number of antigens for delivery as a vaccine to generate an improved immune response.
  • the nanostructure-related polypeptides can be modified, for example, by introducing cysteine residues that will allow chemical conjugation of such a lipid or organic polymer to the monomer or resulting assemly surface.
  • the nanostructure-related polypeptides can be modified, for example, by introducing cysteine residues that will allow chemical conjugation of fluorophores or other imaging agents that allow visualization of the nanostructures in vitro or in vivo.
  • nanostructure-related polypeptides can be mutated in order to improve the stability or solubility of the protein subunits or the assembled nanostructures.
  • a multiple sequence alignment of other proteins from that family can be used to guide the selection of amino acid mutations at non-conserved positions that can increase protein stability and/or solubility, a process referred to as consensus protein design (9).
  • Surface amino acid residues on the nanostructure-related polypeptides can be mutated to positively charged (Arg, Lys) or negatively charged (Asp, Glu) amino acids in order to endow the protein surface with an overall positive or overall negative charge.
  • surface amino acid residues on the nanostructure-related polypeptides can be mutated to endow the interior surface of the self-assembling nanostructure with a high net charge. Such a nanostructure can then be used to package or encapsulate a cargo molecule with the opposite net charge due to the electrostatic interaction between the nanostructure interior surface and the cargo molecule.
  • surface amino acid residues on the nanostructure-related polypeptides can be mutated primarily to Arginine or Lysine residues in order to endow the interior surface of the self-assembling nanostructure with a net positive charge.
  • Solutions containing the nanostructure-related polypeptides can then be mixed in the presence of a nucleic acid cargo molecule such as a dsDNA, ssDNA, dsRNA, ssRNA, cDNA, miRNA., siRNA, shRNA, piRNA, or other nucleic acid in order to encapsulate the nucleic acid inside the self-assembling nanostructure.
  • a nucleic acid cargo molecule such as a dsDNA, ssDNA, dsRNA, ssRNA, cDNA, miRNA., siRNA, shRNA, piRNA, or other nucleic acid in order to encapsulate the nucleic acid inside the self-assembling nanostructure.
  • a nanostructure could be used, for example, to protect, deliver, or concentrate nucleic
  • the nanostructure has icosahedral symmetry.
  • the nanostructure may comprise 60 copies of the first nanostructure-related polypeptide and 60 copies of the second nanostructure-related polypeptide.
  • the number of identical first nanostructure-related polypeptides in each first assembly is different than the number of identical second nanostructure-related polypeptides in each second assembly.
  • the nanostructure comprises twelve first assemblies and twenty second assemblies; in this embodiment, each first assembly may; for example, comprise five copies of the identical first nanostructure- related polypeptide, and each second assembly may, for example, comprise three copies of the identical second nanostructure-related polypeptide.
  • the nanostructure comprises twelve first assemblies and thirty second assemblies; in this embodiment, each first assembly may, for example, comprise five copies of the identical first nanostructure-related polypeptide, and each second assembly may, for example, comprise two copies of the identical second nanostructure- related polypeptide.
  • the nanostructure comprises twenty first assemblies and thirty second assemblies; in this embodiment, each first assembly may, for example, comprise three copies of the identical first nanostructure-related polypeptide, and each second assembly may, for example, comprise two copies of the identical second nanostructure-related polypeptide. All of these embodiments are capable of forming synthetic nanomaterials with regular icosahedral symmetry.
  • Klebsiella pneumoniae (K. pneumoniae) is a Gram-negative pathogen, known to cause urinary tract infections, bacteremia, and sepsis. Multidrug-resistant Klebsiella pneumoniae infections are an increasing cause of mortality in vulnerable populations at risk.
  • the O-antigen serotypes are highly prevalent among strains causing invasive disease globally and derived O-antigen glycoconjugates are attractive as vaccine antigens.
  • any of the compositions disclosed herein may further comprise at least one saccharide that is, or is derived from, at least one K. pneumoniae serotype selected from O1 (and d-Gal-lll variants), 02 (and d-Gal-lll variants), O2ac, 03, 04, 05, 07, 08, and 012.
  • any of the compositions disclosed herein may further comprise a polypeptide derived from K. pneumoniae selected from a polypeptide derived from K. pneumoniae Type I fimbrial protein or an immunogenic fragment thereof; or a polypeptide derived from K. pneumoniae Type III fimbrial protein or an immunogenic fragment thereof; or a combination thereof.
  • K. pneumoniae selected from a polypeptide derived from K. pneumoniae Type I fimbrial protein or an immunogenic fragment thereof
  • K. pneumoniae Type III fimbrial protein or an immunogenic fragment thereof or a combination thereof.
  • pneumoniae O1 and 02 O-antigens and their corresponding v1 and v2 subtypes are polymeric galactans that differ in the structures of their repeat units.
  • K. pneumoniae O1 and 02 antigens contain homopolymer galactose units (or galactans).
  • K. pneumoniae O1 and 02 antigens each contain D-galactan I units (sometimes referred to as the O2a repeat unit), but O1 antigens differ in that O1 antigens have a D-galactan II cap structure.
  • D-galactan III (d-Gal-lll) is a variant of D-galactan I.
  • the saccharide derived from K. pneumoniae O1 includes a repeat unit of [ ⁇ 3)-p-D-Galf -(1 - ⁇ 3)-a-D-Galp-(1 ->]. In some embodiments, the saccharide derived from K. pneumoniae O1 includes a repeat unit of [— >3)-a-D- Galp-(1— >3)- p-D-Galp- (1-*]. In some embodiments, the saccharide derived from K.
  • the saccharide derived from K. pneumoniae O1 includes a repeat unit of — >3)-p-D-Galf -(1 — >3)-a-D-Galp-(1— >], and a repeat unit of [ ⁇ 3)-a-D- Galp-(1 — >3)- p-D- Galp-(1 — >].
  • the saccharide derived from K. pneumoniae O1 includes a repeat unit of — >3)-p-D-Galf -(1 — >3)-[a-D-Galp-(1 — >4)]-a-D-Galp-(1 — >] (referred to as the D-Gal- lll repeat unit).
  • the saccharide derived from K. pneumoniae 02 includes a repeat unit of [ ⁇ 3)-a-D-Galp-(1 ⁇ 3)-p-D-Galf-(1 ⁇ ] (which may be an element of K. pneumoniae serotype O2a antigen). In some embodiments, the saccharide derived from K. pneumoniae 02 includes a repeat unit of [— >3)-p-D-GlcpNAc-(1 — >5)-p-D-Galf-(1 — >] (which may be an element of K. pneumoniae serotype O2c antigen). In some embodiments, the saccharide derived from K.
  • pneumoniae 02 includes a modification of the O2a repeat unit by side chain addition of (1— >4)- linked Galp residues (which may be an element of the K. pneumoniae O2afg antigen).
  • the saccharide derived from K. pneumoniae 02 includes a modification of the O2a repeat unit by side chain addition of (1 — >2)-linked Galp residues (which may be an element of the K. pneumoniae O2aeh antigen).
  • O-antigen polysaccharide structure of K. pneumoniae serotypes 03 and 05 are disclosed in the art to be identical to those of E. coll serotypes O9a (Formula O9a) and 08 (Formula 08), respectively.
  • the invention includes a composition including a polypeptide derived from E. coli FimH or a fragment thereof; and at least one saccharide that is, or derived from, at least one K. pneumoniae serotype selected from O1 (and d-Gal-l 11 variants), 02 (and d-Gal-lll variants), O2ac, 03, 04, 05, 07, 08, and 012.
  • the composition includes saccharides from or derived from one or more of serotypes O1 , 02, 03, and 05, or a combination thereof.
  • the composition includes saccharides from or derived from each of serotypes O1 , 02, 03, and 05.
  • the invention includes a composition including at least one saccharide that is, or is derived from, at least one K. pneumoniae serotype selected from O1 (and d-Gal-lll variants), 02 (and d-Gal-lll variants), O2ac, 03, 04, 05, 07, 08, and 012; and a saccharide derived from an E.Coli O-antigen having a structure selected from any one of Formula O1 (e.g., Formula O1A, Formula O1 B, and Formula O1C), Formula 02, Formula 03, Formula 04 (e.g., Formula O4:K52 and Formula O4:K6), Formula 05 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula 06 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula 07, Formula 08, Formula 09, Formula 010, Formula O11 , Formula 012, Formula 013, Formula 014, Formula 015, Formula 01
  • Formula O45rel Formula 046, Formula 048, Formula 049, Formula 050, Formula 051 , Formula 052, Formula 053, Formula 054, Formula 055, Formula 056, Formula 057, Formula 058, Formula 059, Formula 060, Formula 061 , Formula 062, Formula 62Di, Formula 063, Formula 064, Formula 065, Formula 066, Formula 068, Formula 069, Formula 070, Formula 071 , Formula 073 (e.g., Formula 073 (strain 73-1)), Formula 074, Formula 075, Formula 076, Formula 077, Formula 078, Formula 079, Formula 080, Formula 081 , Formula 082, Formula 083, Formula 084, Formula 085, Formula 086, Formula 087, Formula 088, Formula 089, Formula 090, Formula 091 , Formula 092, Formula 093, Formula 095, Formula 096, Formula 097, Formula 098, Formula 099, Formula 0100, Formula 0101 , Formula 0102, Formula 0103, Formula 0104, Formula 0105, Formula 0106, Formula 0107, Formula 0108, Formula 0109
  • the composition includes a saccharide from or derived from one or more of K. pneumoniae serotypes O1 , 02, 03 and 05, or a combination thereof. In some embodiments, the composition includes a saccharide from or derived from each of K. pneumoniae serotypes O1 , 02, 03 and 05. In some embodiments, the composition includes a saccharide derived from an E.Coli O-antigen having Formula 09 and does not include a saccharide derived from K. pneumoniae serotype 03. In some embodiments, the composition includes a saccharide derived from an E.Coli O-antigen having Formula 08 and does not include a saccharide derived from K. pneumoniae serotype 05.
  • the invention in another aspect, relates to a composition including a polypeptide derived from E. coll FimH or a fragment thereof; at least one saccharide that is, or derived from, at least one K. pneumoniae serotype selected from O1 (and d-Gal-l II variants), 02 (and d-Gal-ll I variants), O2ac, 03, 04, 05, 07, 08, and 012; and a saccharide having a structure selected from any one of Formula O1 (e.g., Formula O1A, Formula O1 B, and Formula O1 C), Formula 02, Formula 03, Formula 04 (e.g., Formula O4:K52 and Formula O4:K6), Formula 05 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula 06 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula 07, Formula 08, Formula 09, Formula 010, Formula O11 , Formula 012, Formula
  • the composition includes a saccharide derived from an E.Coli O-antigen having Formula 09 and does not include a saccharide derived from K. pneumoniae serotype 03. In some embodiments, the composition includes a saccharide derived from an E.Coli O-antigen having Formula 08 and does not include a saccharide derived from K. pneumoniae serotype 05. In some embodiments, the composition includes at least one saccharide derived from any one K. pneumoniae type selected from the group consisting of O1 , 02, 03, and 05.
  • the composition includes at least one saccharide derived from K. pneumoniae type O1 .
  • the K.pneumoniae O- antigen is selected from subtype v1 (O1v1) or subtype v2 (O1v2).
  • the K.pneumoniae O-antigen is selected from subtype v1 (O1v1) and subtype v2 (O1v2).
  • the composition includes at least one saccharide derived from K. pneumoniae type 02.
  • the K.pneumoniae O-antigen is selected from subtype v1 (O2v1) or subtype v2 (O2v2).
  • the K.pneumoniae O-antigen is selected from subtype v1 (O2v1) and subtype v2 (O2v2).
  • the K.pneumoniae O-antigen is selected from the group consisting of: a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype 02 subtype v1 (O2v1), and d) serotype 02 subtype v2 (O2v2).
  • the K.pneumoniae O- antigen is subtype v1 (O1 v1).
  • the K.pneumoniae O-antigen is subtype v2 (O1v2). In one aspect of this embodiment, the K.pneumoniae O-antigen is subtype v1 (O2v1). In one aspect of this embodiment, the K.pneumoniae O-antigen is subtype v2 (O2v2).
  • the composition comprises one, two, three or four K.pneumoniae O-antigen selected from the group consisting of: a) serotype O1 subtype v1 (O1v1), b) serotype O1 subtype v2 (O1v2), c) serotype 02 subtype v1 (O2v1), and d) serotype 02 subtype v2 (O2v2).ln some embodiments, the composition includes a combination of saccharides derived from K. pneumoniae, wherein a first saccharide is derived from any one of K.
  • the composition includes at least one saccharide derived from K. pneumoniae type O1 and at least one saccharide derived from K. pneumoniae type 02.
  • the saccharide derived from K. pneumoniae is conjugated to a carrier protein; and the saccharide derived from E. coli is conjugated to a carrier protein.
  • the invention includes a composition including a polypeptide derived from E. coli FimH or a fragment thereof; and at least one saccharide derived from any one K. pneumoniae type selected from the group consisting of O1 , 02, 03, and 05.
  • the invention includes at least one saccharide derived from any one K. pneumoniae type selected from the group consisting of O1 , 02, 03, and 05; and at least one saccharide derived from E. coli having a structure selected from any one of Formula O1 (e.g., Formula O1A, Formula O1 B, and Formula O1 C), Formula 02, Formula 03, Formula 04 (e.g., Formula O4:K52 and Formula O4:K6), Formula 05 (e.g., Formula O5ab and Formula O5ac (strain 180/C3)), Formula 06 (e.g., Formula O6:K2; K13; K15 and Formula O6:K54), Formula 07, Formula 08, Formula 09, Formula 010, Formula O11 , Formula 012, Formula 013, Formula 014, Formula 015, Formula 016, Formula 017, Formula 018 (e.g., Formula O18A, Formula O18ac, Formula O18A1 , Formula O18B, and Formula O18B1), Formula 019, Formula
  • Formula 044 (e.g., Formula 045 and Formula O45rel), Formula 046, Formula 048, Formula 049, Formula 050, Formula 051 , Formula 052, Formula 053,
  • the composition includes a saccharide derived from an E.Coli O-antigen having Formula 09 and does not include a saccharide derived from K. pneumoniae serotype 03. In some embodiments, the composition includes a saccharide derived from an E.Coli O-antigen having Formula 08 and does not include a saccharide derived from K. pneumoniae serotype 05.
  • the composition includes at least one saccharide derived from K. pneumoniae type O1 ; and at least one saccharide derived from E. coll having a structure selected from the group consisting of Formula 08 and Formula 09.
  • the composition includes at least one saccharide derived from K. pneumoniae type 02; and at least one saccharide derived from E. coll having a structure selected from the group consisting of Formula 08 and Formula 09.
  • the composition includes at least one saccharide derived from K. pneumoniae type O1 ; at least one saccharide derived from K. pneumoniae type 02; and at least one saccharide derived from E. coll having a structure selected from the group consisting of Formula 08 and Formula 09.
  • the entire birth cohort is included as a relevant population for immunization. This could be done, for example, by beginning an immunization regimen anytime from birth to 6 months of age, from 6 months of age to 5 years of age, in pregnant women (or women of child-bearing age) to protect their infants by passive transfer of antibody, infants still in utero, and subjects greater than 50 years of age.
  • Conformation and ligand-binding properties of the lectin domain of FimH are under the allosteric control of the pilin domain of FimH.
  • the interaction of the two domains of full length FimH stabilizes the lectin domain in the low- affinity to monomannose (for example, -300 pM) state, which is characterized by a shallow binding pocket.
  • Binding to a mannoside ligand induces a conformational change leading to a medium affinity state, where the lectin and pilin domains remain in close contact.
  • the lectin and pilin domains separate, thereby inducing the high-affinity state (for example, ⁇ 1 .2 pM).
  • pSB01878 has expected mass consistent with N-terminal F22. Glycosylation present on 1 or 2 sites (+1 mass from each deamidation of N-D).
  • Glycosylation mutants were constructed. See, for example, pSB02081 , pSB02082, pSB02083, pSB02088, and pSB02089.
  • the glycosylation mutants expressed the polypeptides of interest. See FIG. 5 for results.
  • Colonies from each were inoculated into 2xYT zeo50ug/ml, grown overnight at 37°C, plasmid prepped and digested with Notl and Xhol to test for FimC insert and Hindlll and BamHI to test for FimH inserts. All clones had expected sized inserts at both cloning sites. The pSB01879-1 and pSB01880-1 clones were subsequently used for expression.
  • FimH donor strand complement FimG constructs have also been shown to have robust expression in EXPI293 cells.
  • the base constructs for pSB01882-01895 were constructed. Primers were used to PCR amplify pcDNA3.1 (+) with ACCUPRIME PFX DNA Polymerase (Thermo Fisher), digest the PCR products with Ndel (in CMV promoter) and BamHI and cloned into pcDNA3.1 (+) that was digested with Ndel and BamHI and gel isolated to remove the fragment.
  • Primers were used to PCR amplify pcDNA3.1 (+) with ACCUPRIME PFX DNA Polymerase (Thermo Fisher), digest the PCR products with Ndel (in CMV promoter) and BamHI and cloned into pcDNA3.1 (+) that was digested with Ndel and BamHI and gel isolated to remove the fragment.
  • FIG. 3 shows the results following expression in 20 mL EXPI293 cells, 72 hours, 10 ul of conditioned media loaded; high levels of expression observed; the FimH/FimC complex present following expression from pSB01879 & pSB01880 constructs; 20 ml conditioned media batch bound to Nickel Excel, 40 CV wash, elution in Imdidazole.
  • FimH-donor strand complement constructs were prepared. See, for example, pSB02198, pSB02199, pSB02200, pSB02304, pSB02305, pSB02306, pSB02307, pSB02308 constructs.
  • the expression of pSB2198 FimH dscG lock mutant construct is shown in FIG. 7.
  • the pSB2198 FimH dscG Lock Mutant yielded 12 mg/L from transient expression. According to Vi-CELL XR 2.04 (Beckman Coulter, Inc.), the following were observed (actual cell type used for expression was HEK cells):
  • EXAMPLE 7 The sidechain of Phe1 in FimH does not interact directly with D-mannose but is rather buried inside of FimH, suggesting that Phe1 can be replaced by other residues, e.g. aliphatic hydrophobic residues (He, Leu, or Vai)
  • EXAMPLE 9 E. coli and S. enterica strains
  • Clinical strains and derivatives are listed in Table 10. Additional reference strains included: O25K5H1 , a clinical O25a serotype strain; and S. enterica serovar Typhimurium strain LT2.
  • OPS O- Polysaccharide
  • EXAMPLE 10 Oligonucleotide primers for wzzB, fepE and O-antigen gene cluster cloning
  • O25bFepE_A ATAATTGACGATCCGGTTGCC (SEQ ID NO: 43) ST131 assembly and
  • Genbank MG1655 wzzB P2_AS ATTGAGAACCTGCGTAAACGGC (SEQ ID NO: NC_000913.3 or W3110
  • pBAD33_ada CGGTAGCTGTAAAGCCAGGGGCGGTAGCGTG Adaptor has central ptor_S GTTTAAACCCAAGCAACAGATCGGCGTCGTCG Pmel site and homology
  • EXAMPLE 11 Plasmids Plasmid vectors and subclones are listed in Table 12. PCR fragments harboring various
  • E. coli and Salmonella wzzB and fepE genes were amplified from purified genomic DNA and subcloned into the high copy number plasmid provided in the Invitrogen PCROBIunt cloning kit FIG. 12A-12B.
  • This plasmid is based on the pUC replicon.
  • Primers P3 and P4 were used to amplify E. coli wzzB genes with their native promoter, and are designed to bind to regions in proximal and distal genes encoding UDP-glucose-6-dehydrogenase and phosphoribosyladenine nucleotide hydrolase respectively (annotated in Genbank MG1655 NC_000913.3).
  • a PCR fragment containing Salmonella fepE gene and promoter were amplified using primers previously described.
  • Analogous E. coli fepE primers were designed based on available Genbank genome sequences or whole genome data generated internally (in case of GAR2401 and O25K5H1).
  • Low copy number plasmid pBAD33 was used to express O-antigen biosynthetic genes under control of the arabinose promoter.
  • the plasmid was first modified to facilitate cloning (via Gibson method ) of long PCR fragments amplified using universal primers homologous to the 5’ promoter and 3’ 6-phosphogluconate dehydrogenase (gnd) gene Table 12.
  • the pBAD33 subclone containing the O25b biosynthetic operon is illustrated in FIG. 12A- 12B.
  • the fermentation broth was treated with acetic acid to a final concentration of 1 - 2% (final pH of 4.1).
  • the extraction of OAg and delipidation were achieved by heating the acid treated broth to 100°C for 2 hours.
  • the batch was cooled to ambient temperature and 14% NH 4 OH was added to a final pH of 6.1.
  • the neutralized broth was centrifuged and the centrate was collected.
  • CaCI 2 in sodium phosphate was incubated for 30 mins at room temperature. The solids were removed by centrifugation and the centrate was concentrated 12-fold using a 10kDa membrane, followed by two diafiltrations against water.
  • the retentate which contained OAg was then purified using a carbon filter.
  • the carbon filtrate was diluted 1 :1 (v/v) with 4.0M ammonium sulfate.
  • the final ammonium sulfate concentration was 2M.
  • the ammonium sulfate treated carbon filtrate was further purified using a membrane with 2M ammonium sulfate as the running buffer.
  • the OAg was collected in the flow through.
  • the HIC filtrate was concentrated and then buffer exchanged against water (20 diavolumes) using a 5kDa membrane.
  • the MWCO was further reduced to enhance yield.
  • the first set of long chain O25b polysaccharide-CRMig? conjugates were produced using periodate oxidation followed by conjugation using reductive amination chemistry (RAC) (Table 14).
  • Conjugate variants with three activation levels (low, medium and high) by varying the oxidation levels.
  • Conjugates were produced by reacting the lyophilized activated polysaccharides with lyophilized CRMI 97 , reconstituted in DMSO medium, using sodium cyanoborohydride as the reducing agent. Conjugation reactions were carried out at 23 °C for 24 hrs, followed by capping using sodium borohydride for 3 hrs.
  • conjugates were purified by ultrafiltration/diafiltration with 100K MWCO regenerated cellulose membrane, using 5mM Succinate/0.9% NaCI, pH 6.0. Final filtration of the conjugates were performed using a 0.22 pm membrane.
  • the conjugates disclosed throughout the following Examples include a core saccharide moiety.
  • wzzB genes from GAR 2401 and O25K5H1 were subcloned into the high copy PCR-Blunt II cloning vector and introduced into both strains by electroporation. Additional wzzB genes from E. 0011 ⁇ - 2 and S. enterica serovar Typhimurium LT2 were similarly cloned and transferred; likewise fepE genes from E. coli O25K5H1 , GAR 2401 , O25a ETEC NR-5, O157:H7:K- and S. enterica serovar Typhimurium LT2.
  • coli fepE from O25a O25K5H1 conferred the ability to express very long (VL) OAg LPS, with the Salmonella LT2 fepE resulting in OAg exceeding in size that conferred by E. coli fepE.
  • E. coli O25a or K12 strain wzzB restored ability to produce short LPS.
  • the Salmonella LT2 fepE generated the longest LPS, the E. coli fepE a slightly shorter LPS, while the Salmonella LT2 wzzB yielded an intermediate sized long LPS (L).
  • L intermediate sized long LPS
  • the fepE genes from GAR2401 , an O25a ETEC strain and an 0157 Shigella toxin producing strain also conferred the ability to produce very long LPS, but not as long as the LPS generated with the Salmonella LT2 fepE (FIG. 14).
  • O25b OAg-specific IgG mean fluorescence intensity values (MFIs) of approximately ten-fold above pre-immune serum levels were observed in PD4 sera from three out of four rabbits vaccinated with O25b OAg- CRMI 97 , across a range of serum dilutions (from 1 :100 to 1 :6400).
  • Bacteria grown on TSA plates were suspended in PBS, adjusted to OD 6 oo of 2.0 and fixed in 4% paraformaldehyde in PBS. After blocking in 4% BSA/PBS for 1 h, bacteria were incubated with serial dilutions of pre-immune and PD3 immune sera in 2% BSA/PBS, and bound IgG detected with PE-labeled secondary F(ab) antibody.
  • pre-immune rabbit antibodies failed to bind to wild-type serotype O25b isolates GAR2831and GAR2401 or to a K-12 E. coli strain, whereas matched PD3 antibodies stained the O25b bacteria in a concentration dependent manner.
  • Negative control K-12 strain which lacks the ability to express OAg showed only very weak binding of PD3 antibodies, most likely due to the presence of exposed inner core oligosaccharide epitopes on its surface.
  • Introduction of the Salmonella fepE plasmid into the wild-type O25b isolates resulted in significantly enhanced staining, consistent with the higher density of immunogenic epitopes provided by the longer OAg polysaccharide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Mycology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
EP21802007.1A 2020-10-27 2021-10-25 Escherichia coli zusammensetzungen und verfahren dafür Pending EP4237428A2 (de)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063106077P 2020-10-27 2020-10-27
US202163144058P 2021-02-01 2021-02-01
US202163254195P 2021-10-11 2021-10-11
PCT/IB2021/059820 WO2022090893A2 (en) 2020-10-27 2021-10-25 Escherichia coli compositions and methods thereof

Publications (1)

Publication Number Publication Date
EP4237428A2 true EP4237428A2 (de) 2023-09-06

Family

ID=78500672

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21802007.1A Pending EP4237428A2 (de) 2020-10-27 2021-10-25 Escherichia coli zusammensetzungen und verfahren dafür

Country Status (9)

Country Link
EP (1) EP4237428A2 (de)
JP (1) JP7664386B2 (de)
AU (1) AU2021368151B2 (de)
CA (1) CA3199610A1 (de)
CO (1) CO2023005372A2 (de)
IL (1) IL302362A (de)
MX (1) MX2023004912A (de)
PE (1) PE20231934A1 (de)
WO (1) WO2022090893A2 (de)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11260119B2 (en) 2018-08-24 2022-03-01 Pfizer Inc. Escherichia coli compositions and methods thereof
US12138302B2 (en) 2020-10-27 2024-11-12 Pfizer Inc. Escherichia coli compositions and methods thereof
US12357681B2 (en) 2020-12-23 2025-07-15 Pfizer Inc. E. coli FimH mutants and uses thereof
KR20240116841A (ko) 2021-12-17 2024-07-30 화이자 인코포레이티드 폴리뉴클레오티드 조성물 및 그의 용도
KR20260020489A (ko) 2023-06-14 2026-02-11 화이자 인코포레이티드 Rna를 안정화시키는 방법
TW202602467A (zh) * 2024-03-11 2026-01-16 美商輝瑞股份有限公司 包含經共軛之大腸桿菌糖的免疫原性組成物及其用途
WO2025202834A1 (en) 2024-03-26 2025-10-02 Pfizer Inc. Polynucleotide compositions and uses thereof

Family Cites Families (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4709017A (en) 1985-06-07 1987-11-24 President And Fellows Of Harvard College Modified toxic vaccines
US4950740A (en) 1987-03-17 1990-08-21 Cetus Corporation Recombinant diphtheria vaccines
US4912094B1 (en) 1988-06-29 1994-02-15 Ribi Immunochem Research Inc. Modified lipopolysaccharides and process of preparation
NZ230747A (en) 1988-09-30 1992-05-26 Bror Morein Immunomodulating matrix comprising a complex of at least one lipid and at least one saponin; certain glycosylated triterpenoid saponins derived from quillaja saponaria molina
DE3841091A1 (de) 1988-12-07 1990-06-13 Behringwerke Ag Synthetische antigene, verfahren zu ihrer herstellung und ihre verwendung
DE68907045T2 (de) 1989-01-17 1993-12-02 Eniricerche Spa Synthetische Peptide und deren Verwendung als allgemeine Träger für die Herstellung von immunogenischen Konjugaten, die für die Entwicklung von synthetischen Impfstoffen geeignet sind.
JPH04506662A (ja) 1989-07-14 1992-11-19 アメリカン・サイアナミド・カンパニー 接合体ワクチンのためのサイトカイニンおよびホルモンのキヤリヤー
IT1237764B (it) 1989-11-10 1993-06-17 Eniricerche Spa Peptidi sintetici utili come carriers universali per la preparazione di coniugati immunogenici e loro impiego per lo sviluppo di vaccini sintetici.
SE466259B (sv) 1990-05-31 1992-01-20 Arne Forsgren Protein d - ett igd-bindande protein fraan haemophilus influenzae, samt anvaendning av detta foer analys, vacciner och uppreningsaendamaal
DE69113564T2 (de) 1990-08-13 1996-05-30 American Cyanamid Co Faser-Hemagglutinin von Bordetella pertussis als Träger für konjugierten Impfstoff.
IT1262896B (it) 1992-03-06 1996-07-22 Composti coniugati formati da proteine heat shock (hsp) e oligo-poli- saccaridi, loro uso per la produzione di vaccini.
ATE178907T1 (de) 1992-05-06 1999-04-15 Harvard College Rezeptorbindende region des diphtherietoxius
CA2138997C (en) 1992-06-25 2003-06-03 Jean-Paul Prieels Vaccine composition containing adjuvants
IL102687A (en) 1992-07-30 1997-06-10 Yeda Res & Dev Conjugates of poorly immunogenic antigens and synthetic pepide carriers and vaccines comprising them
ES2231770T3 (es) 1993-03-05 2005-05-16 Wyeth Holdings Corporation Nuevos plasmidos para la produccion de proteina crm y toxina difterica.
SG48309A1 (en) 1993-03-23 1998-04-17 Smithkline Beecham Biolog Vaccine compositions containing 3-0 deacylated monophosphoryl lipid a
GB9326253D0 (en) 1993-12-23 1994-02-23 Smithkline Beecham Biolog Vaccines
WO1995020657A1 (en) * 1994-01-27 1995-08-03 Gx Biosystems A/S Receptor specific bacterial adhesins and their use
US6455673B1 (en) 1994-06-08 2002-09-24 President And Fellows Of Harvard College Multi-mutant diphtheria toxin vaccines
US5917017A (en) 1994-06-08 1999-06-29 President And Fellows Of Harvard College Diphtheria toxin vaccines bearing a mutated R domain
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
WO1996002555A1 (en) 1994-07-15 1996-02-01 The University Of Iowa Research Foundation Immunomodulatory oligonucleotides
AUPM873294A0 (en) 1994-10-12 1994-11-03 Csl Limited Saponin preparations and use thereof in iscoms
GB9513261D0 (en) 1995-06-29 1995-09-06 Smithkline Beecham Biolog Vaccines
US5846547A (en) 1996-01-22 1998-12-08 Regents Of The University Of Minnesota Streptococcal C5a peptidase vaccine
AUPO517897A0 (en) 1997-02-19 1997-04-11 Csl Limited Chelating immunostimulating complexes
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
AU7690898A (en) 1997-05-20 1998-12-11 Ottawa Civic Hospital Loeb Research Institute Vectors and methods for immunization or therapeutic protocols
GB9712347D0 (en) 1997-06-14 1997-08-13 Smithkline Beecham Biolog Vaccine
GB9713156D0 (en) 1997-06-20 1997-08-27 Microbiological Res Authority Vaccines
AU1145699A (en) 1997-09-05 1999-03-22 Smithkline Beecham Biologicals (Sa) Oil in water emulsions containing saponins
US6303114B1 (en) 1998-03-05 2001-10-16 The Medical College Of Ohio IL-12 enhancement of immune responses to T-independent antigens
US6218371B1 (en) 1998-04-03 2001-04-17 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
WO1999052549A1 (en) 1998-04-09 1999-10-21 Smithkline Beecham Biologicals S.A. Adjuvant compositions
GB9817052D0 (en) 1998-08-05 1998-09-30 Smithkline Beecham Biolog Vaccine
AU750587B2 (en) 1998-10-16 2002-07-25 Smithkline Beecham Biologicals (Sa) Adjuvant systems and vaccines
DE69940439D1 (de) 1998-12-21 2009-04-02 Medimmune Inc Streptococcus pneumoniae proteine und immunogene fragmente für impstoffe
KR100802198B1 (ko) 1998-12-23 2008-02-11 샤이어 바이오켐 인코포레이티드 신규한 스트렙토코커스 항원
AUPP807399A0 (en) 1999-01-08 1999-02-04 Csl Limited Improved immunogenic lhrh composition and methods relating thereto
ES2572834T3 (es) 1999-02-17 2016-06-02 Csl Limited Complejos inmunogénicos y métodos relacionados con los mismos
JP2002539273A (ja) 1999-03-19 2002-11-19 スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム ワクチン
CA2365914A1 (en) 1999-04-09 2000-10-19 Techlab, Inc. Recombinant clostridium toxin a protein carrier for polysaccharide conjugate vaccines
CN1227030C (zh) 1999-04-19 2005-11-16 史密丝克莱恩比彻姆生物有限公司 包含皂甙和免疫刺激寡核苷酸的佐剂组合物
EP1194561A2 (de) * 1999-07-13 2002-04-10 Medimmune, Inc. Impfstoffe basierend auf zusammensetzungen aus pilin und diesen komplementierenden polypeptide
CO5200838A1 (es) 1999-09-24 2002-09-27 Smithkline Beecham Corp Vacunas
JP2003509473A (ja) 1999-09-24 2003-03-11 スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム ワクチン
GB0007432D0 (en) 2000-03-27 2000-05-17 Microbiological Res Authority Proteins for use as carriers in conjugate vaccines
WO2001098334A2 (en) 2000-06-20 2001-12-27 Shire Biochem Inc. Streptococcus antigens
CA2414460A1 (en) * 2000-07-07 2002-01-17 Medimmune, Inc. Fimh adhesin proteins and methods of use
US20030035806A1 (en) 2001-05-11 2003-02-20 D'ambra Anello J. Novel meningitis conjugate vaccine
EP1456231A2 (de) 2001-12-20 2004-09-15 Shire Biochem Inc. Streptococcus antigene
PT1601689E (pt) 2003-03-13 2008-01-04 Glaxosmithkline Biolog Sa Processo de purificação para citolisina bacteriana
US20060251675A1 (en) 2003-03-17 2006-11-09 Michael Hagen Mutant cholera holotoxin as an adjuvant and an antigen carrier protein
CA2572427A1 (en) 2004-07-18 2006-01-18 Heather L. Davis Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses
AU2005333126A1 (en) 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing innate immune responses
EP2425853A1 (de) 2005-04-08 2012-03-07 Wyeth LLC Multivalente Pneumokokken-Polysaccharidproteinkonjugatzusammensetzung
US7709001B2 (en) 2005-04-08 2010-05-04 Wyeth Llc Multivalent pneumococcal polysaccharide-protein conjugate composition
US7955605B2 (en) 2005-04-08 2011-06-07 Wyeth Llc Multivalent pneumococcal polysaccharide-protein conjugate composition
US20070184072A1 (en) 2005-04-08 2007-08-09 Wyeth Multivalent pneumococcal polysaccharide-protein conjugate composition
BRPI0813644B8 (pt) 2007-06-26 2021-05-25 Glaxosmithkline Biologicals Sa composição imunogênica, vacina, processo para fabricar a mesma, e, uso da composição imunogênica ou vacina
WO2010125480A1 (en) 2009-04-30 2010-11-04 Coley Pharmaceutical Group, Inc. Pneumococcal vaccine and uses thereof
DK3421051T3 (da) 2012-08-16 2020-06-22 Pfizer Fremgangsmåder til glycokonjugering og sammensætninger
US9802987B2 (en) 2013-03-08 2017-10-31 Pfizer Inc. Immunogenic fusion polypeptides
KR20160062169A (ko) * 2013-10-11 2016-06-01 글리코박신 아게 숙주 세포 변형 방법
EP3193918A4 (de) * 2014-09-18 2018-06-20 University of Maryland, Baltimore Kombinierter breitbandimpfstoff zur verhütung von infektionen durch klebsiella pneumoniae und pseudomonas aeruginosa
WO2018150269A1 (en) 2017-02-17 2018-08-23 Lonza Ltd. Multi-site specific integration cells for difficult to express proteins
GB201711635D0 (en) * 2017-07-19 2017-08-30 Glaxosmithkline Biologicals Sa Immunogenic composition
US11260119B2 (en) * 2018-08-24 2022-03-01 Pfizer Inc. Escherichia coli compositions and methods thereof
MX2022005252A (es) * 2019-11-01 2022-06-08 Pfizer Composiciones de escherichia coli y metodos de las mismas.
MX2022010350A (es) * 2020-02-23 2022-09-19 Pfizer Composiciones de esquerichia coli y sus metodos.

Also Published As

Publication number Publication date
WO2022090893A2 (en) 2022-05-05
KR20230096033A (ko) 2023-06-29
MX2023004912A (es) 2023-05-16
CO2023005372A2 (es) 2023-05-19
CA3199610A1 (en) 2022-05-05
AU2021368151A8 (en) 2023-06-22
AU2021368151A1 (en) 2023-06-01
PE20231934A1 (es) 2023-12-01
AU2021368151B2 (en) 2024-09-05
TW202227467A (zh) 2022-07-16
WO2022090893A3 (en) 2022-06-09
JP2023546615A (ja) 2023-11-06
JP7664386B2 (ja) 2025-04-17
IL302362A (en) 2023-06-01

Similar Documents

Publication Publication Date Title
AU2020375214B2 (en) Escherichia coli compositions and methods thereof
US12458689B2 (en) Escherichia coli compositions and methods thereof
AU2021368151B2 (en) Escherichia coli compositions and methods thereof
US12138302B2 (en) Escherichia coli compositions and methods thereof
JP7538459B1 (ja) 大腸菌FimH変異体およびその使用
CN116615439A (zh) 大肠杆菌组合物及其方法
RU2851282C1 (ru) Композиции escherichia coli и связанные с ними способы
KR102966765B1 (ko) 에스케리키아 콜라이 조성물 및 그의 방법
TWI924715B (zh) 大腸桿菌組合物及其方法
RU2821929C1 (ru) Композиции escherichia coli и способы на их основе
HK40089674A (zh) 大肠杆菌组合物及其方法
HK40081440A (en) Escherichia coli compositions and methods thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20230530

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230908

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)