EP2627352B1 - Antigène gb de cytomégalovirus - Google Patents

Antigène gb de cytomégalovirus Download PDF

Info

Publication number
EP2627352B1
EP2627352B1 EP11768058.7A EP11768058A EP2627352B1 EP 2627352 B1 EP2627352 B1 EP 2627352B1 EP 11768058 A EP11768058 A EP 11768058A EP 2627352 B1 EP2627352 B1 EP 2627352B1
Authority
EP
European Patent Office
Prior art keywords
cmv
seq
polypeptide
polypeptides
slp12
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP11768058.7A
Other languages
German (de)
English (en)
Other versions
EP2627352A2 (fr
Inventor
Guy Jean Marie Fernand Pierre Baudoux
Normand Blais
Martine Marchand
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GlaxoSmithKline Biologicals SA
Original Assignee
GlaxoSmithKline Biologicals SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GlaxoSmithKline Biologicals SA filed Critical GlaxoSmithKline Biologicals SA
Publication of EP2627352A2 publication Critical patent/EP2627352A2/fr
Application granted granted Critical
Publication of EP2627352B1 publication Critical patent/EP2627352B1/fr
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/245Herpetoviridae, e.g. herpes simplex virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/01DNA viruses
    • C07K14/03Herpetoviridae, e.g. pseudorabies virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/01DNA viruses
    • C07K14/03Herpetoviridae, e.g. pseudorabies virus
    • C07K14/04Varicella-zoster virus
    • C07K14/045Cytomegalovirus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55555Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55572Lipopolysaccharides; Lipid A; Monophosphoryl lipid A
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55577Saponins; Quil A; QS21; ISCOMS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to the field of immunology.
  • the invention provides compositions, such as for example, vaccines, as well as methods for eliciting an immune response specific for Cytomegalovirus (CMV).
  • CMV Cytomegalovirus
  • HCMV human cytomegalovirus
  • the human cytomegalovirus (HCMV) is a ubiquitous DNA virus belonging to the Herpes virus family. HCMV is made up of a DNA core, an outer capsid and covered by a lipid membrane which incorporates virus specific glycoproteins.
  • HCMV is endemic in most part of the world. Primary infection however normally results in subclinical disease after which the virus becomes latent retaining the capacity to reactivate at any later time. Among two populations, HCMV is however responsible for serious medical conditions. HCMV is a major cause of congenital defects in newborns infected in utero. It is the most common cause of congenital infection in the developed world. Congenital infection refers to infection transmitted from mother to foetus prior to birth of the newborn. Among congenitally infected newborns, 5-10% have major clinical symptoms at birth, such as microcephaly, intracranial calcifications, and hepatitis. Many infants with congenital HCMV infection are asymptomatic at birth. However, follow-up studies have shown that 15% of such infants will have sequelae such as hearing loss or central nervous system abnormalities causing, in particular, poor intellectual performance.
  • the second population at risk are immunocompromised patients, such as those suffering from HIV infection and those undergoing transplantations.
  • the virus becomes an opportunistic pathogen and causes severe disease with high morbidity and mortality.
  • the clinical disease causes a variety of symptoms including fever, hepatitis, pneumonitis and infectious mononucleosis.
  • candidate vaccines are developed including live attenuated vaccines and subunit vaccines.
  • a subunit vaccine comprising a modified glycoprotein B (gB) deleted from its transmembrane domain combined with the MF59TM emulsion was tested in a phase II clinical trial ( WO 2009/037359 , N. Engl. J. Med. 2009; 360: 1191-9 ).
  • a cytomegalovirus (CMV) gB polypeptide comprising a non-functional transmembrane (TM) domain and at least a portion of a gB protein extracellular domain comprising a fusion loop 1 (FL1) domain defined by amino acids Y.I.Y located at position 155-157 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides, and a fusion loop 2 (FL2) domain defined by amino acids W.L.Y located at position 240-242 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides, wherein at least one of the FL1 and FL2 domains comprises at least one amino acid deletion or substitution.
  • CMV cytomegalovirus
  • a CMV gB polypeptide having the sequence selected from the group consisting of the sequences set forth in: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO:21.
  • an immunogenic composition comprising the CMV gB polypeptides of the invention admixed with a suitable pharmaceutical carrier.
  • a polynucleotide that encodes the CMV gB polypeptides of the invention.
  • a polynucleotide having the sequence selected from the group consisting of the sequences set forth in: SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, and SEQ ID NO:17.
  • a recombinant vector comprising the polynucleotides of the invention.
  • a host cell transformed with the recombinant vector of the invention.
  • CMV gB polypeptides of the invention for use in the prevention and/or treatment of CMV infection.
  • the present invention concerns a novel CMV gB polypeptide which presents excellent immunogenicity and superior process characteristics.
  • the gB polypeptide of the invention is particularly suitable as an antigen for inclusion in an immunogenic composition, such as vaccines.
  • the gB polypeptide of the invention displays an improved homogenous product profile.
  • the inventors observed that upon expression, gB polypeptides of the prior art, such as a gB polypeptide lacking the transmembrane domain (gB-DeltaTM), assembled into multimers of different sizes, including high molecular weight multimers, making the population heterogeneous. They also observed that the multimer profile was not consistent, as the proportion of multimers of a given size varied from one experiment to another.
  • a CMV gB polypeptide lacking the transmembrane domain is described in EP 0 802 979 .
  • trimers represent at least 50%, suitably at least 60% and more suitably at least 70% of the population of CMV gB polypeptides of the present disclosure.
  • the inventors observed that the purification yield of the polypeptides according to the invention is significantly higher than the purification yield obtained with the CMV gB polypeptide of the prior art lacking the transmembrane domain.
  • the yield improvement is at least 2-fold, and possibly at least 3- to 5-fold.
  • further mutations in the novel polypeptides in accordance with the invention are shown to result in polypeptides being more efficiently expressed and secreted than the prior art polypeptides.
  • Such a property presents a significant advantage in terms of antigen production for vaccine manufacturing, a field in which the antigen production is typically a limiting factor.
  • gB polypeptides such as a CMV gB polypeptide lacking the transmembrane domain
  • a clipping occurred in the C-terminal cytoplasmic domain of gB resulting in at least two different forms of the polypeptide having a different size after recombinant expression in cells and secretion.
  • an immunogenic composition such as in a vaccine
  • the inventors found out that when deleting at least part of the C-terminal cytoplasmic domain, the clipping no longer occurred and the resulting population of polypeptides was mainly made of a single form of gB.
  • an improved homogenous product profile means that the population of CMV gB polypeptides of the invention, upon their recombinant expression, is made of at least 50% of trimers, for instance, as measured by analytical ultra centrifugation (See Example 2, section 1.2).
  • a preparation comprising a population of CMV gB polypeptides of the invention is made of at least 50%, suitably at least 60%, and more suitably, at least 70% of of trimers.
  • trimerisation profile or "a trimer-enriched profile” in the present specification.
  • heterogeneous population means that the population is made of at least two polypeptides having different sizes, while a homogenous population is to be understood as a population mainly made of a single polypeptide of a given size.
  • a heterogeneous population means that the population is made of different mature polypeptides starting each with a different amino acid at the N-terminus.
  • a homogeneous population is to be understood as a population mainly made of a single mature polypeptide, which polypeptide starting unvaryingly with an identical given amino acid at the N-terminal end.
  • a "mature" polypeptide refers to a polypeptide wherein the signal sequence has been cleaved off.
  • a preparation comprising a population of mature CMV gB polypeptides produced after cleavage of the signal sequence, wherein at least 30%, at least 80%, from 80% to 90% of the mature gB polypeptides comprise the same amino acid at the N-terminal end.
  • the mature polypeptides described in the disclosure suitably start with a serine or a histidine at the N-terminal position.
  • gB is an envelope glycoprotein B having numerous roles, one of which is the involvement in the fusion of the Cytomegalovirus with host cells. It is encoded by the UL55 gene of HCMV genome.
  • the size of the native form of gB depends on the size of the open reading frame (ORF) which may vary a little according to the strain. For example, the ORF of AD169 strain, which is 2717 bp long, encodes a full length gB of 906 amino acids whereas the ORF of Towne strain encodes a full length gB of 907 amino acids.
  • AD169 gB contains in the N-terminal to C-terminal direction of the protein (see also FIG. 1 ) (i) an amino acid signal sequence, or signal peptide, known to be involved in the polypeptide intracellular trafficking including targeting the polypeptide towards secretion, followed by (ii) a region called the leader sequence, (iii) an extracellular domain containing an endoproteolytic cleavage site of a furin type between amino acids 456 and 460 of the sequence set forth in SEQ ID NO:1, (iv) a transmembrane domain and (v) a C-terminal cytoplasmic domain.
  • an amino acid signal sequence, or signal peptide known to be involved in the polypeptide intracellular trafficking including targeting the polypeptide towards secretion, followed by (ii) a region called the leader sequence, (iii) an extracellular domain containing an endoproteolytic cleavage site of a furin type between amino acids 456 and 460 of the sequence set forth in S
  • amino acid stretches have been identified in the amino acid sequence of CMV gB as putative fusion loops based on sequence alignment with gB proteins originating from distinct herpesviruses ( Backovic et al. 2007. J. Virol. 81(17): 9596-600 ), such as HSV. HSV fusion loops were experimentally determined ( Hannah, B.P. et al. 2009. J. Virol. 83(13): 6825-6836 ). Said stretches were so called owing to their involvement in fusion of the viruses with host cells. According to the above literature, two putative fusion loops were identified by sequence alignment in CMV gB, which are called FL1 and FL2, in the rest of the specification. Said fusion loops are located in the extracellular domain of the protein upstream to the transmembrane domain.
  • the present inventors observed that disrupting the fusion loops FL1 and FL2 of a CMV gB polypeptide having a non-functional transmembrane domain, by mutating specific amino acids, resulted in a product which upon expression presented an improved trimerisation profile, as compared to a CMV gB polypeptide having a non-functional transmembrane domain, but having intact fusion loops.
  • the CMV gB polypeptide comprises the mutation, such as for instance amino acid substitution, or deletion, of at least one of the fusion loops FL1 or FL2, possibly both.
  • the polypeptide of the disclosure comprises at least one amino acid substitution, or deletion, in the fusion loop FL1.
  • the polypeptide of the disclosure comprises at least one amino acid substitution, or deletion, in the fusion loop FL2. More suitably, the CMV gB polypeptide of the disclosure comprises the mutation of both fusion loops FL1 and FL2. For instance, the gB polypeptide of the disclosure comprises at least one amino acid substitution, or deletion, in the fusion loop FL1 and at least one amino acid substitution, or deletion, in the fusion loop FL2.
  • the amino acids encompassing the fusion loop FL1 of CMV AD169 gB are defined as 155 Y.I.Y 157 of the sequence set forth in SEQ ID NO:1.
  • the amino acids encompassing the fusion loop FL2, i.e. the amino acid sequence of FL2, within the meaning of the present invention are defined as 240 W.L.Y 242 of the sequence set forth in SEQ ID NO:1.
  • Corresponding fusion loops FL1 and FL2 sequences can be identified within gB polypeptides from other CMV strains, for instance, by sequence alignment.
  • Disruption of said fusion loops includes any type of mutation in relation to these amino acid triplets, whether by deletion or amino acid substitutions, which results in a product, upon recombinant expression, having a trimer-enriched, improved profile, that is the product has a greater proportion of polypeptides in a trimeric form as compared with the non-mutated form
  • a non-limiting suitable mutation concerning FL1 is the deletion, or substitution, of at least one, suitably at least two, amino acids selected from 155 Y.I.Y 157 amino acids of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains, with a polar amino acid, in particular, a non-aromatic polar amino acid, more particularly, an amino acid selected from the group of positively charged amino acids consisting of lysine (K), histidine (H) and arginine (R).
  • K lysine
  • H histidine
  • R arginine
  • the CMV gB polypeptidehaving a non-functional transmembrane domain has a mutated fusion loop FL1 wherein at least the isoleucine (I 156 ) suitably at least the tyrosine (Y 155 ), suitably at least the tyrosine (Y 157 ), is substituted with a histidine (H), or is deleted.
  • the CMV gB polypeptide of the disclosure has a mutated fusion loop FL1 wherein at least the tyrosine (Y 157 ) is substituted with an arginine (R).
  • the CMV gB polypeptide having a non-functional transmembrane domain has a mutated fusion loop FL1 wherein at least the isoleucine (I 156 ) and tyrosine (Y 157 ) are substituted with histidine (H 156 ) and arginine (R 157 ), respectively, or deleted.
  • the CMV gB polypeptide having a non-functional transmembrane domain has a mutated fusion loop FL1 wherein at least the tyrosine (Y 155 ) is substituted with a glycine (G), or is deleted, optionally, in combination with the substitution, or deletion, of the isoleucine (I 156 ) with a histidine (H) or with the substitution, or deletion, of the tyrosine (Y 157 ) with an arginine (R), or in combination with both substitutions, or deletions.
  • G glycine
  • R arginine
  • the CMV gB polypeptide of the invention having a non-functional transmembrane domain has a mutated fusion loop FL1 wherein the three amino acids 155 Y.I.Y 157 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains, are substituted with amino acids 155 G.H.R 157 .
  • the mutation of the FL1 domain can be defined in an alternative way.
  • the hydrophobicity of a particular amino acid sequence can be determined using a hydrophobicity scale, such as the Kyte and Dolittle scale ( Kyte et al. 1982. J. Mol. Bio. 157: 105-132 ).
  • the FL1 domain which encompasses the amino acids 155 Y.I.Y 157 achieves a score of +1.9 on that scale.
  • the stretch of amino acids Y.I.Y located at position 155-157 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides is substituted with a stretch of three amino acids having a hydrophobicity score of less than -3, less than - 7, or less than -8, as measured using the Kyte and Doolittle scale. All three amino acids may not be substituted simultaneously, so long as the global score of the amino acid stretch reaches the above-specified values. For example, only one or two amino acids of the three amino acid long stretch may be substituted, the scoring being then calculated based on the identity of the substituted amino acids, i.e. one or two, plus the identity of the native ones, two or one, respectively.
  • a non-limiting suitable mutation concerning the fusion loop FL2 is the deletion, or substitution of at least one, suitably at least two, amino acids selected from 240 W.L.Y 242 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains, with a positively charged amino acid selected from the group consisting of lysine (K), histidine (H) and arginine (R), suitably a histidine (H).
  • the CMV gB polypeptide of the invention has a mutated fusion loop FL2 wherein at least the tyrosine (Y 242 ), suitably at least the leucine (L 241 ), suitably at least the tryptophan (W 240 ), is substituted with a histidine (H), or deleted, optionally, in combination with a mutated fusion loop FL1 as described above.
  • the CMV gB polypeptide of the invention has a mutated fusion loop FL2 wherein the three amino acids 240 W.L.Y 242 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains, are substituted with amino acids 240 A.F.H 242 , optionally, in combination with FL1 mutations as described above.
  • the mutations relating to FL1 and/or FL2 fusion loops are not limited to the above described mutations. Further mutations, in addition to the ones described above, may be performed, such as, for instance, mutating amino acids surrounding the above triplets 155 Y.I.Y 157 and 240 W.L.Y 242 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains, so long as the resulting mutant polypeptide presents an improved, trimer-enriched, profile, and said further mutations do not interfere with production (expression and secretion), processing or stability of the polypeptide when recombinantly expressed in host cells.
  • the present inventors also observed that combining the mutation of at least one fusion loop (FL1 and/or FL2), such as any of the above described mutations, with an additional mutation in the C-terminal cytoplasmic domain of the polypeptide also provided a CMV gB polypeptide with an improved trimerisation profile.
  • the C-terminal cytoplasmic domain of a gB CMV polypeptide is to be understood as the domain located downstream to the transmembrane domain (see also Fig. 1 ).
  • the additional mutation in the C-terminal cytoplasmic domain suitably concerns the deletion of a hydrophobic region, suitably a proline-rich region, suitably a highly hydrophilic, negatively charged region, possibly all of them.
  • a suitable mutation corresponds to the deletion of the amino acids 825 to 877 of the sequence set forth in SEQ ID NO:1 which is called Del2.
  • the delineation of the above sequence which is deleted is not strictly limited to the amino acid position 825 to 877 and may vary, so long as the resulting mutant polypeptide presents an improved, trimer-enriched, profile, and is not affected in terms of production, processing or stability when recombinantly expressed in host cells.
  • the CMV gB polypeptide comprises both the mutation of at least one fusion loop (FL1 and/or FL2), suitably FL1, and the deletion of at least one hydrophobic region, one proline-rich region and one highly hydrophilic region in the C-terminal cytoplasmic domain, in particular, the deletion of amino acids 825 to 877 (Del2) of the sequence set forth in SEQ ID NO:1.
  • Hydrophobicity of an amino acid sequence or a fragment thereof is dictated by the type of amino acids composing this sequence or a fragment thereof.
  • Amino acids are commonly classified into distinct groups according to their side chains. For example, some side chains are considered non-polar, i.e. hydrophobic, while some others are considered polar.
  • alanine (A), glycine (G), valine (V), leucine (L), isoleucine (I), methionine (M), proline (P), phenylalanine (F) and tryptophan (W) are considered to be part of hydrophobic amino acids, while serine (S), threonine (T), asparagine (N), glutamine (Q), tyrosine (Y), cysteine (C), lysine (K), arginine (R), histidine (H), aspartic acid (D) and glutamic acid (E) are considered to be part of polar amino acids.
  • amino acids are also classified into subgroups based on common properties shared by their side chains. For example, phenylalanine, tryptophan and tyrosine are jointly classified as aromatic amino acids and will be considered as aromatic amino acids within the meaning of the present invention. Aspartate (D) and glutamate (E) are part of the acidic or negatively charged amino acids, while lysine (K), arginine (R) and histidine (H) are part of the basic or positively charged amino acids, and they will be considered as such in the sense of the present invention.
  • Aspartate (D) and glutamate (E) are part of the acidic or negatively charged amino acids
  • lysine (K), arginine (R) and histidine (H) are part of the basic or positively charged amino acids, and they will be considered as such in the sense of the present invention.
  • Hydrophobicity scales are available which utilize the hydrophobic and hydrophilic properties of each of the 20 amino acids and allocate a hydrophobic score to each amino acid, creating thus a hydrophobicity ranking.
  • a hydrophobicity ranking may be available.
  • This scale allows to calculate the average hydrophobicity within a segment of predetermined length.
  • hydrophobic regions in an amino acid sequence may be identified by the skilled person as potential targets for mutation in accordance with the present invention. The ability of the mutation of said regions to induce an improved product profile of the resulting mutant protein, i.e.
  • the mutation of a hydrophobic region may consist in a deletion of said region as indicated above, or part of it, or in point mutations substituting hydrophobic amino acids with polar amino acids within said region.
  • the relevance of the mutation will be determined by analysing the resulting effect of said mutation on the product profile of the mutated polypeptide, upon recombinant expression in host cells, that is, a relevant mutation is to induce an improved, trimer-enriched, profile wherein at least 50%, suitably at least 60% and more suitably, at least 70% of trimers are present within the population of the mutated polypeptide.
  • the CMV gB polypeptides of the invention comprise both the mutation of at least one fusion loop (FL1 and/or FL2), suitably FL1, or possibly both, and the deletion of the entire cytoplasmic domain, for example, amino acids 776 to 906 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides.
  • Any method allowing to discriminate the constituents within a population, such as purified polypeptides possibly aggregating to each other, according to their size or density can be used for monitoring the product profile and, thus, for determining whether given mutations are conferring an improved profile product as described above.
  • Suitable methods may be based on sedimentation, such as analytical ultracentrifugation (AUC), or on chromatography, in particular, size exclusion chromatography, such as size exclusion chromatography based on UV (SEC-UV).
  • AUC analytical ultracentrifugation
  • SEC-UV size exclusion chromatography
  • a method for evaluating the aggregation level within a protein or polypeptide sample can consist in treating the sample with a cross-linking agent, so as to form covalent bonds between two proteins, or polypeptides, or more.
  • Glutaraldehyde may suitably be used as a cross-linker.
  • loading the sample on a gel in denaturing conditions, such as SDS-PAGE, and staining the gel for the presence of proteins, for example with Coomassie blue or silver nitrate will display aggregates, if any, which are separated according to their molecular weight.
  • Loading in parallel a ladder made of proteins with known molecular weight will allow determining the molecular weight of the different aggregates.
  • the molecular weight of the minimal unit such as a polypeptide in its monomeric form, is known, then the observed molecular weight of the aggregates will be indicative of the multimerisation level within aggregates.
  • the CMV AD169 gB polypeptide deleted from the transmembrane domain is 838 amino acids long. If considering that the average molecular weight of an amino acid is 110 kDa, then the expected molecular weight of this polypeptide is 92 kDa. Therefore, should such a polypeptide aggregate, then the average molecular weight of the resulting multimers would be expected to be a multiple of 92. In particular, if forming trimers, the expected average molecular weight of such trimers, made of 3 molecules of gB deleted from the transmembrane domain, is 276 kDa.
  • CMV gB polypeptides according to the present invention are to be understood as having a non-functional transmembrane domain and comprising further specific mutations, such as the fusion loops mutations.
  • the location of a transmembrane domain within a polypeptide can be predicted through the use of computer programs able to formulate a hydropathy scale from the amino acid sequence, using the hydrophobic and hydrophilic properties of the 20 amino acids ( Kyte et al. 1982. J. Mol. Bio. 157: 105-132 ). The average hydropathy within a segment of predetermined length of sequence is calculated continuously as the program moves through the sequence.
  • CMV gB may the publication by Spaete et al. ( Spaete et al., 1988, Virology 167: 207-225 ) cited. Indeed, the authors identified in the CMV gB polypeptide from the strains AD169 and Towne a putative hydrophobic transmembrane domain readily apparent as two broad, adjacent hydrophobic peaks near the C-terminus of the gB polypeptide.
  • the first one comprises amino acids 715 to 748 and the second one amino acids 752 to 772 (the numbering corresponds to the amino acid sequence of the gB polypeptide from the AD169 strain as depicted in SEQ ID NO:1).
  • the transmembrane domain of the CMV gB polypeptide encompasses at least the amino acids 701 to 775 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides, and is thus 74 amino acid long.
  • a non-functional transmembrane domain it is to be understood within the meaning of the present invention that at least part of the putative transmembrane domain is altered to enable secretion of the resulting polypeptide from a host cell upon expression in said cell.
  • the gB polypeptide is deleted from the entire transmembrane domain.
  • the CMV gB polypeptides retain a portion of the transmembrane domain.
  • the CMV gB polypeptides retain at least 5%, suitably at least 10%, more suitably at least 20%, more suitably at least 30%, or at least 50% of the amino acids of the transmembrane domain.
  • the transmembrane domain of the CMV gB polypeptide of the invention is made non-functional by deleting amino acid amino acids 701 to 775 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides.
  • the extent of the deletion may further vary, so long as the resulting deleted CMV gB polypeptide is secreted from host cells upon expression in said cells.
  • the functional alteration of the transmembrane domain is not limited to deletion of amino acids.
  • the alteration may consist in any other type of amino acid mutations, such as insertion and/or substitutions. Deletions, insertions and substitutions of amino acids may also be combined in any way, so long as the resulting mutated CMV gB polypeptide is secreted from host cells upon expression in said cells.
  • the secretion of a polypeptide can be detected and the secretion level be assessed by any technique known in the art.
  • the cell culture supernatant is collected before the cells are lysed according to any common lysis method, providing thus two fractions, a cellular one and a supernatant one.
  • the content of the polypeptide can then be measured in each fraction by any protein detection technique known in the art.
  • the polypeptide can be detected by Western-blot or by ELISA assay.
  • the extracellular domain By “comprising at least a portion of the extracellular domain”, it is to be understood in the sense of the present invention as at least the part of the extracellular domain comprising or encompassing the fusion loops FL1 and FL2.
  • the number of additional amino acids outside the fusion loops in the extracellular domain may vary.
  • the appropriate number of amino acids, or the percentage of amino acids of the extracellular domain present in the polypeptides of the invention should be such that the resulting polypeptides comprise the antigenic epitopes and present an improved trimerisation profile.
  • at least 50%, more suitably at least 70%, more suitably at least 80% and even 90% of the amino acids of the extracellular domain is retained in polypeptides of the disclosure, which percentage necessarily encompasses the fusion loops FL1 and FL2.
  • the CMV gB polypeptide retains the entire extracellular domain, which domain comprises at least one mutation in one of the two fusion loops FL1 and FL2, possibly both.
  • CMV gB polypeptides of the disclosure comprise at least 5%, more suitably at least 10%, and it can be 20%, or greater, of amino acids of the cytoplasmic domain. Accordingly, in some embodiments at least 80%, at least 90%, or at least 95% of amino acids of the cytoplasmic domain in the CMV gB polypeptides of the invention is deleted. In a further embodiment, the CMV gB polypeptides of the invention are deleted from the entire cytoplamsic domain.
  • Mutations of the transmembrane domain may be combined with mutations of the cytoplasmic domain, such as for example deletions of at least part of it. Any combination is contemplated in the present disclosure, so long as the resulting mutated CMV gB polypeptide is secreted from host cells upon expression in said cells, as described above and presents an improved trimerisation profile. Accordingly, in particular embodiments, the CMV gB polypeptides of the invention are deleted from both the entire transmembrane domain and the entire cytoplasmic domain.
  • the CMV gB polypeptides are deleted from the entire transmembrane domain and retain at least part of the cytoplasmic domain, such as, for example, 10% of it. In further aspects of the disclosure, the CMV gB polypeptides are deleted from the entire cytoplasmic domain and retains at least 30% of the transmembrane domain.
  • the inventors observed that combining mutations of the fusion loops FL1 and/or FL2 with the deletion of at least part of the cytoplasmic domain, possibly the deletion of all of it, and the deletion of at least part of the transmembrane domain, possibly the deletion of all it, provided polypeptides being more efficiently expressed and secreted than polypeptides of the prior art.
  • the inventors observed that the signal sequence of the CMV polypeptides of the prior art, after recombinant expression and secretion of the polypeptides, was cleaved off by a signal peptidase at different amino acid positions, generating thus a population of mature gB polypeptides having a varying end at the N-terminus, i.e. a population made of gB polypeptides having a different amino acid at the N-terminus.
  • a preparation comprising a population of mature CMV gB polypeptides produced after cleavage of the signal sequence, wherein at least 30%, at least 80%, from 80% to 90% of the mature gB polypeptides comprise the same amino acid at the N-terminal end.
  • the mature polypeptides of the invention suitably start with a serine or a histidine at the N-terminal position.
  • a CMV gB polypeptide comprising the deletion of the entire leader sequence.
  • the inventors also observed that the above deletion of the leader sequence could be combined with mutations occurring in the signal sequence, such as at least one amino acid substitution, suitably in the C-terminal part of the signal peptide.
  • said signal sequence may comprise at least one amino acid insertion, suitably in the C-terminal part of the signal peptide.
  • the extent of the deletion of the leader sequence, as well as the type of mutations in the signal sequence, may vary so long as the resulting gB polypeptide, after recombinant expression and secretion, is cleaved off by a signal peptidase at one major site, generating thus a population of mature gB polypeptides having a the same amino acid at the N-terminus.
  • the identity of the N-terminal amino acid within a population of polypeptides can determined through any known in the art sequencing techniques. Alternatively the different forms of polypeptides within a population of polypeptides may be subjected to a tryptic digestion, and the different peptides generated may be analysed by mass spectroscopy, such as MS/MS. The comparison with standard peptides of known sequences will allow to determine the amino acid composition of the digested peptides.
  • the above deletion of the leader sequence and/or the mutation of the signal sequence could be combined with any of the above-described mutations relating to the Fusion Loops FL1 and FL2 domains and/or to the deletion of at least a portion of the TM domain and/or to the deletion of at least a portion of the cytoplasmic domain, while still maintaining the properties conferred by each type of mutation, such as an improved trimerisation profile, a better expression and secretion, the absence of C-terminal clipping, and homogeneity at the N-terminus after cleavage of the signal sequence, as compared with the CMV gB polypeptides of the prior art, such as gB-DeltaTM.
  • the CMV gB polypeptides comprise mutations in the leader sequence optionally combined with mutations in the signal sequence, any previously described FL1 and/or FL2 domain mutations, and any mutations in the cytoplasmic domain and in the TM domain disclosed therein.
  • the CMV gB polypeptides of the invention are not "naturally occurring” in the sense that they are not present in the same state as it is in nature, i.e. their sequence have been modified artificially.
  • polypeptide or protein refers to a polymer in which the monomers are amino acids which are joined together through amide bonds.
  • polypeptide or protein as used herein are intended to encompass any amino acid sequence and include modified sequences such as glycoproteins.
  • polypeptide is specifically intended to cover both naturally occurring proteins and non-naturally occuring proteins which are recombinantly or synthetically produced.
  • fragment in reference to a polypeptide, refers to a portion (that is, a subsequence) of a polypeptide.
  • immunogenic fragment refers to all fragments of a polypeptide that retain at least one predominant immunogenic epitope of the full-length reference protein or polypeptide. Orientation within a polypeptide is generally recited in an N-terminal to C-terminal direction, defined by the orientation of the amino and carboxy moieties of individual amino acids. Polypeptides are translated from the N-terminal or amino-terminus towards the C-terminal or carboxy-terminus.
  • a gB polypeptide as described above carrying further mutations, such as for instance, mutations at endoproteolytic cleavage sites so that said sites are made ineffectual.
  • the furin cleavage site located around amino acids 456 to 460 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains may be mutated.
  • at least one of the amino acid substitutions is performed which is selected from the group consisting of: R 456 substituted with T 456 , R 458 substituted with Q 458 , and R 459 substituted with T 459 , relative to the sequence set forth in SEQ ID NO:1.
  • the CMV gB polypeptides comprise further point mutations wherein the arginine R 456 , R 458 and R 459 of the sequence set forth in SEQ ID NO:1, or at a corresponding position in other CMV gB polypeptides originating from different strains, are substituted with a threonine (T 456 ), a glutamic acid (Q 458 ) and a threonine (T 459 ), respectively.
  • the arginine at position 50 and 357 of the sequence as set forth in SEQ ID NO:1 was substituted with a serine.
  • the gB polypeptides in particular, the ones comprising a deletion of a hydrophobic region in the C-terminal cytoplasmic domain, comprise a further point mutation wherein the cysteine at position 778 of the sequence set forth in SEQ ID NO:1 is substituted with an alanine.
  • the gB polypeptide of the present disclosure may include a signal peptide at the N-terminus.
  • a signal peptide can be selected from among numerous signal peptides known in the art, and is typically chosen to facilitate production and processing in a system selected for recombinant expression of the gB polypeptide of the present disclosure.
  • the signal peptide is the one naturally present in the native gB protein from the AD169 strain, i.e. amino acids 1-20 of the sequence as set forth in SEQ ID NO:1.
  • the signal peptide may be a heterologous sequence in that the sequence arises from a protein distinct from gB.
  • Exemplary signal peptides suitable for use in the context of the CMV gB polypeptides of the disclosure include signal peptides of tissue plasminogen activator (tPA), Herpes Simplex Virus (HSV) gD protein, human endostatin, HIV gp120, CD33, human Her2Neu, or Epstein Barr Virus (EBV) gp350.
  • tPA tissue plasminogen activator
  • HSV Herpes Simplex Virus
  • EBV Epstein Barr Virus
  • a "signal peptide” is a short amino acid sequence (e.g., approximately 18-25 amino acids in length) that direct newly synthesized secretory or membrane proteins to and through membranes, e.g., of the endoplasmic reticulum.
  • Signal peptides are frequently but not universally located at the N-terminus of a polypeptide, and are frequently cleaved off by signal peptidases after the protein has crossed the membrane. This cleavage is commonly considered as a step in the process of protein "maturation". In particular, once the signal peptide is cleaved off, the protein is referred to as in its "mature" form.
  • Signal sequences typically contain three common structural features: an N-terminal polar basic region (n-region), a hydrophobic core, and a hydrophilic c-region).
  • the gB polypeptide comprises the signal peptide naturally present in the native gB.
  • the gB polypeptide comprises a heterologous signal peptide, such as the signal peptide of the protein CD33.
  • the signal sequences can be non native and may comprise mutations, such as substitutions, insertions, or deletions of amino acids.
  • said signal peptide comprises at least one amino acid substitution, suitably in the C-terminal part of the signal peptide.
  • said signal peptide may comprise at least one amino acid insertion, suitably in the C-terminal part of the signal peptide.
  • the CMV gB polypeptides of the disclosure can include the addition of an amino acid sequence that constitutes a tag, which facilitates subsequent processing or purification of a recombinantly expressed polypeptide.
  • a tag can be an antigenic or epitope tag, an enzymatic tag or a polyhistidine tag.
  • the tag is situated at one or the other end of the polypeptide, such as at the C-terminus or N-terminus of the polypeptide.
  • the CMV gB polypeptides comprise a polyhistidine tag located at the C-terminus of the polypeptides.
  • the CMV gB polypeptide of the invention has an amino acid sequence selected from SEQ ID NO:3, SEQ ID NO:4,SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:18.
  • the CMV gB polypeptide of the invention has an amino acid sequence selected from SEQ ID NO:19, SEQ ID NO:20,SEQ ID NO:21.
  • Another aspect of this disclosure concerns nucleic acids encoding the CMV gB polypeptides of the present invention.
  • Cells into which such nucleic acids or vectors are introduced i.e. host cells
  • the host cells can be bacterial cells, but more commonly will be eukaryotic cells, such a yeast cells (e.g. pichia), plant cells, insect cells, or mammalian cells (e.g. CHO cells).
  • the CMV gB polypeptides are recombinantly expressed in CHO cells.
  • polynucleotide and “nucleic acid sequence” refer to a polymeric form of nucleotides at least 10 bases in length. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single and double forms of DNA.
  • isolated polynucleotide is meant a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
  • a polynucleotide encodes a polypeptide.
  • the 5' and 3' direction of a nucleic acid is defined by reference to the connectivity of individual nucleotide units, and designated in accordance with the carbon positions of the deoxyribose(or ribose) sugar ring.
  • the informational (coding) content of a polynucleotide sequence is read in a 5' to 3' direction.
  • a “recombinant” nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
  • a “recombinant” protein is one that is encoded by a heterologous (e.g., recombinant) nucleic acid, which has been introduced into a host cell, such as a bacterial or eukaryotic cell.
  • the nucleic acid can be introduced, on an expression vector having signals capable of expressing the protein encoded by the introduced nucleic acid or the nucleic acid can be integrated into the host cell chromosome.
  • the recombinant nucleic acids are codon optimized for expression in a selected prokaryotic or eukaryotic host cell, such as a mammalian, plant or insect cell.
  • a selected prokaryotic or eukaryotic host cell such as a mammalian, plant or insect cell.
  • the nucleic acids can be incorporated into a vector, such as a prokaryotic or a eukaryotic expression vector.
  • nucleic acids disclosed herein can be included in any one of a variety of vectors (including, for example, bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, pseudorabies, adenovirus, adeno-associated virus, retroviruses and many others), most commonly the vector will be an expression vector suitable for generating polypeptide expression products.
  • vectors including, for example, bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, pseudorabies, adenovirus, adeno-associated virus, retroviruses and many others.
  • the nucleic acid encoding the CMV gB polypeptide is typically arranged in proximity and orientation to an appropriate transcription control sequence (promoter, and optionally, one or more enhancers) to direct mRNA synthesis. That is, the polynucleotide sequence of interest is operably linked to an appropriate transcription control sequence.
  • promoters include: the immediate early promoter of CMV, LTR or SV40 promoter, polyhedron promoter of baculovirus, E. coli lac or trp promoter, phage T7 and lambda P L promoter, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector typically also contains a ribosome binding site for translation initiation, and a transcription terminator.
  • the vector optionally includes appropriate sequences for amplifying expression.
  • the expression vectors optionally comprise one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance or kanamycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the expression vector can also include additional expression elements, for example, to improve the efficiency of translation.
  • These signals can include an ATG initiation codon and adjacent sequences.
  • a translation initiation codon and associated sequence elements are inserted into the appropriate expression vector simultaneously with the polynucleotide sequence of interest (e.g., a native start codon).
  • additional translational control signals are not required.
  • exogenous translational control signals including an ATG initiation codon is provided for expression of the CMV gB sequence. The initiation codon is placed in the correct reading frame to ensure translation of the polynucleotide sequence of interest.
  • Exogenous transcriptional elements and initiation codons can be of various origins, both natural and synthetic. If desired, the efficiency of expression can be further increased by the inclusion of enhancers appropriate to the cell system in use ( Scharf et al. (1994) Results Probl Cell Differ 20:125-62 ; Bitter et al. (1987) Methods in Enzymol 153:516-544 ).
  • nucleic acids that encode the CMV gB polypeptides of the invention are represented by SEQ ID NOs: 6, 7, 8, 9, 11, 13, 15 and 17. Additional sequence variants that share sequence identity with the exemplary variants can be produced by those of skill in the art. Typically, the nucleic acid variants will encode polypeptides that differ by no more than 1%, or 2%, or 5%, or 10%, or 15%, or 20% of the nucleotide or amino acids. That is, the encoded polypeptides share at least 80%, or 85%, more commonly, at least about 90% or more, such as 95%, or even 98% or 99% sequence identity. It will be immediately understood by those of skill in the art, that the polynucleotide sequences encoding the CMV gB polypeptides, can themselves share less sequence identity due to the redundancy of the genetic code.
  • sequence identity is frequently measured in terms of percentage identity (or similarity); the higher the percentage, the more similar are the primary structures of the two sequences. In general, the more similar the primary structures of two amino acid (or polynucleotide) sequences, the more similar are the higher order structures resulting from folding and assembly.
  • Variants of CMV gB polypeptides and polynucleotide sequences can have one or a small number of amino acid deletions, additions or substitutions but will nonetheless share a very high percentage of their amino acid, and generally their polynucleotide sequence. Methods of determining sequence identity are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981 ; Needleman and Wunsch, J. Mol. Biol.
  • NCBI National Center for Biotechnology Information
  • blastp blastn
  • blastx blastx
  • tblastn tblastx
  • Another indicia of sequence similarity between two nucleic acids is the ability to hybridize.
  • the stringency of hybridization conditions are sequence-dependent and are different under different environmental parameters.
  • hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences.
  • the temperature of hybridization and the ionic strength (especially the Na + and/or Mg ++ concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency.
  • stringent conditions are selected to be about 5°C to 20°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • stringent conditions encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence.
  • Stringent conditions can be broken down into particular levels of stringency for more precise definition.
  • “moderate stringency” conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of “medium stringency” are those under which molecules with more than 15% mismatch will not hybridize, and conditions of “high stringency” are those under which sequences with more than 10% mismatch will not hybridize.
  • Conditions of "very high stringency” are those under which sequences with more than 6% mismatch will not hybridize.
  • nucleic acids that hybridize under "low stringency” conditions include those with much less sequence identity, or with sequence identity over only short subsequences of the nucleic acid. It will, therefore, be understood that the various variants of nucleic acids that are encompassed by this disclosure are able to hybridize to at least one of SEQ ID NOs: 6, 7, 8, 9, 11, 13, 15 and 17, over substantially their entire length.
  • the CMV gB polypeptides disclosed herein are produced using well established procedures for the expression and purification of recombinant proteins. Procedures sufficient to guide one of skill in the art can be found in, for example, Sambrook and the Ausubel references cited above. Additional and specific details are provided hereinbelow.
  • Recombinant nucleic acids that encode the CMV gB polypeptides such as (but not limited to) the exemplary nucleic acids represented by SEQ ID NOs: 6, 7, 8, 9, 11, 13, 15 and 17, are introduced into host cells by any of a variety of well-known procedures, such as electroporation, liposome mediated transfection, Calcium phosphate precipitation, infection, transfection and the like, depending on the selection of vectors and host cells.
  • Host cells that include recombinant CMV gB polypeptide-encoding nucleic acids are, thus, also a feature of this disclosure.
  • Favorable host cells include prokaryotic (i.e., bacterial) host cells, such as E. coli, as well as numerous eukaryotic host cells, including fungal ( e.g ., yeast, such as Saccharomyces cerevisiae and Picchia pastoris) cells, insect cells, plant cells, and mammalian cells (such as CHO cells).
  • Recombinant CMV gB nucleic acids are introduced (e.g ., transduced, transformed or transfected) into host cells, for example, via a vector, such as an expression vector.
  • the vector is most typically a plasmid, but such vectors can also be, for example, a viral particle, a phage, etc.
  • appropriate expression hosts include: bacterial cells, such as E. coli, Streptomyces, and Salmonella typhimurium; fungal cells, such as Saccharomyces cerevisiae, Pichia pastoris, and Neurospora crassa; insect cells such as Drosophila and Spodoptera frugiperda; mammalian cells such as 3T3, COS, CHO, BHK, HEK 293 or Bowes melanoma; plant cells, including algae cells, etc.
  • the host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants, or amplifying the inserted polynucleotide sequences.
  • the culture conditions such as temperature, pH and the like, are typically those previously used with the host cell selected for expression, and will be apparent to those skilled in the art and in the references cited herein, including, e.g ., Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition, Wiley- Liss, New York and the references cited therein.
  • Expression products corresponding to the nucleic acids of the invention can also be produced in non-animal cells such as plants, yeast, fungi, bacteria and the like.
  • vectors which direct high level expression of proteins that are readily purified are favorably employed.
  • Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the coding sequence of interest, e.g ., a polynucleotide of the invention as described above, can be ligated into the vector in-frame with sequences for the amino-terminal translation initiating Methionine and the subsequent 7 residues of beta-galactosidase producing a catalytically active beta galactosidase fusion protein; pIN vectors ( Van Heeke & Schuster (1989) J Biol Chem 264:5503-5509 ); pET vectors (Novagen, Madison WI), in which the amino-terminal methionine is ligated in frame with a histidine tag; and the like.
  • yeast such as Saccharomyces cerevisiae
  • a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH can be used for production of the desired expression products.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH
  • PGH protein oxidase
  • a host cell is optionally chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion.
  • modifications of the protein include, but are not limited to, glycosylation, (as well as, e.g ., acetylation, carboxylation, phosphorylation, lipidation and acylation).
  • Post-translational processing for example, which cleaves a precursor form into a mature form of the protein (for example, by a furin protease) is optionally performed in the context of the host cell.
  • Different host cells such as 3T3, COS, CHO, HeLa, BHK, MDCK, 293, WI38, etc.
  • CMV gB polypeptide encoded by the nucleic acids disclosed herein stable expression systems are typically used.
  • cell lines which stably express a CMV gB polypeptide of the invention are obtained by introducing into the host cell expression vectors which contain viral origins of replication or endogenous expression elements and a selectable marker gene. Following the introduction of the vector, cells are allowed to grow for 1-2 days in an enriched media before they are switched to selective media.
  • the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences.
  • resistant groups or colonies of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type.
  • Host cells transformed with a nucleic acid encoding a CMV gB polypeptide are optionally cultured under conditions suitable for the expression and recovery of the encoded protein from cell culture.
  • the selected promoter is induced by appropriate means (e.g ., temperature shift or chemical induction) and cells are cultured for an additional period.
  • appropriate means e.g ., temperature shift or chemical induction
  • the secreted polypeptide product is then recovered from the culture medium and purified.
  • cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Eukaryotic or microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell CMV gB polypeptides can be recovered and purified from recombinant cell cultures by any of a number of methods well known in the art, including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography ( e.g ., using any of the tagging systems noted herein), hydroxyapatite chromatography, and lectin chromatography. Protein refolding steps can be used, as desired, in completing configuration of the mature protein.
  • HPLC high performance liquid chromatography
  • purification methods are well known in the art, including, e.g ., those set forth in Sandana (1997) Bioseparation of Proteins, Academic Press, Inc. ; and Bollag et al. (1996) Protein Methods, 2nd Edition Wiley-Liss, NY ; Walker (1996) The Protein Protocols Handbook Humana Press, NJ , Harris and Angal (1990) Protein Purification Applications: A Practical Approach IRL Press at Oxford, Oxford, U.K .; Scopes (1993) Protein Purification: Principles and Practice 3rd Edition Springer Verlag, NY ; Janson and Ryden (1998) Protein Purification: Principles. High Resolution Methods and Applications, Second Edition Wiley-VCH, NY ; and Walker (1998) Protein Protocols on CD-ROM Humana Press, NJ .
  • the polynucleotides that encode the CMV gB polypeptides are cloned into a vector suitable for introduction into mammalian cells (e.g ., CHO cells).
  • a vector suitable for introduction into mammalian cells e.g ., CHO cells.
  • the polynucleotide sequence that encodes the CMV gB polypeptide is introduced into the pMax vector developed by Amaxa.
  • the polypeptide is expressed under a constitutive promoter, the immediate early CMV promoter. Selection of the stably transfected cells expressing the chimer is made based on the ability of the transfected cells to grow in the presence of kanamycin.
  • Cells that have successfully integrated the pMax are able to grow in the presence of kanamycin, because the pMax vector expresses a kanamycin resistance gene.
  • Selected cells can be clonally expanded and characterized for expression of the CMV gB polypeptides.
  • the polynucleotide sequences that encode the CMV gB polypeptides of the invention may be introduced into the pTT5 vector developed by NRC, which expresses an ampicillin resistance gene.
  • the expressed polypeptides are recovered (e.g ., purified or enriched).
  • the CMV gB polypeptides include a C-terminal polyhistidine tag.
  • the cell culture supernatant was collected 6 days post-transfection. After clarification, the supernatants were loaded on nickel columns.
  • purification refers to the process of removing components from a composition, the presence of which is not desired. Purification is a relative term, and does not require that all traces of the undesirable component be removed from the composition. In the context of vaccine production, purification includes such processes as centrifugation, dialyzation, ion-exchange chromatography, and size-exclusion chromatography, affinity-purification or precipitation. Thus, the term “purified” does not require absolute purity; rather, it is intended as a relative term.
  • a preparation of substantially pure nucleic acid or protein can be purified such that the desired nucleic acid, or protein, represents at least 50% of the total nucleic acid content of the preparation.
  • a substantially pure nucleic acid, or protein will represent at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, or at least 95% or more of the total nucleic acid or protein content of the preparation.
  • an "isolated" biological component such as a nucleic acid molecule, or protein
  • nucleic acid molecule, or protein has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, such as, other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles.
  • Nucleic acids and proteins that have been "isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins.
  • the CMV gB polypeptides and nucleic acids of the disclosure are useful in the preparation of medicaments for treating a CMV infection.
  • the CMV gB polypeptides of the invention are particularly suitable as antigens for inclusion in an immunogenic composition, such as vaccines.
  • the present disclosure also describes methods for eliciting an immune response against CMV by administering to a subject an immunologically effective amount of a composition containing any of the CMV gB polypeptides of the disclosure.
  • Subjects may be either HCMV-seropositive or HCMV-seronegative subjects.
  • the subjects are adolescent girls, typically from 12 to 16 years old. Alternatively, the subjects are child bearing-age women.
  • the group of child bearing-age women represent women who are between 16 and 45 years of age that can become pregnant.
  • a method for eliciting an immune response against CMV comprising the steps of administering to HCMV-seronegative child bearing-age women an immunologically effective amount of a composition comprising a gB polypeptide of the disclosure.
  • the CMV gB polypeptides are used in the preparation of a medicament for preventing and/or treating CMV infection.
  • the composition, or medicament elicits a protective immune response that reduces or prevents infection with CMV and/or reduces or prevents a pathological response following infection with CMV.
  • the method of the disclosure wherein child bearing-age women are administered an immunologically effective amount of a composition containing any of the CMV gB polypeptides of the invention, prevents the CMV transmission from mother to foetus, i.e. prevents CMV congenital infection.
  • prevention of HCMV congenital infection in a newborn means that the newborn is free of HCMV infection at birth.
  • suitable subjects to receive the immunogenic composition of the disclosure are immunocompromised subjects, such as for example, transplanted patients. Accordingly, in some aspects of the disclosure, it is described the use of CMV gB polypeptides of the invention for reducing and/or preventing CMV infection in immunocompromised subjects. In further aspects of the disclosure, it is described methods for eliciting an immune response against CMV comprising the steps of administering CMV gB polypeptides of the invention to immunocompromised subjects.
  • a "subject” is a living multi-cellular vertebrate organism.
  • the subject can be an experimental subject, such as a non-human animal, e.g. , a mouse, a cotton rat, or a non-human primate.
  • the subject can be a human subject, as indicated above.
  • an “antigen” is a compound, composition, or substance that can stimulate an immune response by producing antibodies and/or a T cell response in an animal, including compositions that are injected, absorbed or otherwise introduced into an animal.
  • the term “antigen” includes all related antigenic epitopes.
  • the term “epitope” or “antigenic determinant” refers to a site on an antigen to which B and/or T cells respond.
  • the "predominant antigenic epitopes” are those epitopes to which a functionally significant host immune response, e.g ., an antibody response or a T-cell response, is made.
  • the predominant antigenic epitopes are those antigenic moieties that when recognized by the host immune system result in protection from disease caused by the pathogen.
  • T-cell epitope refers to an epitope that when bound to an appropriate MHC molecule is specifically bound by a T cell (via a T cell receptor).
  • B-cell epitope is an epitope that is specifically bound by an antibody (or B cell receptor molecule).
  • an “immune response” is a response of a cell of the immune system, such as a B cell, T cell, or monocyte, to a stimulus.
  • An immune response can be a B cell response, which results in the production of specific antibodies, such as antigen specific neutralizing antibodies.
  • An immune response can also be a T cell response, such as a CD4+ response or a CD8+ response.
  • the response is specific for a particular antigen (that is, an "antigen-specific response"), in particular, CMV.
  • the antigen-specific response is a "pathogen-specific response.”
  • a "protective immune response” is an immune response that inhibits a detrimental function or activity of a pathogen, reduces infection by a pathogen, or decreases symptoms (including death) that result from infection by the pathogen.
  • a protective immune response can be measured, for example, by the inhibition of viral replication or plaque formation in a plaque reduction assay or ELISA-neutralization assay, or by measuring resistance to pathogen challenge in vivo.
  • the immune response elicits an immune response characterized by the production of Th1 type cytokines, e.g. a Th1-type immune response.
  • Th1 type cytokines e.g. a Th1-type immune response.
  • a "Th1" type immune response is characterized CD4+ T helper cells that produce IL-2 and IFN-y.
  • Th2 type immune response is characterized by CD4+ helper cells that produce IL-4, IL-5, and IL-13.
  • an "immunologically effective amount” is a quantity of a composition (typically, an immunogenic composition) used to elicit an immune response in a subject.
  • a composition typically, an immunogenic composition
  • the desired result is the production of an antigen (e.g ., pathogen)-specific immune response that is capable of or contributes to protecting the subject against the pathogen, such as CMV.
  • an antigen e.g ., pathogen
  • the term immunologically effective amount encompasses a fractional dose that contributes in combination with previous or subsequent administrations to attaining a protective immune response.
  • immunogenic compositions such as vaccines, including a CMV gB polypeptide and a pharmaceutically acceptable diluent, carrier or excipient.
  • An "immunogenic composition” is a composition of matter suitable for administration to a human or animal subject that is capable of eliciting a specific immune response, e.g., against a pathogen, such as CMV.
  • an immunogenic composition includes one or more antigens (for example, polypeptide antigens) or antigenic epitopes, such as for instance, the CMV gB polypeptides of the inventions.
  • An immunogenic composition can also include one or more additional components capable of eliciting or enhancing an immune response, such as an excipient, carrier, and/or adjuvant.
  • immunogenic compositions are administered to elicit an immune response that protects the subject against symptoms or conditions induced by a pathogen.
  • symptoms or disease caused by a pathogen is prevented (or reduced or ameliorated) by inhibiting replication of the pathogen (e.g ., CMV) following exposure of the subject to the pathogen.
  • the term immunogenic composition will be understood to encompass compositions that are intended for administration to a subject or population of subjects for the purpose of eliciting a protective or palliative immune response against CMV (that is, vaccine compositions or vaccines).
  • the immunogenic compositions according to the disclosure are not limited to compositions comprising CMV gB polypeptides.
  • the present disclosure also describes immunogenic compositions, such as vaccines, comprising the CMV gB polypeptides of the invention and at least one or more CMV antigens selected from the group consisting of pp65, IE1, pUL131, gL, gH, pUL128, pUL130, or any combination thereof.
  • immunogenic compositions, such as vaccines comprising the CMV gB polypeptides of the invention and at least one or more antigens selected from the group consisting of HPV, Chlamydia, RSV, Toxoplasma gondii. Zoster, and Aspergillus.
  • diluents and carriers and/or pharmaceutically acceptable excipients are known in the art and are described, e.g., in Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975 ).
  • pharmaceutically acceptable indicates that the diluent, or carrier, or excipient, is suitable for administration to a subject (e.g ., a human or animal subject).
  • a subject e.g ., a human or animal subject.
  • the nature of the diluent, carrier and/or excipient will depend on the particular mode of administration being employed.
  • parenteral formulations usually include injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like.
  • a liquid diluent is not employed.
  • non-toxic solid carriers can be used, including for example, pharmaceutical grades of trehalose, mannitol, lactose, starch or magnesium stearate..
  • excipients and carriers can be selected by those of skill in the art to produce a formulation suitable for delivery to a subject by a selected route of administration.
  • Excipients include, without limitation: glycerol, polyethylene glycol (PEG), glass forming polyols (such as, sorbitol, trehalose) N-lauroylsarcosine ( e.g ., sodium salt), L -proline, non detergent sulfobetaine, guanidine hydrochloride, urea, trimethylamine oxide, KCI, Ca 2+ , Mg 2+ , Mn 2+ , Zn 2+ (and other divalent cation related salts), dithiothreitol (DTT), dithioerytrol, ß-mercaptoethanol, Detergents (including, e.g ., Tween80, Tween20, Triton X-100, NP-40, Empigen BB, Octylglucoside, Lauroyl
  • the immunogenic composition also includes an adjuvant.
  • Suitable adjuvants for use in immunogenic compositions containing CMV gB polypeptides of the invention are adjuvants that in combination with said polypeptides disclosed herein are safe and minimally reactogenic when administered to a subject.
  • an “adjuvant” is an agent that enhances the production of an immune response in a non-specific manner.
  • Common adjuvants include suspensions of minerals (alum, aluminum hydroxide, aluminum phosphate) onto which antigen is adsorbed; emulsions, including water-in-oil, and oil-in-water (and variants thereof, including double emulsions and reversible emulsions), liposaccharides, lipopolysaccharides, immunostimulatory nucleic acids (such as CpG oligonucleotides), liposomes, Toll Receptor agonists (particularly, TLR2, TLR4, TLR7/8 and TLR9 agonists), and various combinations of such components.
  • Suitable adjuvants for use in combination with the CMV gB polypeptides of the invention are saponins.
  • immunogenic compositions of the invention may comprise the saponin QS21 ( WO8809336A1 ; US5057540A ).
  • QS21 is well known in the art as a natural saponin derived from the bark of Quillaja saponaria Molina, which induces CD8+ cytotoxic T cells (CTLs), Th1 cells and a predominant IgG2a antibody response.
  • CTLs cytotoxic T cells
  • Th1 cells a predominant IgG2a antibody response.
  • IgG2a antibody response for the avoidance of doubt reference to QS21 includes OPT-821.
  • the immunogenic compositions of the may comprise QS21 in substantially pure form, that is to say, the QS21 is at least 80%, at least 85%, at least 90% pure, for example at least 95% pure, or at least 98% pure.
  • Compositions of the disclosure may comprise QS21 in an amount of between about 1 ⁇ g to about 100 ⁇ g, for example between about 1 ⁇ g and about 60 ⁇ g or between 10 ⁇ g and about 50 ⁇ g, for example, about 10 ⁇ g, about 12.5 ⁇ g, about 15 ⁇ g, about 20 ⁇ g, about 25 ⁇ g, about 30 ⁇ g, about 40 ⁇ g or in particular about 50 ⁇ g.
  • QS21 is present in an amount between about 40 ⁇ g and 60 ⁇ g or between 45 and 55 ⁇ g or between 47 and 53 ⁇ g or between 48 and 52 ⁇ g or between 49 and 51 or about 50 ⁇ g.
  • QS21 is present in an amount between 21 ⁇ g and 29 ⁇ g or between about 22 ⁇ g and about 28 ⁇ g or between about 23 ⁇ g and about 27 ⁇ g or between about 24 ⁇ g and about 26 ⁇ g, or about 25 ⁇ g.
  • immunogenic compositions comprising the CMV gB polypeptides comprise QS21 in an amount of about 10 ⁇ g, for example between about 5 ⁇ g and 15 ⁇ g, about 6 ⁇ g and about 14 ⁇ g, about 7 ⁇ g and about 13 ⁇ g, about 8 ⁇ g and about 12 ⁇ g or about 9 ⁇ g and about 11 ⁇ g, or about 10 ⁇ g.
  • immunogenic compositions comprise QS21 in an amount of around about 5 ⁇ g, for example between about 1 ⁇ g and 9 ⁇ g, about 2 ⁇ g and about 8 ⁇ g, about 3 ⁇ g and about 7 ⁇ g, about 4 ⁇ g and about 6 ⁇ g, or about 5 ⁇ g.
  • a suitable amount of QS21 in the human dose of compositions of the disclosure is for example any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 ⁇ g.
  • the immunogenic compositions comprising the CMV gB polypeptides of the invention may comprise QS21 and a sterol, cholesterol in particular. Such compositions show a decreased reactogenicity when compared to compositions in which the sterol is absent, while the adjuvant effect is maintained. Reactogenicity studies may be assessed according to the methods disclosed in WO 96/33739 .
  • the sterol according to the disclosure is taken to mean an exogenous sterol, i.e. a sterol which is not endogenous to the organism from which the ⁇ -Amyloid antigen preparation may be taken.
  • the exogenous sterol is associated to the saponin adjuvant as described in WO 96/33739 .
  • the cholesterol is present in excess to that of QS21, for example, the ratio of QS21:sterol will typically be in the order of 1:100 to 1:1 (w/w), suitably between 1:10 to 1:1 (w/w), and preferably 1:5 to 1:1 (w/w). In particular, the ratio of QS21:sterol being at least 1:2 (w/w). In a particular aspect of the disclosure, the ratio of QS21:sterol is 1:5 (w/w). Suitable sterols include ⁇ -sitosterol, stigmasterol, ergosterol, ergocalciferol and cholesterol. In one aspect of the disclosure, the compositions of the invention comprise cholesterol as sterol.
  • immunogenic compositions comprising the CMV gB polypeptides comprise QS21 in its less reactogenic composition where it is quenched with an exogenous sterol, such as cholesterol for example.
  • an exogenous sterol such as cholesterol for example.
  • the saponin /sterol is in the form of a liposome structure ( WO 96/337391 ).
  • CMV gB polypeptides of the invention can suitably be employed in immunogenic compositions with an adjuvant comprising a combination of QS21 and cholesterol.
  • liposome(s) generally refers to uni- or multilamellar (particularly 2, 3, 4, 5, 6, 7, 8, 9, or 10 lamellar depending on the number of lipid membranes formed) lipid structures enclosing an aqueous interior. Liposomes and liposome formulations are well known in the art. Lipids, which are capable of forming liposomes include all substances having fatty or fat-like properties.
  • Lipids which can make up the lipids in the liposomes can be selected from the group comprising of glycerides, glycerophospholipides, glycerophosphinolipids, glycerophosphonolipids, sulfolipids, sphingolipids, phospholipids, isoprenolides, steroids, stearines, sterols, archeolipids, synthetic cationic lipids and carbohydrate containing lipids.
  • Liposomes may suitably comprise a phospholipid.
  • Suitable phospholipids include (but are not limited to): phosphocholine (PC) which is an intermediate in the synthesis of phosphatidylcholine; natural phospholipid derivates: egg phosphocholine, egg phosphocholine, soy phosphocholine, hydrogenated soy phosphocholine, sphingomyelin as natural phospholipids; and synthetic phospholipid derivates: phosphocholine (didecanoyl-L- ⁇ -phosphatidylcholine [DDPC], dilauroylphosphatidylcholine [DLPC], dimyristoylphosphatidylcholine [DMPC], dipalmitoyl phosphatidylcholine [DPPC], Distearoyl phosphatidylcholine [DSPC], Dioleoyl phosphatidylcholine [DOPC], 1-palmitoyl, 2-oleoylphosphatidylcholine [POPC], Dielaidoyl phosphatidylcholine [DEPC
  • the liposomes comprise 1-palmitoyl-2-oleoyl-glycero-3-phosphoethanolamine.
  • highly purified phosphatidylcholine is used and can be selected fom the group comprising Phosphatidylcholine (EGG), Phosphatidylcholine Hydrogenated (EGG) Phosphatidylcholine (SOY) Phosphatidylcholine Hydrogenated (SOY).
  • the liposomes comprise phosphatidylethanolamine [POPE] or a derivative thereof. Liposome size may vary from 30 nm to several ⁇ m depending on the phospholipid composition and the method used for their preparation.
  • the liposome size will be in the range of 50 nm to 500 nm and in further aspects 50 nm to 200 nm.
  • Dynamic laser light scattering is a method used to measure the size of liposomes well known to those skilled in the art.
  • Liposomes of the disclosure may comprise dioleoyl phosphatidylcholine [DOPC] and a sterol, in particular cholesterol.
  • immunogenic compositions comprising the CMV gB polypeptides of the invention, such as gB polypeptides having a non-functional transmembrane domain and at least one of the Fusion Loops FL1 and FL2 mutated, possibly both, comprise QS21 in any amount described herein in the form of a liposome, wherein said liposome comprises dioleoyl phosphatidylcholine [DOPC] and a sterol, in particular cholesterol.
  • DOPC dioleoyl phosphatidylcholine
  • Immunogenic compositions of the invention may comprise one or more further immunostimulants.
  • immunogenic compositions comprising the CMV gB polypeptides of the invention as described herein further comprise a lipopolysaccharide, suitably a non-toxic derivative of lipid A, particularly monophosphoryl lipid A or more particularly 3-Deacylated monophoshoryl lipid A (3D - MPL).
  • 3D-MPL is sold under the name MPL by GlaxoSmithKline Biologicals N.A., and is referred throughout the specification as MPL or 3D-MPL. See, for example, US Patent Nos. 4,436,727 ; 4,877,611 ; 4,866,034 and 4,912,094 .
  • 3D-MPL primarily promotes CD4+ T cell responses with an IFN- ⁇ (Th1) phenotype.
  • 3D-MPL can be produced according to the methods disclosed in GB2220211 A . Chemically it is a mixture of 3-deacylated monophosphoryl lipid A with 3, 4, 5 or 6 acylated chains. In the compositions of the present disclosure small particle 3D-MPL can be used. Small particle 3D-MPL has a particle size such that it can be sterile-filtered through a 0.22 ⁇ m filter. Such preparations are described in WO94/21292 .
  • compositions of the disclosure may comprise 3D-MPL in an amount of between about 1 ⁇ g to about 100 ⁇ g, for example between about 1 ⁇ g and about 60 ⁇ g or between 10 ⁇ g and about 50 ⁇ g, for example, about 10 ⁇ g, about 12.5 ⁇ g, about 15 ⁇ g, about 20 ⁇ g, about 25 ⁇ g, about 30 ⁇ g, about 40 ⁇ g or in particular about 50 ⁇ g.
  • 3D-MPL is present in an amount between about 40 ⁇ g and 60 ⁇ g or between 45 and 55 ⁇ g or between 47 and 53 ⁇ g or between 48 and 52 ⁇ g or between 49 and 51 or about 50 ⁇ g.
  • 3D-MPL is present in an amount between 21 ⁇ g and 29 ⁇ g or between about 22 ⁇ g and about 28 ⁇ g or between about 23 ⁇ g and about 27 ⁇ g or between about 24 ⁇ g and about 26 ⁇ g, or about 25 ⁇ g.
  • the human dose of the immunogenic composition comprises 3D-MPL at a level of about 10 ⁇ g, for example between 5 and 15 ⁇ g, suitably between 6 and 14 ⁇ g, for example between 7 and 13 ⁇ g or between 8 and 12 ⁇ g or between 9 and 11 ⁇ g, or 10 ⁇ g.
  • the human dose of the immunogenic composition comprises 3D-MPL at a level of about 5 ⁇ g, for example between 1 and 9 ⁇ g, or between 2 and 8 ⁇ g or suitably between 3 and 7 ⁇ g or 4 and 6 ⁇ g, or 5 ⁇ g.
  • a suitable amount of 3D-MPL in the compositions of the disclosure is for example any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 ⁇ g.
  • the lipopolysaccharide can be a ⁇ 1-6) glucosamine disaccharide, as described in US Patent No. 6,005,099 and EP Patent No. 0 729 473 B1 .
  • acylated monosaccharide and disaccharide derivatives that are a sub-portion to the above structure of MPL are also suitable adjuvants.
  • the adjuvant is a synthetic derivative of lipid A, some of which are described as TLR-4 agonists, and include, but are not limited to:
  • compositions with CMV gB polypeptides can also be used in compositions with CMV gB polypeptides.
  • QS21 can be formulated together with 3D-MPL.
  • the ratio of QS21 : 3D-MPL will typically be in the order of 1 : 10 to 10 : 1; such as 1:5 to 5 : 1, and often substantially 1 : 1.
  • the ratio is in the range of 2.5 : 1 to 1 : 1 3D-MPL: QS21.
  • immunogenic compositions comprising CMV gB polypeptides of the invention may comprise at least QS21 and 3D-MPL.
  • the immunogenic compositions comprising the CMV gB polypeptides of the invention may also be suitably formulated with an oil-in-water emulsion.
  • the oil in water emulsion comprises a metabolisable oil (i.e. biodegradable).
  • the oil may be any vegetable oil, fish oil, animal oil or synthetic oil, which is not toxic to the recipient and is capable of being transformed by metabolism. Nuts, seeds, and grains are common sources of vegetable oils. Synthetic oils are also suitable. Accordingly, oil-in-water emulsions used in combination with the CMV gB polypeptides of the invention may comprise a metabolisable oil.
  • oil- in-water emulsions comprise squalene (for example between about 4% and 6% [v/v]).
  • the oil-in-water emulsion may further comprise a surfactant.
  • Oil-in-water emulsions of the disclosure comprise one or more surfactants. Suitable surfactants are well known to the skilled person and include, but are not limited to polyoxyethylene sorbitan monooleate (Tween 80, Polysorbate 80), sorbitan triolate (Span 85), phosphatidylcholine (lecithin), polyoxyethylene (12) cetostearyl ether and octoxynol-9 (Triton X-100).
  • oil-in-water emulsions comprise polyoxyethylene sorbitan monooleate (Tween 80, Polysorbate 80).
  • oil in water emulsions of the disclosure comprise polyoxyethylene sorbitan monooleate (Tween 80) and a further surfactant, in particular sorbitan trioleate (Span 85).
  • Oil-in-water emulsions of the disclosure may also comprise a tocol. Tocols are well known in the art and are described in EP0382271 .
  • the tocol is ⁇ -tocopherol or a derivative thereof such as alpha-tocopherol succinate (also known as vitamin E succinate).
  • immunogenic compositions comprising CMV gB polypeptides of the invention in combination with an oil-in-water emulsion comprising squalene (for example about 5% [v/v]) and ⁇ -tocopherol (for example about 5% [v/v]).
  • the oil-in-water emulsion comprises a metabolisable oil (e.g . squalene), a tocol (e.g . ⁇ -tocopherol) and a surfactant (e.g . polyoxyethylene sorbitan monooleate [Polysorbate 80]).
  • oil-in-water emulsions of the disclosure comprise a metabolisable oil (e.g . squalene), a surfactant (e.g . polyoxyethylene sorbitan monooleate [Polysorbate 80]), and optionally a second surfactant (e.g . sorbitan trioleate [Span 85]).
  • oil-in-water emulsions of the disclosure comprise a metabolisable oil (e.g . squalene), a polyoxyethylene alkyl ether hydrophilic non-ionic surfactant (e.g .
  • immunogenic compositions comprising the CMV gB polypeptides of the invention, such as gB polypeptides having a non-functional transmembrane domain and at least one of the Fusion Loops FL1 and FL2 mutated, possibly both, comprise an oil-in-water emulsion comprising squalene, alpha-tocopherol, and Polysorbate 80.
  • the oil-in-water comprises 11 mg metabolisable oil (such as squalene) or below, for example between 0.5-11 mg, 0.5-10 mg or 0.5-9 mg 1-10 mg, 1-11 mg, 2-10 mg, 4-8 mg, or 4.5-5.5 mg, and 5 mg emulsifying agent (such as polyoxyethylene sorbitan monooleate) or below, for example between 0.1-5 mg, 0.2-5 mg, 0.3-5 mg, 0.4-5 mg, 0.5-4 mg, 1-2 mg or 2-3 mg per dose of the vaccine.
  • tocol e.g. alpha-tocopherol
  • tocol e.g. alpha-tocopherol
  • vaccine human dose is meant a dose which is in a volume suitable for human use. Generally this is between 0.25 and 1.5 ml.
  • a human dose is 0.5 ml.
  • a human dose is higher than 0.5 ml, for example 0.6, 0.7, 0.8, 0.9 or 1 ml.
  • a human dose is between 1 ml and 1.5 ml.
  • a human dose may be less than 0.5 ml such as between 0.25 and 0.5 ml.
  • An immunogenic composition typically contains an immunoprotective quantity (or a fractional dose thereof) of the antigen and can be prepared by conventional techniques.
  • Preparation of immunogenic compositions, such as vaccines, including those for administration to human subjects, is generally described in Pharmaceutical Biotechnology, Vol.61 Vaccine Design-the subunit and adjuvant approach, edited by Powell and Newman, Plenurn Press, 1995 . New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, U.S.A. 1978 .
  • Encapsulation within liposomes is described, for example, by Fullerton, U.S. Patent 4,235,877 .
  • Conjugation of proteins to macromolecules is disclosed, for example, by Likhite, U.S.
  • the amount of protein in each dose of the immunogenic composition is selected as an amount which induces an immunoprotective response without significant, adverse side effects in the typical subject.
  • Immunoprotective in this context does not necessarily mean completely protective against infection; it means protection against symptoms or disease, especially severe disease associated with the virus.
  • the amount of antigen can vary depending upon which specific immunogen is employed.
  • each human dose will comprise 1-1000 ⁇ g of protein, such as from about 1 ⁇ g to about 100 ⁇ g, for example, from about 1 ⁇ g to about 50 ⁇ g, such as about 1 ⁇ g, about 2 ⁇ g, about 5 ⁇ g, about 10 ⁇ g, about 15 ⁇ g, about 20 ⁇ g, about 25 ⁇ g, about 30 ⁇ g, about 40 ⁇ g, or about 50 ⁇ g.
  • the amount utilized in an immunogenic composition is selected based on the subject population (e.g., infant or elderly). An optimal amount for a particular composition can be ascertained by standard studies involving observation of antibody titres and other responses in subjects. Following an initial vaccination, subjects can receive a boost in about 4 weeks.
  • All the gB polypeptide variants originate from the amino acid sequence of gB from the CMV strain AD169. Accordingly, the numbering of amino acids when specifying the position of mutations is relative to the sequence of AD169 CMV gB set forth in SEQ ID NO:1. Also, in addition to the specific mutations they each contain, as described below, the following constructs are (i) all deleted from the transmembrane domain (deletion of amino acids 701 to 775) and (ii) all comprise the following point mutations: amino acids R 50 and R 357 substituted with amino acid S.
  • the gB-SLP12 variant comprises 2 series of point mutations targeting the putative fusion loops of gB, FL1 and FL2, respectively.
  • FL1 was mutated by substituting the amino acids 155 Y.I.Y 157 with the amino acids 155 G.H.R 157
  • FL2 was mutated by substituting the amino acids 240 W.L.Y 242 with amino acids 240 A.F.H 242 .
  • This construct codes for a 830 amino acids long protein.
  • the complete amino acid sequence of gB-SLP12 is given in SEQ ID NO:3.
  • the gB-SLP12 gene sequence (SEQ ID NO:6) was synthesized by GeneArt company. The coding sequence was codon-optimized for expression in CHO cell. HindIII and BamHI restriction sites were introduced at the 5' end (in front of the start codon) and the 3' end (just after the stop codon), respectively.
  • the codon-optimized gene sequence carries mutations in both the first putative fusion loop ( 155 Y.I.Y 157 replaced with 155 G.H.R 157 ) and the second putative fusion loop ( 240 W.L.Y 242 replaced with 240 A.F.H 242 ).
  • the synthetic DNA fragment was received as a 2558 bp long DNA insert cloned into pMA vector (GeneArt proprietary plasmid) using KpnI and SacI cloning sites, generating AD169-gB-SLP12-pMA plasmid.
  • AD169-gB-SLP12-pMA plasmid was restricted with HindIII and BamHI.
  • the 2530 bp DNA fragment containing gB-SLP12 gene was gel purified and ligated to the mammalian expression vector pMax, a modified version of the pMaxCloning vector of Amaxa.
  • the pMaxCloning vector backbone has been modified in order to eliminate an ATG start codon present in multiple cloning site of the Amaxa commercial vector (between KpnI and HindIII ). After sequence verification by automated DNA sequencing, pMax-AD169-gB-SLP12 recombinant plasmid was used to transiently transfect CHO-S cells.
  • the deletion of one hydrophobic region encompassing amino acids Pro 825 to Lys 877 was introduced into the gB-SLP12 variant, generating the gB-SLP12-Del2 variant.
  • This construct codes for a 777 amino acids long protein.
  • the complete amino acid sequence of the gB-SLP12-Del2 variant is given in SEQ ID NO:4.
  • the nucleotide sequence encoding for gB-SLP12-Del2 is given in SEQ ID NO:8.
  • a 2159 bp DNA fragment encompassing HindIII and ClaI unique restriction sites present in the AD169-gB-SLP12 coding sequence was amplified by PCR, using AD169-gB-SLP12-pMA plasmid as template and the primers SLP-Fw (SEQ ID NO:22) (5'-GAAAGCGGGCAGTGAGCGGAAGGC-3') and SLP-Rv (SEQ ID NO:23) (5'-TGTCCTCCACGTACTTCACGCGCTGC-3').
  • the C-terminal part of AD169-gB-SLP12Del2 gene was also PCR amplified as a 745 bp fragment encompassing ClaI and SacI restriction sites, using Del2-pMA vector as template and the primers Del-Fw (SEQ ID NO:24) (5'-CCCGAACGACCGAGCGCAGCGAGTCA-3') and Del-Rv (SEQ ID NO:25) (5'-CCAGCTGGCGAAAGGGGGATGTGC-3').
  • Del2-pMA vector which carries a synthetic DNA fragment coding for the C-term part of gB-SLP12-Del2 gene was constructed by GeneArt company.
  • the gB-SLP1 gene was first synthesized by GeneArt.
  • the codon-optimized gene sequence carries mutations in the first putative fusion loop ( 155 Y.I.Y 157 replaced with 155 G.H.R 157 ).
  • This synthetic gene was received as a 2558 bp DNA fragment, cloned into pMA vector using KpnI and SacI cloning sites, generating AD169-gB-SLP1-pMA plasmid.
  • the expression vector pMax-AD169-gB-SLP1-Del2 was constructed from AD169-gB-SLP1-pMA and vector plasmid Del2-pMA.
  • pMA-gB-SLP1 vector was restricted with HindIII and ClaI, and the 1964 bp DNA fragment coding for the N-terminal part of SLP1-Del-2 protein was isolated by gel purification.
  • the vector plasmid Del2-pMA was digested with ClaI and SacI, and the 420 bp DNA fragment coding for the C-terminal part of gB-SLP1-Del2 protein was isolated by gel purification. These two fragments were ligated together into pMax expression vector restricted with HindIII and SacI, generating the final expression vector pMax-AD169-gB-SLP1-Del2.
  • pMax-AD169-gB-SLP1-Del2 recombinant plasmid was used to transiently transfect CHO-S cells.
  • the nucleotide sequence encoding for gB-SLP1-Del2 is shown in SEQ ID NO:7.
  • gB-SLP12-Delta113 variant The deletion of the C-terminal part of the cytoplasmic domain, starting at the amino acid 793 was performed in the gB-SLP12-Delta113 variant, as well as the deletion of the amino acids 701-775 of the transmembrane domain. This variant codes for a 717 amino acid long protein.
  • the complete amino acid sequence of gB-SLP12-Delta113 variant is given in SEQ ID NO:12.
  • the strategy used to construct pTT5-gB-SLP12-Delta113 expression vector is as follows. First, pMax-AD169-gB-SLP12 vector (see section 1.1.1) was restricted with HindIII and ClaI. The resulting 1970-bp gB fragment, corresponding to the N-terminal part of gB-SLP12-Delta113 construct, was isolated by gel purification. The C-terminal end of gB-SLP12-Delta113 construct encompassing ClaI and BamHI sites (just after the stop codon), was synthesized by Geneart and received as a 230-bp long DNA insert (named new-2) cloned into pMA vector (Geneart proprietary plasmid).
  • New-2-pMA vector was restricted with ClaI and BamHI and the 230-bp insert was gel purified.
  • the two gel purified DNA fragments were ligated together into pMax expression vector previously restricted with HindIII and BamHI ,generating pMax-AD169-gB-SLP12-Delta113 plasmid.
  • serines at position 50 and 357 of AD169-gB-SLP12-Delta113 construct were both reverted to the native arginine, using "QuickChange Multi Site-Directed Mutagenesis" kit from Stratagene (No. 200513).
  • the resulting plasmid after sequence verification, was digested with restriction enzymes HindIII and BamHI .
  • the 2200-bp gB fragment was gel purified and ligated into pTT5 vector (NRC, Canada) previously restricted with HindIII and BamHI , generating the final pTT5-gB-SLP12-Delta113 expression vector.
  • This vector was used to transiently transfect CHO-S cells.
  • the nucleotide sequence encoding for gB-SLP12-Delta113 is shown in SEQ ID NO:11.
  • a PCR fragment encompassing the ClaI and BamHI restriction sites (SEQ ID NO:26) and comprising the following sequence: ATCGAT CCCCTGGAGAACACCGACTTCAGGGTGCTGGAGCTGTACTCCCAGAAGGAACTGAGGT CCAGCAACGTGTTCGACCTGGAGGAAATCATGAGAGAGTTCAACAGCTACAAGCAGCGCGTGAA GTACGTGGAGGACAAGGTGGTGGACCCCCTGC CCCCCTACCT GAAGGGCCTGGACGACCTGA TGAGCGGACTCGGGGCTGCTGGAAAGGCCTGA GGATCC was also generated.
  • This variant codes for a 683 amino acid long protein.
  • the complete amino acid sequence of gB-SLP12-Delta725-LVL759 is given in SEQ ID NO:14.
  • the pTT5-gB-SLP12-Delta725-RR-leader2 plasmid was mutated using the QuickChange II XL Site-Directed Mutagenesis kit from Stratagene (No. 200522) and the primer CAN1498 5'-gtgcatcgtgtgcctgggatccgaggccgtgagccacagg-3' and CAN 1499 5'-cctgtggctcacggcctcggatcccaggcacacgatgcac-3' resulting in the intermediate plasmid pTT5-694-13.
  • This intermediate plasmid was mutated using the same QuickChange II XL Site-Directed Mutagenesis kit and the primer CAN 1650 5'- gtgaacctgtgcatcgtgtgcctggccctggccagccaccgggccaacgagacaa-3' and CAN 1651 5'- ttgtctcgttggcccggtggctggccagggccaggcacacgatgcacaggttcac-3' resulting in the final expression vector pTT5-gB-SLP12-725-LVL759.
  • the nucleotide sequence encoding for gB-SLP12-Delta725-LVL759 is shown in SEQ ID NO:13.
  • This variant codes for a 683 amino acid long protein.
  • the complete amino acid sequence of gB-SLP12-Delta725-LVL776 variant is given in SEQ ID NO:16.
  • the above intermediate plasmid pTT5-694-13 was mutated using using the same QuickChange II XL Site-Directed Mutagenesis kit and the primers CAN1648 5'-cctgtgcatcgtgtgcctgggagccctggccagccaccgggccaacgagacaatc-3' and CAN1649 5'-gattgtctcgttggcccggtggctggccagggctcccaggcacacgatgcacagg-3' resulting in a further intermediate plasmid pTT5- LVL758-1.
  • This intermediate plasmid was mutated using the same QuickChange II XL Site-Directed Mutagenesis kit and the primers CAN1697 5'-tggtgtgcgtgaacctgtgcatcgtgctcctgggagccctggcccaccgggccaacgagacaatctac-3' and CAN1698 5'-gtagattgtctcgttggcccggtgggccagggctcccaggagcacgatgcacaggttcacgcacacca-3' resulting in the final vector expression pTT5-gB-SLP12-Delta725-LVL776.
  • the nucleotide sequence encoding for gB-SLP12-Delta725-LVL759 is shown in SEQ ID NO:15.
  • the gB-SLP12-Delta725-CD33 variant codes for a 677 amino acids long protein.
  • This construct is almost identical to gB-SLP12-Delta725 construct except that the N-terminal part of the gB gene, encompassing nucleotides 1 to 192 (the signal sequence and the first 64 amino acids of mature gB protein), were replaced with the signal sequence of CD33 (Taylor et al. 1999, Vol. 274, No. 17: p11505-11512).
  • the complete amino acid sequence of gB-SLP12Delta725-CD33 variant is given in SEQ ID NO 18.
  • the gB-SLP12-Delta725-CD33 gene was constructed by PCR amplification using pTT5-gB-SLP12-Delta725 plasmid as a template and the primers CD33 (SEQ ID NO:27) (5'-AATCAAAAGCTTACTAGTGCCGCCACCATGGCCCCCCTGCTGCTTCTGCTGCCCCTGCTTTGGG CAGGGGCCCTGGCCCACCGGGGCAACG-3') and CMO578 (SEQ ID NO:28) (5'-GTAATAGGATCCGGTACCTCATCAGGCCTTTCCAGCAG-3').
  • the forward primer contains the HindIII site and the CD33 signal sequence.
  • the reverse primer contains the stop codon and the BamHI site.
  • the coding sequence was PCR amplified using pEE14- gB-SLP12-Delta725-CD33 vector as a template and the primers CD33F (SEQ ID NO:29) (5'-AATCAAAAGCTTACTAGTGCCGCCACCATGGCCCCCCTGCTG-3') and Ecto-Rv (SEQ ID NO:30) (5'-GACTTATAGGATCCTCATCAGTGGTGGTGATGATGGTGGCCGCCGGCCTTTCCAGCAGC-3').
  • Forward and reverse primers contain the HindIII and BamHI cloning sites, respectively.
  • Amplified DNA and pTT5 vector were restricted with HindIII and BamHI before ligation.
  • the resulting pTT5-gB-SLP12-Delta725-CD33 expression vector after sequence verification, was used to transiently transfect CHO-S cells.
  • the nucleotide sequence encoding for gB-SLP12-Delta725-CD33 is shown in SEQ ID NO:17.
  • the different DNA constructs described above were transiently transfected in CHO (Chinese Hamster Ovary) cells, using the FreeStyleTM MAX CHO expression system from Invitrogen.
  • the construct encoding the polypeptide gB-DeltaTM was used as a control.
  • the amino acid sequence of gB-Delta TM is depicted in SEQ ID NO:2.
  • the expression vector used for expressing gB-DeltaTM was pMax-AD169.
  • FreeStyleTM MAX CHO system uses CHO-S cell line, a separate sub-clone of the common CHO-K1 cell line adapted to suspension and a synthetic cationic lipid-based polymer as transfection reagent.
  • Plasmid DNA for transfection was isolated using Qiagen Maxiprep kit (Qiagen, Valencia, CA) following manufacturer's protocol. The transfection complex was prepared as recommended by Invitrogen. Briefly 37.5 ⁇ g of plasmid and 37.5 ⁇ l of FreeStyle MAX transfection reagent were diluted separately in 0.6 ml of Opti-ProTMSFM medium. Right after, the diluted FreeStyle MAX transfection reagent was added to the diluted DNA solution. The DNA-FreeStyle MAX mix was incubated for 10 minutes at room temperature before adding to the cell culture. Transfected cultures were incubated at 37°C for 3 days. Then, the cultures were maintained at 29°C for another 3 days period.
  • the proteins were transferred to nitrocellulose membranes and the membranes probed with the anti-gB antibody MAb 27-156 (Spaete et al., 1990).
  • the expression and secretion level were detected by Elisa assay using an anti-gB antibody.
  • the assay was performed in 96 well plates. Plates were coated with a polyclonal anti-gB antibody (the antibody was produced by injecting the polypeptide gB** - described in EP0759995 - in rabbits). After a saturation step in Skim Milk 3 % for 1h at 37°C, the antibody was incubated overnight at 4°C. The wells were then washed 4 times.
  • TMB Tetra-methyl-benzidine 75%
  • FIG.3 Shown in FIG.3 is a representative Western blot out of three experiments performed independently -
  • the lanes A, B, C and D represent the cellular fractions of the cultures transfected with gB-DeltaTM, gB-SLP12, gB-SLP1-Del2 and gB-SLP12-Del2, respectively.
  • the level of gB present in said cellular fractions is indicative of the level of gB which is intracellular.
  • the lanes E, F, G and H represent the supernatants of the cultures transfected with gB-DeltaTM, gB-SLP12, gB-SLP1-Del2 and gB-SLP12-Del2, respectively.
  • the level of gB present in said supernatants is indicative of the level of gB which is secreted. If comparing the level of gB present in lanes B, C and D with the level of gB present in lane A, it is noted that the level of intracellular gB remains unchanged when mutating the fusion loops, i.e . the polypeptides of the invention, as compared to gB-DeltaTM with intact fusion loops, i.e. the polypeptide of the prior art, suggesting that mutations in fusion loops do not affect secretion.
  • gB-DeltaTM it was observed that within the population of the expressed polypeptide, around half of the polypeptide is retained intracellularly (gray bar) and around half of the polypeptide is secreted (black bar), Surprisingly, when gB-SLP12 was expressed, it was observed that the level of total expression was significantly higher than for gB-DeltaTM, around 2-fold. Moreover, if comparing the respective level of the intracellular form and the secreted form, it was observed that more than 80% of the polypeptide was secreted, while only 10-20% remained intracellular, suggesting that gB-SLP12 was also more efficiently secreted than gB-DeltaTM.
  • FIG. 5A shows that gB-SLP12 is secreted at least as efficiently as gB-SLP12-Delta725, both of which showing a higher secretion level than gB-DeltaTM (compare lanes F and J with lane B), confirming the results observed by Elisa assay.
  • the lanes M and N represent the cellular fractions and the supernatant of a culture transfected with gB-SLP12-Delta725 having intact fusion loops FL1 and FL2.
  • FIG. 5C A Western Blot is shown in FIG. 5C -
  • the level of gB present in the supernatant of a culture transfected with gB-SLP12-Delta725-LVL759 is at least as good as the level of gB present in the supernatant of a culture transfected with gB-SLP12-Delta725 (compare lanes f and h with lanes b and d, respectively).
  • the level of gB present in the supernatant of a culture transfected with gB-SLP12-Delta725-LVL776 is only slightly lower than the level of gB present in the supernatant of a culture transfected with gB-SLP12-Delta725 (compare lanes j and l with lanes b and d, respectively). These results indicate that the mutation in the N-terminal part in polypeptides (see FIG. 2 ) of the invention does not significantly impact the secretion level of said polypeptides.
  • gB-DeltaTM, gB-SLP12 and gB-SLP1-Del2 were transiently expressed in CHO cells as described in Example 2, and the culture supernatants were collected at day 6 post-transfection. After clarification, the supernatants were supplemented with 350 mM NaCl and 0.4% Empigen and then 0.22 ⁇ m filtrated. Nickel columns were used to purify the transfected and secreted polypeptides from cell corresponding culture supernatants. XK 16 columns (Qiagen) were equilibrated with a buffer comprising 10 mM TRIS-HCl, 350 mM NaCl, 10 mM imidazole and 0.4% Empigen pH 8.0.
  • Cell culture supernatants previously clarified, supplemented and filtrated, were loaded at a flow rate of 4 ml/min and retained proteins were washed with the equilibration buffer. Elution was performed at a flow rate of 4 ml/min with a buffer comprising 10 mM TRIS HCl, 350 mM NaCl, 350 mM imidazole and 0.4% Empigen pH 8.0. The eluted fractions were then injected at a flow rate of 2 ml/min in XK 26 columns (GE) equilibrated with a buffer comprising 10 mM phosphate (K) buffer and 0.4% Empigen pH 7.2. The first protein peak was harvested for further analysis.
  • GE XK 26 columns
  • the eluted fractions corresponding to this peak were then loaded on cellufine sulphate columns (Chisso Corporation) equilibrated with a buffer comprising 10 mM phosphate (K) and 0.4% Empigen pH 7.2. Elution was performed at a flow rate of 3 ml/min with a buffer comprising 5 mM phosphate (K), 1M NaCl and 0.1% Pluronic F68 pH 7.2.
  • the purified polypeptides resulting from the above purification process were then subjected to the following experiments.
  • Glutaraldehyde was added directly to 15 ⁇ l of each purified polypeptide (corresponding to approximately 7 ⁇ g of total protein) so as to obtain a final concentration of glutaraldehyde of 0.5% and 1%.
  • a sample of each purified polypeptide was left without glutaraldehyde. The mixtures were left incubated for 150 min and, then, the glutaraldehyde reaction was stopped by adding NaBH 4 (Aldrich) and the samples were incubated on ice for 20 min. Samples were then run on Criterion XT 4-12% Bis Tris gel (Biorad) using MOPS buffer. The gel was stained with Coomassie blue R-250 and is shown in FIG. 9 .
  • any multimer present in said sample was denatured into monomers when migrating on a gel in denaturing conditions, so that polypeptides in control samples migrated according to the molecular weight equivalent to a monomer of the polypeptide (see a single band a bit lower than 150 kDa in lanes A, D and G). If considering the multimer profile of gB-DeltaTM (lanes A, B and C), one observes 2 bands of very high molecular weight (indicated by the arrows) in samples treated with glutaraldehyde.
  • the gel used in that experiment does not provide a resolution good enough to determine whether the lower molecular weight bands observed in lanes relating to gB-DeltaTM are of the same size as the ones observed in lanes relating to gB-SLP12 and gB-SLP1-Del2. For the same reason, it is not possible to determine precisely the actual size of each band, so that identifying the observed multimers as dimers or trimers, etc... from that experiment is difficult. In order to get this information, the two following experiments were performed with the purified polypeptides.
  • AUC Analytical ultracentrifugation
  • gB-DeltaTM, gB-SLP12 and gB-SLP1-Del2 resuspended in 10 mM sodium phosphate, 1 M NaCl and 0.1% Pluronic, pH 7.2 were spun in a Beckman-Coulter ProteomeLab XL-1 analytical ultracentrifuge at 28 000 rpm after the AN-60Ti rotor had been equilibrated to 15°C. For data collection, 160 scans were recorded at 280nm and 230nm every 5 min. Data analysis was performed using the program SEDFIT for determination of the C(S) distribution.
  • Determination of the partial specific volume of the proteins was performed with the SEDNTERP software from a combination of their amino acid sequence and of their expected glycan composition. SEDNTERP was also used to determine the viscosity and the density of the buffer, by neglecting the contribution of the Pluronic F68, which is not represented in the database of this software. The results are presented in the form of a graph representing the concentration of each species plotted against molecular weight. Determination of the relative abundance of all species has been performed by considering the total area under the curve of the overall distribution as 100% of the sample and by calculating the percentage of this total area represented by the contribution of every species.
  • FIG. 10 successively displays the profile of purified gB-DeltaTM, gB-SLP12 and gB-SLP1-Del2 as analysed by analytical ultracentrifugation.
  • the graph corresponding to the gB-DeltaTM sample indicates a heterogeneous distribution represented by a plurality of peaks.
  • the major population observed in said sample are species of 417 kDa (35%) and 723 kDa (30%), which are likely to represent trimers and hexamers, respectively. Higher molecular weight multimers are also present within said sample.
  • the profile of the corresponding purified gB-SLP12 polypeptide indicates a more homogenous population, as the major population is a species of 327 kDa (63%) which is likely to represent trimers.
  • the presence of higher molecular weight multimers is barely noticeable.
  • a similar profile was observed in the gB-SLP1-Del2 sample, wherein the major population is a species of 311 kDa (67%) which is likely to represent trimers also, while the presence of higher molecular weight multimers is only marginal.
  • the gB polypeptides of the invention present an improved product profile, as the trimers population is increased of an approximately 2-fold factor, as compared with the trimer population of the gB polypeptide of the prior art (gB-DeltaTM).
  • Analytical Ultracentrifugation was performed as described above in section 3.2 to determine the homogeneity and size distribution in solution of the different species within the purified polypeptides gB-SLP12-Delta725 and gB-SLP12-Delta113.
  • the polypeptides were recombinantly expressed as described in Example 2 and purified as described in the first paragraph of the present Example 3.
  • gB-SLP12-Delta725 and gB-SLP12-Delta113 were each resuspended either in a buffer comprising 0.1 % Pluronic or in a buffer with no Pluronic.
  • gB-SLP12-Delta113 and gB-SLP12-Delta725 show an improved product profile, with an enriched proportion of trimers
  • the results obtained indicate that gB-SLP12-Delta725 presents the additional advantage of having an increased structural stability in solution, as its trimer profile is maintained in the presence or absence of Pluronic. Indeed, a detergent treatment had no observable impact on the sedimentation properties of that polypeptide.
  • the protein size of purified gB-DeltaTM and gB-SLP12 was also determined by size-exclusion chromatography using a UV-detector at 280 nm and a TSK G5000PWXL column (Tosoh Bioscience). The samples were loaded at room temperature at a flow rate of 0.5ml/min. The elution was performed with PBS + 0.1% Pluronic at the same flow rate at room temperature.
  • Thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), albumin (68 kDa), conalbumine (75k Da), ovalbumin (43 kDa), carbonic anydrase (29 kDa), and ribonuclease (13.7kDa) were used for calibration.
  • gB-SLP12 has a size of 357 kDa, as measured by size-exclusion chromatography, which is likely to represent the trimeric form.
  • the gB-DeltaTM, gB-SLP12, gB-SLP12-Delta113 and gB-SLP12-Delta725 polypeptides were transiently transfected and expressed as described in Example 2.
  • gB-SLP12, gB-SLP12-Delta113 and gB-SLP12-Delta725 polypeptides were purified as described in the first paragraph of the Example 3. After collection on day 6 post-transfection,the gB-DeltaTM supernatant was supplemented with Bis-Tris and Empigen BB to reach the final concentration of 20 mM and 0.4%, respectively.
  • the polypeptide-containing flow-through was recovered, concentrated by ultrafiltration using a 100kD Pellicon XL membrane (Millipore), and loaded onto a Superdex 200 column (GE Healthcare) equilibrated in a buffer comprising 10 mM sodium phosphate - 0.4% Empigen BB, pH 7.2. The eluate was collected, concentrated and diafiltered with 10 mM potassium phosphate, pH 7.2.
  • the data presented in FIG. 14 show that the clipping occurring with the polypeptides gB-DeltaTM and gB-SLP12 in the C-terminal part of the polypeptide does not occur when at least part of the cytoplasmic domain is deleted.
  • the CMV gB-SLP12-Delta725 polypeptide when recombinantly expressed in cells results in a population of mature polypeptides which are heterogeneous at the the N-terminal end. Indeed, the signal peptidase happens to cleave off the signal sequence at different amino acid positions, as indicated. This phenomenon is also referred to as signal peptidase "woobling".
  • the culture supernatants were collected.
  • An EDTA-free protease inhibitor cocktail (Roche, No. 11873580001) was added to the supernatants, and the NaCl concentration was adjusted to 500 mM, and the final pH to 8.3.
  • IMAC sepharose 6 FF (GE Healthcare) was packed into 5 cm diameter glass columns (Waters). The columns were equilibrated with 5 column volumes of binding buffer (10 mM Tris, 500 mM NaCl, 10 mM Imidazole, pH 8.3). The supernatants were loaded on the equilibrated columns at a flow rate of 10 ml/min. Unbound material was washed with two column volumes of the above binding buffer. Fractions of 50 ml were harvested. Columns were further washed with an additional two column volumes of the above binding buffer. Fractions of 10 ml were harvested.
  • the proteins bound to the columns were eluted with 6 column volumes of elution buffer (Tris, 500 mM NaCl, 350 mM, Imidazole, pH 8.30). Fractions of 10 ml were harvested. The fractions were loaded on a SDS-PAGE gel and positive fractions were pooled and concentrated with Centricon Ultrafiltration device (Millipore). The concentrated protein was quantified by RCDC modified Lowry colorimetric assay (Biorad). 5 to 10 ⁇ g of the purified protein was deglycosylated using the N-Glycosidase F deglycosylation kit (Roche, No. 11836552001) following the manufacturer's instructions.
  • the deglycosylated protein was precipitated by RCDC precipitation reactant (BioRad), resuspended in SDS-PAGE reducing loading buffer and loaded on SDS-PAGE.
  • the protein band migrating at the position corresponding to the deglycosylated protein was cut for tryptic digestion and MS/MS peptide mapping analysis.
  • the gel pieces containing the purified protein were dehydrated with acetonitrile (ACN). Proteins were reduced by adding the reduction buffer (10 mM DTT, 100 mM ammonium bicarbonate) for 30 min at 40°C, and alkylated by adding the alkylation buffer (55 mM iodoacetamide, 100 mM ammonium bicarbonate) for 20 min at 40°C. Gel pieces were then further dehydrated and washed at 40 °C by adding ACN for 5 min before discarding all the reagents.
  • ACN acetonitrile
  • LC-MS/MS analysis Prior to LC-MS/MS analysis, extracted peptides were re-solubilized under agitation for 15 min in 12 ⁇ l of 0.2% formic acid and then centrifuged at 2000 rpm for 1 min.
  • the LC column is a C18 reversed phase column packed with a high-pressure packing cell.
  • a 75 lm i.d. fused silica capillary of 100 mm long was packed with the C18 Jupiter 5 lm300 ⁇ reverse-phase material (Phenomenex).
  • This column was installed on the nano LC-2D system (Eksigent) and coupled to the LTQ Orbitrap (ThermoFisher Scientific).
  • the buffers used for chromatography were 0.2% formic acid (buffer A) and 100% ACN/0.2% formic acid (buffer B). During the first 12 min, 5 ⁇ l of sample are loaded on column with a flow of 650nl/min and, subsequently, the gradient goes from 2-80% buffer B in 20 min and then come back to 2% buffer B for 10 min.
  • LC-MS/MS data acquisition was accomplished using a four scan event cycle comprised of a full scan MS for scan event 1 acquired in the Orbitrap.
  • Example 6 Immunogenicity of immunogenic compositions containing exemplary CMV gB polypeptides of the invention
  • Immunogenicity was evaluated by analyzing the humoral immune responses to vaccination, as measured by neutralization (NT) assay and ELISA (Enzyme-Linked immuno Sorbent Assay) 21 days post-immunization 1 and 14 days post-immunization 2 (see section 6.3 and 6.4, respectively).
  • neutralization NT
  • ELISA Enzyme-Linked immuno Sorbent Assay
  • Groups of 10 C57BL/6 mice have been designed in order to obtain 90% of power with a 2-fold difference for the primary read-out.
  • Statistical analysis was performed on days 14 post-immunization 2 data using UNISTAT.
  • the protocol applied for analysis of variance can be briefly described as follows: Log transformation of data; Shapiro-Wilk test on each population (group) in order to verify the normality; Cochran test in order to verify the homogeneity of variance between different populations (group): Analysis of variance on selected data (ANOVA 1 or 2); Tuckey-HSD test for multiple comparisons.
  • MRC5 cells Prior to the assay, MRC5 cells were seeded into 96-well plates and incubated for 3 days at 37°C. Serial dilutions of heat-inactivated sera were incubated with a fixed amount of human CMV AD169 virus for 1h at 37°C. After incubation, the mixture of sera and virus was added into 96-well plates containing MRC5 cells. The plates were centrifuged at 2000 rpm for 1h at 37°C. After an overnight incubation at 37°C, the plates were fixed with a solution of acetone 80% (20-30 min at +4°C).
  • the acetone solution was removed and the CMV-positive wells were detected using a specific monoclonal biotin-conjugated anti-immediate early I (IE-I) antibody for 1h at 37°C.
  • IE-I monoclonal biotin-conjugated anti-immediate early I
  • the plates were washed 3 times with PBS. After washing, streptavidin-horseradish peroxidase was added for an additional 30 min at 37°C. Plates were washed 3 times and incubated for 10 min with a solution of True-Blue. Specific colored signals were recorded by visual examination under microscope. Neutralizing titers were expressed as the reciprocal of the highest dilution of serum giving 50% reduction in the number of CMV-positive wells when compared to the virus dose control without serum.
  • the neutralizing antibody response was measured on sera samples collected 21 days after the first immunization and 14 days after the second immunization. Samples were tested for their neutralizing activity against human CMV AD169 virus. Results are shown in FIG. 15A . All tested polypeptides induced a significant response 14 days post-immunization 2 (see the grey bars). gB-SLP12, gB-SLP12-Delta113, gB SLP12-Delta725 and LVL759 induced titres that were non-significantly* different from gB-DeltaTM. CD33 (p-value: 0.0006) and LVL776 (p-value: 0.0116) induced titers significantly lower than gB-DeltaTM.
  • Quantification of anti-gB antibodies was performed by ELISA using a gB polypeptide called gB** (described in EP0759995 ) as a coating antigen.
  • the antigen was diluted at a final concentration of 4 ⁇ g/ml in PBS (100 ⁇ l/well) and incubated overnight at 4°C in 96-well plates. The plates were then saturated for 1h at 37°C with 200 ⁇ l of PBS containing 1% Bovine Serum Albumin. Two-fold serial dilutions of sera were added into wells (100 ⁇ l/well) and incubated 1h 30 min at 37°C. The plates were washed 4 times with PBS/Tween 20 0.1%.
  • the ELISA titre was measured on sera samples collected 21 days after the first immunization and 14 days after the second immunization. Results are shown in FIG. 15B . All tested polypeptides induced a significant response 14 days post-immunization 2 (see the grey bars).
  • gB-SLP12-Delta113 and gB-SLP12-Delta725 induced titers that were non-significantly* different from the titer induced by gB-DeltaTM.
  • gB-SLP12, CD33, LVL759 and LVL776 induced titers that were non-significantly* different.
  • gB-DeltaTM induced significantly higher titres** than gB-SLP12 (p-value: 0.0002), CD33 (p-value: 0.0226), LVL759 (p-value: 0.0002) and LVL776 (p-value: 0.0001).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Communicable Diseases (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)

Claims (18)

  1. Polypeptide gB du cytomégalovirus (CMV) comprenant un domaine transmembranaire (TM) non fonctionnel, dans lequel au moins 50 %, au moins 70 %, au moins 80 %, ou au moins 90 % des acides aminés du domaine TM sont délétés, et au moins une partie du domaine extracellulaire de la protéine gB comprenant un domaine de boucle de fusion 1 (FL1) défini par les acides aminés Y.I.Y localisés au niveau des positions 155 à 157 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV, et un domaine de boucle de fusion 2 (FL2) défini par les acides aminés W.L.Y localisés au niveau des positions 240 à 242 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du cytomégalovirus, dans lequel au moins le domaine FL1 comprend la substitution d'au moins un acide aminé choisi parmi Y.I.Y localisés au niveau des positions 155 à 157 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV, par un acide aminé polaire autre qu'un acide aminé aromatique.
  2. Polypeptide gB du CMV selon la revendication 1, dans lequel le domaine TM est rendu non fonctionnel par délétion des acide aminés acides aminés 701 à 775 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV.
  3. Polypeptide gB du CMV selon la revendication 1 ou la revendication 2, comprenant une délétion d'au moins 80 %, d'au moins 90 %, d'au moins 95 % des acides aminés du domaine cytoplasmique, ou une délétion du domaine cytoplasmique entier.
  4. Polypeptide gB du CMV selon les revendications 1 à 3, dans lequel l'acide aminé polaire est choisi dans le groupe des acides aminés chargés positivement constitué de la lysine (K), l'histidine (H) et l'arginine (R).
  5. Polypeptide gB du CMV selon l'une quelconque des revendications 1 à 4, dans lequel les acides aminés Y.I.Y localisés au niveau des positions 155 à 157 dans le domaine de boucle de fusion FL1 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV, sont substitués par les acides aminés G.H.R, respectivement.
  6. Polypeptide gB du CMV selon l'une quelconque des revendications 1 à 5, dans lequel les acides aminés Y.I.Y localisés au niveau des positions 155 à 157 dans le domaine de boucle de fusion FL1 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV, sont substitués par une séquence d'acides aminés présentant un score d'hydrophobicité inférieur à -3, inférieur à -7, inférieur à -8, mesuré par l'échelle de Kyte et Doolittle.
  7. Polypeptide gB du CMV selon l'une quelconque des revendications 1 à 6, dans lequel le domaine de boucle de fusion FL2 comprend la substitution d'au moins un acide aminé choisi parmi W.L.Y localisés au niveau des positions 240 à 242 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV, par un acide aminé chargé positivement choisi dans le groupe constitué de la lysine (K), l'histidine (H) et l'arginine (R).
  8. Polypeptide gB du CMV selon l'une quelconque des revendications 1 à 7, dans lequel les acides aminés W.L.Y localisés au niveau des positions 240 à 242 dans le domaine de boucle de fusion FL2 de la séquence représentée par SEQ ID NO : 1, ou au niveau d'une position correspondante dans d'autres polypeptides gB du CMV, sont substitués par les acides aminés A.F.H, respectivement.
  9. Polypeptide gB du CMV selon l'une quelconque des revendications 1 à 8, comprenant une délétion d'au moins 40 %, d'au moins 50 %, d'au moins 70 %, d'au moins 80 %, d'au moins 90 % des acides aminés de la séquence de tête, ou de la séquence de tête entière.
  10. Polypeptide gB du CMV ayant la séquence choisie dans le groupe constitué des séquences représentées par : SEQ ID NO : 3, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID NO : 10, SEQ ID NO : 12, SEQ ID NO : 14, SEQ ID NO : 16, SEQ ID NO : 18, SEQ ID NO : 19, SEQ ID NO : 20 et SEQ ID NO : 21.
  11. Composition immunogène comprenant le polypeptide gB du CMV selon l'une quelconque des revendications 1 à 9 mélangé avec un support pharmaceutique approprié.
  12. Composition immunogène selon la revendication 11, comprenant en outre un adjuvant comprenant du 3D-MPL et du QS21 dans une formulation liposomique.
  13. Polynucléotide qui code pour le polypeptide gB du CMV selon l'une quelconque des revendications 1 à 9.
  14. Polynucléotide ayant la séquence choisie dans le groupe constitué des séquences représentées par : SEQ ID NO : 6, SEQ ID NO : 7, SEQ ID NO : 8, SEQ ID NO : 9, SEQ ID NO : 11, SEQ ID NO : 13, SEQ ID NO : 15, et SEQ ID NO : 17.
  15. Vecteur recombinant comprenant le polynucléotide selon la revendication 13 ou la revendication 14.
  16. Cellule hôte transformée par le vecteur recombinant selon la revendication 15.
  17. Polypeptide gB du CMV selon l'une quelconque des revendications 1 à 9 ou la composition selon l'une quelconque des revendications 11 et 12, pour une utilisation dans la prévention et/ou le traitement d'une infection par le CMV.
  18. Polypeptide gB du CMV selon la revendication 17 pour une utilisation dans la prévention d'une infection congénitale par le CMV chez un nouveau-né.
EP11768058.7A 2010-10-15 2011-10-14 Antigène gb de cytomégalovirus Active EP2627352B1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US39341310P 2010-10-15 2010-10-15
PCT/EP2011/068040 WO2012049317A2 (fr) 2010-10-15 2011-10-14 Nouvel antigène

Publications (2)

Publication Number Publication Date
EP2627352A2 EP2627352A2 (fr) 2013-08-21
EP2627352B1 true EP2627352B1 (fr) 2017-05-10

Family

ID=44789497

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11768058.7A Active EP2627352B1 (fr) 2010-10-15 2011-10-14 Antigène gb de cytomégalovirus

Country Status (20)

Country Link
US (1) US20130216613A1 (fr)
EP (1) EP2627352B1 (fr)
JP (1) JP6138047B2 (fr)
KR (1) KR20130140009A (fr)
CN (1) CN103237560B (fr)
AR (1) AR083454A1 (fr)
AU (1) AU2011315447A1 (fr)
BR (1) BR112013008624B1 (fr)
CA (1) CA2813522C (fr)
CL (1) CL2013001037A1 (fr)
CO (1) CO6741153A2 (fr)
CR (1) CR20130191A (fr)
DO (1) DOP2013000080A (fr)
ES (1) ES2635014T3 (fr)
IL (1) IL225667A0 (fr)
MA (1) MA34802B1 (fr)
MX (1) MX2013004149A (fr)
SG (1) SG189176A1 (fr)
TW (1) TW201305190A (fr)
WO (1) WO2012049317A2 (fr)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2010313339B2 (en) * 2009-10-30 2016-05-26 The Administrators Of The Tulane Educational Fund Peptide compositions and methods for inhibiting herpesvirus infection
AU2014359276B2 (en) * 2013-12-03 2021-01-28 Hookipa Biotech Gmbh CMV vaccines
CN106102769A (zh) * 2013-12-11 2016-11-09 促进军事医学的亨利·M·杰克逊基金会公司 人疱疹病毒三聚糖蛋白B、包含三聚gB的蛋白复合体及其作为疫苗的用途
EP3031822A1 (fr) 2014-12-08 2016-06-15 Novartis AG Antigènes du cytomégalovirus
US10611800B2 (en) 2016-03-11 2020-04-07 Pfizer Inc. Human cytomegalovirus gB polypeptide
EP3426676A1 (fr) * 2016-03-11 2019-01-16 Pfizer Inc Polypeptide gb de cytomégalovirus humain
CN106119286A (zh) * 2016-08-10 2016-11-16 吴江近岸蛋白质科技有限公司 表达载体及其高效表达和制备人胱抑素c蛋白的方法
EP3606551A1 (fr) * 2017-04-04 2020-02-12 Avidea Technologies, Inc. Vaccins à base de peptides, procédés de fabrication et utilisations de ceux-ci pour induire une réponse immunitaire
AU2018331874B2 (en) 2017-09-13 2022-06-02 Sanofi Pasteur Human cytomegalovirus immunogenic composition
US20210346494A1 (en) 2018-10-25 2021-11-11 Km Biologics Co., Ltd. Modified cmv gb protein and cmv vaccine including same
WO2020121983A1 (fr) * 2018-12-10 2020-06-18 Kmバイオロジクス株式会社 Vaccin pour la prévention ou le traitement d'une infection congénitale par le cytomégalovirus
US11629172B2 (en) 2018-12-21 2023-04-18 Pfizer Inc. Human cytomegalovirus gB polypeptide
CN109627294B (zh) * 2018-12-29 2020-10-09 四川大学 一种正确折叠的重组狂犬病毒g蛋白胞外段及其潜在应用
US20230201334A1 (en) 2019-07-24 2023-06-29 Glaxosmithkline Biologicals Sa Modified human cytomegalovirus proteins
EP4161570A1 (fr) 2020-06-05 2023-04-12 GlaxoSmithKline Biologicals S.A. Protéines modifiées de spicule de coronavirus bêta
WO2021250626A2 (fr) 2020-06-12 2021-12-16 Glaxosmithkline Biologicals Sa Système d'étiquette-ancrage
WO2021250625A2 (fr) 2020-06-12 2021-12-16 Glaxosmithkline Biologicals Sa Nanoparticules de ferritine gbs
TW202413391A (zh) * 2020-06-21 2024-04-01 美商輝瑞股份有限公司 人巨細胞病毒糖蛋白B(gB)多肽
US20230398211A1 (en) 2020-10-28 2023-12-14 Sanofi Pasteur Liposomes Containing TLR4 Agonist, Preparation and Uses Thereof
EP4401763A1 (fr) * 2021-09-16 2024-07-24 The Council of the Queensland Institute of Medical Research Compositions immunogènes et leurs utilisations
WO2023144665A1 (fr) 2022-01-28 2023-08-03 Glaxosmithkline Biologicals Sa Protéines de cytomégalovirus humain modifiées
CN115948468A (zh) * 2022-09-09 2023-04-11 青岛大学 一种人巨细胞病毒重组载体及其制备方法和应用

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235877A (en) 1979-06-27 1980-11-25 Merck & Co., Inc. Liposome particle containing viral or bacterial antigenic subunit
US4372945A (en) 1979-11-13 1983-02-08 Likhite Vilas V Antigen compounds
IL61904A (en) 1981-01-13 1985-07-31 Yeda Res & Dev Synthetic vaccine against influenza virus infections comprising a synthetic peptide and process for producing same
US4866034A (en) 1982-05-26 1989-09-12 Ribi Immunochem Research Inc. Refined detoxified endotoxin
US4436727A (en) 1982-05-26 1984-03-13 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US6100064A (en) 1984-04-06 2000-08-08 Chiron Corporation Secreted viral proteins useful for vaccines and diagnostics
US4877611A (en) 1986-04-15 1989-10-31 Ribi Immunochem Research Inc. Vaccine containing tumor antigens and adjuvants
CA1331443C (fr) 1987-05-29 1994-08-16 Charlotte A. Kensil Adjuvant a saponine
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
US4912094B1 (en) 1988-06-29 1994-02-15 Ribi Immunochem Research Inc. Modified lipopolysaccharides and process of preparation
DK0382271T3 (da) 1989-02-04 1995-05-01 Akzo Nobel Nv Tocoler som adjuvanser i vacciner
ATE204762T1 (de) 1993-03-23 2001-09-15 Smithkline Beecham Biolog 3-0-deazylierte monophosphoryl lipid a enthaltende impfstoff-zusammensetzungen
CZ290331B6 (cs) 1993-11-17 2002-07-17 Laboratoires Om S. A. Glukosaminové disacharidy, způsob jejich přípravy a farmaceutický prostředek
GB9409962D0 (en) 1994-05-18 1994-07-06 Smithkline Beecham Biolog Novel compounds
UA56132C2 (uk) 1995-04-25 2003-05-15 Смітклайн Бічем Байолоджікалс С.А. Композиція вакцини (варіанти), спосіб стабілізації qs21 відносно гідролізу (варіанти), спосіб приготування композиції вакцини
EP1089913A1 (fr) 1998-06-08 2001-04-11 SCA Emballage France Emballage a remise a plat rapide
RU2223262C2 (ru) 1998-06-30 2004-02-10 Ом Фарма Новые ацилированные псевдодипептиды, способ их получения и содержащие их фармацевтические композиции
DE19910044A1 (de) * 1999-03-08 2000-09-14 Bodo Plachter Virale Partikel, die nach Infektion durch humanes Cytomegalovirus freigesetzt werden und ihre Verwendung als Impfstoff
AU1581400A (en) 1999-12-22 2001-07-03 Om Pharma Acyl pseudopeptides bearing a functionalised auxiliary spacer
WO2009037359A1 (fr) * 2007-09-21 2009-03-26 Sanofi Pasteur Composition vaccinale pour la prévention d'infections à cmv
WO2010089129A1 (fr) * 2009-02-06 2010-08-12 Cormus Srl Inhibiteurs de fusion virale et leurs utilisations
AU2010313339B2 (en) * 2009-10-30 2016-05-26 The Administrators Of The Tulane Educational Fund Peptide compositions and methods for inhibiting herpesvirus infection
EP2603241A2 (fr) * 2010-08-11 2013-06-19 Jv Bio Srl Inhibiteurs multimères de fusion virale et ses utilisations

Also Published As

Publication number Publication date
BR112013008624A2 (pt) 2021-05-11
WO2012049317A2 (fr) 2012-04-19
TW201305190A (zh) 2013-02-01
BR112013008624B1 (pt) 2022-07-26
ES2635014T3 (es) 2017-10-02
CL2013001037A1 (es) 2013-08-30
CR20130191A (es) 2013-06-28
IL225667A0 (en) 2013-06-27
WO2012049317A3 (fr) 2012-06-21
CA2813522A1 (fr) 2012-04-19
MA34802B1 (fr) 2014-01-02
JP6138047B2 (ja) 2017-05-31
KR20130140009A (ko) 2013-12-23
US20130216613A1 (en) 2013-08-22
AU2011315447A1 (en) 2013-05-09
SG189176A1 (en) 2013-05-31
CA2813522C (fr) 2022-06-21
CO6741153A2 (es) 2013-08-30
JP2013544074A (ja) 2013-12-12
EP2627352A2 (fr) 2013-08-21
MX2013004149A (es) 2013-09-02
DOP2013000080A (es) 2013-08-15
CN103237560A (zh) 2013-08-07
AR083454A1 (es) 2013-02-27
CN103237560B (zh) 2016-05-11

Similar Documents

Publication Publication Date Title
EP2627352B1 (fr) Antigène gb de cytomégalovirus
US20230201334A1 (en) Modified human cytomegalovirus proteins
WO2010149743A2 (fr) Vaccin
JP6515036B2 (ja) C.ディフィシルCDTb及び/又はCDTaタンパク質のエレメントを含む免疫原性組成物
JP2011528222A (ja) キメラ呼吸器合胞体ウイルスポリペプチド抗原
US20230174587A1 (en) Recombinant human metapneumovirus f proteins and their use
US20220175910A1 (en) Novel influenza antigens
CN114206909A (zh) 治疗性病毒疫苗
US11872279B2 (en) SARS-CoV-2 antigens and uses thereof
JP2023523423A (ja) SARS-CoV-2に対するワクチン及びその調製物
Chiang et al. Induction of robust immunity by the emulsification of recombinant lipidated dengue-1 envelope protein domain III
JP2015528456A (ja) Staphylococcusaureusに対する免疫化のための安定化されたタンパク質
CN116212012A (zh) 复合佐剂以及包含它的疫苗制剂
CN115515628A (zh) 腮腺炎和麻疹病毒免疫原及其用途
WO2023144665A1 (fr) Protéines de cytomégalovirus humain modifiées
JP2015532594A (ja) Staphylococcusaureusに対する免疫化のための安定化されたタンパク質
KR20220109996A (ko) 사스-코로나바이러스-2 융합 단백질 및 이를 포함하는 면역원성 조성물
BAUDOUX et al. Patent 2710600 Summary

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130508

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1182644

Country of ref document: HK

17Q First examination report despatched

Effective date: 20140805

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20160926

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 891613

Country of ref document: AT

Kind code of ref document: T

Effective date: 20170515

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602011037853

Country of ref document: DE

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 7

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG4D

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2635014

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20171002

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 891613

Country of ref document: AT

Kind code of ref document: T

Effective date: 20170510

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170811

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170810

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170910

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170810

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602011037853

Country of ref document: DE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20180213

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20171031

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20171014

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20171031

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 8

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20171014

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20111014

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20170510

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1182644

Country of ref document: HK

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170510

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230331

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: TR

Payment date: 20230927

Year of fee payment: 13

Ref country code: NL

Payment date: 20230922

Year of fee payment: 13

Ref country code: IT

Payment date: 20230920

Year of fee payment: 13

Ref country code: IE

Payment date: 20230921

Year of fee payment: 13

Ref country code: GB

Payment date: 20230920

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20230920

Year of fee payment: 13

Ref country code: BE

Payment date: 20230920

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20231102

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20230920

Year of fee payment: 13