EP2625275A1 - Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides - Google Patents

Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides

Info

Publication number
EP2625275A1
EP2625275A1 EP11767977.9A EP11767977A EP2625275A1 EP 2625275 A1 EP2625275 A1 EP 2625275A1 EP 11767977 A EP11767977 A EP 11767977A EP 2625275 A1 EP2625275 A1 EP 2625275A1
Authority
EP
European Patent Office
Prior art keywords
dna vector
dna
plasmid
circular
vitro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11767977.9A
Other languages
German (de)
English (en)
Inventor
Bernd Rehberger
Markus Heine
Claas Wodarczyk
Roland Wagner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rentschler Biotechnologie GmbH
Original Assignee
Rentschler Biotechnologie GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rentschler Biotechnologie GmbH filed Critical Rentschler Biotechnologie GmbH
Priority to EP11767977.9A priority Critical patent/EP2625275A1/fr
Publication of EP2625275A1 publication Critical patent/EP2625275A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

Definitions

  • the present invention relates to methods and reagents for the production of DNA vectors, in particular MiniCircle (MC) DNA vectors, in superhelical form. Furthermore, the invention relates to high-purity preparations of circular DNA vectors, in particular MC DNA vectors.
  • MC MiniCircle
  • the requirements for the purification method are also important Insulation of the MC correspondingly high so as not to destroy the desired structure of the MC during the purification.
  • the MC is separated from the DNA byproducts formed after recombination - parental plasmid, miniplasmide and concatemers of the individual products - by a targeted linearization of the unwanted molecules by means of specially selected restriction enzymes and subsequent agarose gel electrophoresis.
  • the MC is not modified by the restriction enzymes, so that the circular status of the MC is not affected.
  • parental plasmids such as MC are also able to transduce eukaryotic cells, this can have negative consequences for the MC experiment (eg permanently transduced cells due to integration of the parental plasmid into the genome of the host cell).
  • the new method dispenses with the use of recombinases for generating the MC from the parent plasmid. At the same time it is not It is necessary to purify the MC obtained by complex and expensive methods, such as, for example, column chromatography, since mixing of the MC with the various by-products is avoided from the outset. This leads to a simplification of the production of MC compared to the previously common methods while increasing the yield and purity of the target molecules, especially as superfluous bacterial sequences in the backbone of the MC are completely avoided.
  • the method presented here is based on a combined in vivo / in vitro technology in which, in a final enzymatic step, circular superhelical MiniCircle DNA is generated with the aid of gyrase.
  • An object of the present invention is thus a process for the preparation of a circular DNA vector in superhelical form, comprising the steps:
  • step (e) twisting the circular DNA vector of step (d) with a gyrase to obtain a circular DNA vector in superhelical form
  • Yet another object of the invention is a process for the preparation of super-helical circular DNA vectors comprising In vitro restriction cleavage, in vitro ligation, and in vitro gyrase digestion.
  • Yet another object of the invention is a process for the preparation of superheical MiniCircle DNA vectors without the use of site (sequence) specific recombinases such as FLP.
  • the production of the DNA vector in particular of the MC-DNA vector, is carried out as follows:
  • the parental plasmid is isolated from the host cell using standard methods.
  • the MC sequences of the PP are excised from the PP by digestion with restriction enzymes.
  • the resulting linear fragments one of which contains the regions of the MC, are e.g. separated by agarose gel electrophoresis.
  • the linearized MC fragments are isolated by common methods, e.g. by elution, and used for further MC preparation.
  • the relaxed MCs are twisted using (recombinant) gyrase in a ' fro' approach to produce the corresponding superheiled (supercoiled) forms of MC needed for their transduction of eukaryotic cells.
  • DNA vectors in particular MiniCircle gene vectors
  • the method described herein for the production of DNA vectors makes it possible to obtain e.g. to produce for the production of recombinant cell lines or gene therapy usable DNA vectors with simple methods in large quantities and purity.
  • a circular DNA vector is produced in superhelical form.
  • the DNA vector consists of double-stranded DNA and usually has a size of 0.5 to about 10 kb, especially about 1-6 kb. However, smaller or larger DNA vectors can also be produced.
  • the DNA vector is a MiniCircle (MC) DNA vector, i. a circular DNA vector corresponding to that for the DNA vector, e.g. the later MiniCircle DNA vector, contains necessary functions. These functions usually include sequences for a transgene, e.g. a recombinant gene or cDNA, together with regulatory sequences for gene expression, e.g.
  • Transcriptional and translational initiation sequences such as promoters, enhancers, ribosomal binding sites, etc., and optionally transcriptional termination sequences such as polyA sequences and other regulatory or functional nucleotide sequences such as e.g. S / MAR sequences for transferring the adherence of the DNA vector to the nuclear matrix as a trigger for integration-independent episomal replication (2, 13, 14).
  • the DNA vector may be a pharmaceutically acceptable DNA Sequence include, for example, a gene or a cDNA from mammals, in particular a human gene or a recombinant variant thereof for therapeutic applications, or a synthetic sequence, for example a synthetic gene.
  • a preferred "transgene” or “transgenic sequence” according to the invention is a eukaryotic sequence, especially a human sequence and / or a synthetic sequence.
  • Such a sequence encodes, for example, growth factors, cytokines, interleukins, interferons, tumor suppressor proteins, etc.
  • the DNA vector can also be transgenic as a sequence of pathogenic organisms which encode an antigen, or a sequence which can be used for a tumor or tumor Autoantigen encoded, included.
  • the preparations of circular super-helical DNA vectors, in particular MC vectors, obtainable by the process according to the invention can be used both as research reagents and as pharmaceutical products.
  • Preferred are medical applications such as DNA vaccination, gene therapy, reprogramming or reprogramming of cells or the use of RNAi.
  • the DNA vectors produced from the process can also be used for the production of therapeutic proteins in recombinant cells, in particular eukaryotic cells, in particular CHO cells.
  • the corresponding host cells are transiently or stably transduced by the DNA vectors, so that the resulting recombinant cells produce the desired therapeutic protein.
  • the production of the therapeutic protein can be carried out under common industrial biotechnological methods.
  • Another field of application of the DNA vectors produced by the method described here, in particular MiniCircle vectors, is the genetic modification of host cells which are more recombinant for expression Proteins are to be used.
  • the host cells are modified by the DNA vectors so that the expression of the transgenic protein in the modified host cells is superior in quantity and / or quality of protein expression from unaltered host cells.
  • DNA vectors in particular MC vectors
  • MC vectors the subsequent modification of already recombinant protein-producing production cells, so that they can be modulated by the genes introduced by the MC in the desired manner with respect to transgene quantity and / or quality.
  • the transduction of the target cells with one or more MCs can take place simultaneously.
  • the generation of the circular superhelical DNA vectors takes place from so-called parental plasmids, which do not differ in their basic functions from ordinary plasmids. They serve to amplify the DNA vector sequences in host cells, e.g. Bacteria such as E. coli. Other examples of suitable host cells are yeasts such as Saccharomyces.
  • These parental plasmids usually carry, in addition to the sequence of the DNA vector, heterologous sequences on a contiguous portion of the whole plasmid, e.g. for propagation in a host cell, such as information for the origin of replication to initiate replication of the plasmid in host cells and, more usually, a gene including regulatory sequences for conferring antibiotic resistance on the plasmid-bearing host cells.
  • a parent plasmid free of recombinase recognition sequences eg free of recognition sequences for sequence-specific recombinases, such as about FLP, Cre, RecA, Phi-C31 and others.
  • the parent plasmid (PP) therefore consists essentially of two parts:
  • the functional entity moiety for replication and amplification of the parental plasmid in host cells e.g. Bacteria.
  • the parent plasmid used as the starting material of the method of the present invention is usually obtained by cultivating a host cell, particularly a prokaryotic host cell such as E. coli, and isolating the plasmid from the host cell.
  • a host cell particularly a prokaryotic host cell such as E. coli
  • a bacterial strain suitable for high-copy amplification of plasmids such as E. coli XL1 Blue (16) is used as the host cell.
  • the recovery of parent plasmids does not differ from methods for the preparation of conventional plasmids or DNA vectors.
  • the purification of the PP from the bacteria can be carried out by standard methods, e.g. with commercially available kits (e.g., QIAgen Midiprep).
  • Step (a) of the method according to the invention comprises the cleavage of a parent plasmid with one or more restriction enzymes.
  • This step is conveniently carried out in vitro, ie on an isolated plasmid preparation.
  • restriction enzymes are used which allow excision of a fragment comprising the sequence of the DNA vector (DNA vector fragment).
  • DNA vector fragment is presented in linear form alongside one or more other linear fragments corresponding to those described in U.S. Pat Parental plasmid existing, additional, heterologous sequences.
  • the region of the DNA vector is not cut, while the remaining sequence, also called mini plasmid (MP), either remains as a whole piece, or is split by the cleavage into smaller pieces. It is important that no DNA fragments are formed that are similar in size to the DNA vector fragment.
  • the restriction cleavage preferably proceeds quantitatively, so that after the enzymatic treatment of the DNA there is no longer any inactivated parental plasmid.
  • step (b) the linear DNA vector fragment of other restriction cleavage products, i. other linear DNA fragments, separated.
  • separation is by size, e.g. by gel electrophoresis. Separation by agarose gel electrophoresis is preferred.
  • the linear DNA vector fragment is isolated in a highly purified form free of other products of restriction cleavage. Because the DNA vector fragment is in linearized form, it can be easily identified by its size by means of a common DNA marker in the gel.
  • the linearized MC can be isolated by standard methods, e.g. by elution and purification by means of commercial kits (e.g., QIAgen gel elute) from the agarose gel.
  • the DNA thus obtained contains only linearized MC-DNA.
  • step (c) the linear DNA vector fragment is brought into contact with a ligase under conditions under which a ligation takes place, whereby a circular DNA vector is produced in a relaxed form.
  • Step (c) is conveniently carried out in vitro, ie on an isolated preparation of the DNA vector fragment.
  • Suitable ligases are available commercially, for example in recombinant form.
  • a blunt-ended ligation may also be performed.
  • step (d) is purified to separate the circular DNA vector from other products of the ligation. This can e.g. by separation over an agarose gel. Here, possibly contaminations with MP fragments or MC concatemers are visible. From the gel, only the band for the circularized DNA vector (MC) is excised and eluted from the DNA. This further increases the purity of the MC-DNA and virtually eliminates contamination with MP or PP fragments.
  • the circular DNA molecule be in superhelical form. This superhelical status is not present after circularization with ligase. Therefore, this must be subsequently produced by gyrase treatment of circular MC.
  • Gyrase which is commercially available in recombinant form, is a type II topoisomerase which, in the presence of ATP, promotes the introduction of negative superhelical structures in DNA causes.
  • Step (e) therefore comprises contacting the circular DNA vector of step (d) with a gyrase under conditions where the vector is twisted, e.g. in the presence of ATP.
  • Step (e) is conveniently carried out in vitro, i. performed on an isolated preparation of the DNA vector. The reaction time can be varied to obtain preparations with different degrees of twist.
  • the reaction can be carried out according to the instructions of the manufacturer for the application of gyrase. After introduction of the superhelical structures into the MC, they may be finally terminated by standard methods, e.g. purified from the reaction batch using commercial kits (e.g., QIAgen MidiPrep).
  • Step (e) involves the purification of the circular, super-helical DNA vectors by standard methods (precipitation, agarose gel electrophoresis followed by elution, Qiagen Qiaquick Nucleotide Removal Kit, etc.) for the removal of by-products from the enzymatic gyrase reaction.
  • kits containing restriction enzymes, a ligase and a gyrase for carrying out the method according to the invention.
  • the kit according to the invention preferably comprises a restriction endonuclease. In another preferred embodiment, no endonuclease is included. More preferably, a restriction endonuclease comprises simultaneous absence of an exonuclease.
  • the kit comprises a guide for carrying out the method according to the invention.
  • Yet another object of the invention is a preparation of a DNA vector, in particular a MiniCircle DNA vector in superhelical form characterized by the absence of by-products, in particular linear or circular miniplasmid and / or parental plasmid.
  • the preparation contains no reference to the above-mentioned after PCR.
  • By-products The PCR reaction is not part of the MC production process but represents a detection method for contaminations by parent and miniplasmide, which makes it possible to detect the greater purity of the present invention in vitro generated MC preparations against recombinations in a conventional manner prepared MC preparations.
  • the sequence-specific primers In order to detect PCR-contaminating parental plasmids, the sequence-specific primers must be chosen such that one of the two oligonucleotides binds in the region of the heterologous backbone of the parental plasmid while the corresponding primer is located in the region of the mini-circle. In this arrangement of the oligonucleotides, only an amplification of the corresponding fragment occurs when parental plasmid occurs in the MC preparation. By means of a second PCR also contaminating miniplasmides can be found. Both must PCR primers are in the region of the heterologous backbone of the original parental plasmid.
  • this may be derived either from miniplasmids or the parent plasmid. If the first PCR was negative for parental plasmid, then the amplicon of the second PCR is due to miniplasmide. If both PCR reactions are positive, no clear statement as to the type of by-products is possible.
  • the in vitro produced MiniCircles have specifically controllable superhelical structural components.
  • the resulting predictability of the composition of the in vitro MC preparation is clearly superior to the random composition of circular DNA molecules obtained from bacteria by site-specific recombination. This superiority has substantial consequences, in particular for the use of therapeutic vectors in clinical applications.
  • FIG. 1 Plasmid map of the MC parental plasmid "pEpi-eGFP M18 antiHLC” and of the recombination products.
  • the parental plasmid contains all the units necessary for a working plasmid, such as Origin of Replication (oh, in this case between HSV TK polyA and the following FRT site, not shown) and antibiotic resistance (Neo / Kana).
  • Origin of Replication ovals
  • antibiotic resistance Neo / Kana
  • Critical to the production of MC vectors by the usual method by means of sequence-specific recombination is the presence of the two FRT sequences, which serve as targets for the FLP Recombinase.
  • the FLP-induced recombination of these two sequences against each other leads to constriction of two independent circular DNA molecules.
  • MiniPlasmid One of these carries the information for the important functions in bacteria and will therefore referred to as MiniPlasmid.
  • MiniPlasmid The second molecule no longer contains any functional bacterial sequences but only carries the information specific to the vector and thus represents the MiniCircle.
  • Figure 2 Comparison of the "in iro" mini-circle with the miniCircle produced by site-specific recombination in E. coli EL250 using a 1% agarose gel.
  • the in vitro MC was obtained by restriction with the enzyme XbaI and subsequent re-ligation with a T4 ligase from the PP. Subsequently, the ligated DNA (1 pg each) for 30 min. (Lane 1), 2 h (lane 2) or 5 h (lane 4) treated with 1 U DNA gyrase.
  • the "EL250" MC was obtained by site-specific recombination in E. coli EL250 after induction with 0.3% L-arabinose (lane 3)
  • the in vitro MC and the "EL250" MCs have the same in a 1% agarose gel Running behavior, ie that super-helical structures were introduced into the ligated MC DNA with the aid of DNA gyrase.
  • i.v. in wfro-MiniCircle
  • EL250 MiniCircle, produced by site-specific recombination in E. coli EL250
  • MC MiniCircle
  • PP parental plasmid
  • MP miniplasmid
  • FIG. 3 Separation of different ccc plasmids on a 0.8% chloroquine agarose gel
  • the plasmids pMAXGFP (LONZA), CMV-GFP parental plasmid and pEpi-delCM18opt (Rentschier Biotechnologie) were used.
  • the plasmids pMAXGFP (LONZA), CMV-GFP parental plasmid and pEpi-delCM18opt were used.
  • Agarose gel contained 2.5 ⁇ g mL- 1 chloroquine and gel-run for 15 h
  • FIG. 4 Separation of different amounts of the ccc plasmid pEpidel CM18opt on a 0.8% chloroquine agarose gel.
  • the DNA was separated for 15 h at 2.5 V cm -1 and the gel contained 2.5 [ig mL -1 chloroquine.
  • the series 1-6 contain different amounts of ccc DNA, the series 7 contains the linearized plasmid.
  • B The band patterns were recorded with the program ImageJ. It becomes clear that the application of a quantity of 100 ng of DNA is sufficient for the evaluation of the band patterns. With prolonged exposure even 50 ng can be evaluated (data not shown).
  • FIG. 5 Comparison of the twist of the "in v fro" miniCircle with the miniCircle produced by site-specific recombination from the plasmid pEpi-delCM18opt
  • Lane 1 The in vitro MiniCircle was prepared by restriction digestion of the parental plasmid with the enzymes XbaI and BstBI and subsequent ligation (T4 ligase) (oc). It can be seen that the ligation is not complete, some of the DNA remains linearized. Furthermore, concatemers arise from two or more DNA pieces. Lane 2: The gyrase and the gyrase buffer were added directly to the ligation batch (1 ⁇ g DNA). It can be seen that no twist has taken place. Lane 3: The ligation was first purified (QIAGEN PCR Purification Kit), then 1 ⁇ ligated DNA was treated with 5 U gyrase for 2 h. Lane 4: The MiniCircle was prepared by site-specific recombination. This was induced in E. coli EL250 by means of a genome-encoded FLP recombinase by L-arabinose.
  • (B) Lanes 3 and 4 from (A) were enlarged and displayed inverted here.
  • the site-specific recombination MC (lane 4) shows the expected banding pattern.
  • the in vitro MC (lane 3) also shows the band pattern, but one band is particularly pronounced.
  • (C) The signals were recorded with the program ImageJ and are marked with arrows. In track 3, the significant band signal mentioned in (B) can be seen (red arrow).
  • linear linearized DNA
  • oc open circle DNA
  • ccc supercoiled DNA
  • U unit
  • EL250 MC produced by site-specific recombination
  • MC MiniCircle
  • FIG. 6 Checking the purity of the generated MiniCircle by PCR and 1% agarose gel
  • a piece was PCRed in the miniplasmid region (see Linearized Vector Map B, PCR 1) and via an FRT site (see linearized vector map B, PCR 2) amplified. In each case 10 ng of template DNA was used. If an amplificate is generated in PCR 1, if the sample contains either miniplasmid or parental plasmid, an amplificate is generated in PCR 2, the sample contains parental plasmid, since in this PCR a primer lies in the MiniCircle region and a primer in the miniplasmid region.
  • C1 In the sample with the miniCircle (EL250 MC) produced by site-specific recombination, an amplificate was produced, in the sample with the // 7-w ' f / -MiniCircle no amplificate was produced.
  • C2 An amplicon was also created on the EL250 MiniCircle.
  • PP Parental plasmid
  • MC minicircle
  • EL250 MC MiniCircle, which was produced by site-specific recombination in E. coli strain EL250.
  • FIG. 7 Sequencing of the "in fro" mini-circle from pEpi-delCM18opt
  • superhelical MC could be successfully produced in vitro, without relying on the use of sequence-specific recombinases or specific bacterial strains to replicate the PP and then induce MC production.
  • a PP pEpi-eGFM18 anti HLC
  • MC MC
  • MP induced, sequence-specific recombination
  • the semi-synthetic MiniCircle DNA vectors described in this application were prepared according to the method described in more detail here:
  • the respective plasmid DNA of the clones was examined by restriction digestion and sequencing for a correct base sequence. Long-term storage of the correct clones was achieved by mixing a 5 ml overnight culture with 87% glycerol in the ratio 1: 1 and storage at -20 ° C (Glycerol stock).
  • the culture at 6000 xg for 15 min. centrifuged.
  • the preparation of the plasmid DNA was carried out with a QIAGEN plasmid kit according to the manufacturer's instructions.
  • the restriction digest was separated by gel electrophoresis (1% agarose gel). After gel-run, the DNA in the gel was stained with methylene blue and the gel slice cut with the linearized MiniCircle DNA with a scalpel. The recovery of the MiniCircle from the gel was done with the QIAGEN Gel Extraction Kit according to the manufacturer's instructions.
  • the linearized MiniCircle DNA was religated by T4 ligase at 16 ° C for 16 h.
  • the purification of the ligated DNA from the ligation mixture was carried out after agarose gel electrophoresis with the QIAGEN Gel Extraction Kit according to the manufacturer's instructions.
  • Transfer of the ligated MiniCircle to the ccc state was achieved by incubation with a DNA gyrase at 37 ° C. The incubation time was based on the desired degree of twist and was between 30 min. and 24 h. The batch was separated by gel electrophoresis (1% agarose). The DNA was stained using methylene blue and then the gel slice was cut out of the gel with the ccc MiniCircle DNA using a scalpel. The recovery of the MiniCircle from the gel was done with the QIAGEN Gel Extraction Kit according to the manufacturer's instructions.
  • the recombination caused by FIpE recombinase takes place between two so-called FRT sites, which in this case flank the MiniCircle sequence located in the parent plasmid.
  • the E. coli EL250 strain (2) contains the gene for the FIpE recombinase integrated in the genome. This gene is under the control of an L-arabinose-inducible promoter, ie the expression of this gene is first switched on by the addition of L-arabinose into the culture medium. The induction takes place in M9 minimal medium, since glucose or sucrose in the LB medium would interfere with the uptake of L-arabinose.
  • the parental plasmid consisting of MiniPlasmid and MiniCircle region, was electrotransformed into E.coli EL250. After selection of individual clones on agar plates (with appropriate selection medium), the respective plasmid DNA of the clones was examined by restriction digestion and sequencing for a correct base sequence. Long-term storage of the correct clones was achieved by mixing a 5 ml overnight culture with 87% glycerol in the ratio 1: 1 and storage at -20 ° C (glycerol stock).
  • the culture at 6000xg for 15 min. centrifuged.
  • the preparation of the plasmid DNA was carried out with a QIAGEN plasmid kit according to the manufacturer's instructions.
  • the starting volume of the bacterial culture was 50 ml in both cases.
  • the yield of MC DNA based on the starting volume of the bacterial culture in the process according to the invention is about 10-15 times higher than in the process by sequence-specific recombination.
  • the reasons for this are in particular the higher starting number of PP copies per bacterium in the bacterial strain used for the method according to the invention and in the low efficiency of the sequence-specific recombination (clearly visible on the strong PP band in the gel) compared to the ligation. 2.
  • the superhelical status of a DNA indicates to what extent the double helix is twisted in itself again. This "twisting state" is considered critical to the efficiency of DNA vectors for their ability to transform eukaryotic cells with significant effect on stability of expression and integration into the host cell genome.
  • the site-specific recombination generated in E. coli and the in vitro MC are compared in terms of their band pattern to demonstrate the suitability of the gyrase in generating ccc-DNA in vitro to obtain the various numbers of twists.
  • Another advantage of the new method is that the quality of twisting of the in vitro MC can be directly adjusted by the amount of gyrase used and the incubation time.
  • a large amount of gyrase (5 U) was used and a long incubation time was chosen to give a uniform To obtain a band pattern that reflects a uniform distribution of different Verdreilungs caren (information from the gyrase manufacturer New England Biolabs: 1 U gyrase twists 0.5 pg DNA in 30 min.).
  • PCR1 - Detection of MiniPlasmid or Parental Plasmid 10 pmol of primer 3 (TTTTCTGCGCGTAATCTGCT) and primer 4 (GTAAAAAGGCCGCGTTGCT) were used per reaction. These were used with 10 ng of MiniCircle preparation or Parental Plasmid control DNA using RedTaq polymerase (Invitrogen) by the following program for the amplification of possible impurities:
  • the positive control used was the parental plasmid pEpi-delCM18opt corresponding to the MiniCircles.
  • the amplicon to be expected upon contamination of the preparation has a size of 602 bp.
  • PCR2 - detection of parental plasmid 10 pmol of primer 1 (GCATGCCATCATGACTTCAG) and primer 2 (CGAAACGATCCTCATCCTGT) were used per reaction. These were used with 10 ng of MiniCircle preparation or Parental Plasmid control DNA using RedTaq polymerase (Invitrogen) by the following program for the amplification of possible impurities:
  • the positive control used was the parental plasmid pEpi-delCM18opt corresponding to the minicircles.
  • the amplicon to be expected upon contamination of the preparation is 876 bp in size.
  • MiniCircle produced by the classical method in E. coli EL250 contains impurities with parental plasmid and possibly also miniplasmid.
  • the in vitro minicircle produced by the new method no longer has DNA contaminants with MP or PP. 4. Control for the correct assembly of the in vitro MC by the ligase
  • a partial sequencing of the in vitro MC was used to investigate whether it also corresponds to the MC generated by site-specific recombination with regard to its sequence. To this end, the region of the FRT site resulting from recombination was sequenced (FIG. 7), the separation of MC and MP initially being carried out by the restriction enzyme XbaI, followed by religation by circularization of the MC fragment to the desired in vitro MC.
  • the partial in vitro MC sequencing data revealed that the FRT region of the in vitro MC corresponds to the FRT region of the vector map. Restriction with Xbal followed by ligation resulted in a new FRT site, as in site-specific recombination. This impressively demonstrates the superiority of the new method. Re-ligation of the linear MC fragments to circular in vitro MC is expected to be safe.
  • the MC produced by the in vitro method are characterized by a significantly greater purity and the manufacturing process by a significantly higher yield based on the starting volume of the bacterial culture.
  • DNA changes in response to topological perturbation of plasmids in E. coli and SV40 in vitro, in nuclei and in CV-1 cells, Nucleic Acids Research, Vol. 15 Num. 13, 5105-5124, 1987
  • Patent Application 20070031378 (12) Mayrhofer Peter et al. 2008, Minicircle-DNA production by site specific recombination and protein-DNA interaction chromatography; The Journal of Gene Medicine, Vol. 10, 1253-1269

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé et des réactifs pour la production de vecteurs d'ADN, en particulier des vecteurs d'ADN minicercles (MC) sous forme superenroulée. L'invention concerne en outre des préparations à haut degré de pureté de vecteurs d'ADN circulaires, en particulier de vecteurs d'ADN MC.
EP11767977.9A 2010-10-05 2011-10-04 Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides Withdrawn EP2625275A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP11767977.9A EP2625275A1 (fr) 2010-10-05 2011-10-04 Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP10186568A EP2439276A1 (fr) 2010-10-05 2010-10-05 Procédé de fabrication semi-synthétique de vecteurs d'ADN minicercle à pureté élevée à partir de plasmide
PCT/EP2011/067280 WO2012045722A1 (fr) 2010-10-05 2011-10-04 Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides
EP11767977.9A EP2625275A1 (fr) 2010-10-05 2011-10-04 Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides

Publications (1)

Publication Number Publication Date
EP2625275A1 true EP2625275A1 (fr) 2013-08-14

Family

ID=43733185

Family Applications (2)

Application Number Title Priority Date Filing Date
EP10186568A Withdrawn EP2439276A1 (fr) 2010-10-05 2010-10-05 Procédé de fabrication semi-synthétique de vecteurs d'ADN minicercle à pureté élevée à partir de plasmide
EP11767977.9A Withdrawn EP2625275A1 (fr) 2010-10-05 2011-10-04 Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP10186568A Withdrawn EP2439276A1 (fr) 2010-10-05 2010-10-05 Procédé de fabrication semi-synthétique de vecteurs d'ADN minicercle à pureté élevée à partir de plasmide

Country Status (8)

Country Link
US (1) US20130203121A1 (fr)
EP (2) EP2439276A1 (fr)
AU (1) AU2011311637A1 (fr)
BR (1) BR112013009244A2 (fr)
CA (1) CA2813664A1 (fr)
IL (1) IL225518A0 (fr)
SG (1) SG189272A1 (fr)
WO (1) WO2012045722A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201307075D0 (en) 2013-04-19 2013-05-29 Mayrhofer Peter Plasmid for minicircle production
PT107663B (pt) * 2014-05-28 2019-02-26 Inst Superior Tecnico Processo para a purificação de minicírculos
CA3151464A1 (fr) 2019-09-18 2021-03-25 Bruce C. SCHNEPP Vecteurs d'adn synthetiques et procedes d'utilisation

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0108968D0 (en) 2001-04-10 2001-05-30 Imp College Innovations Ltd Methods
US20040191799A1 (en) * 2003-03-25 2004-09-30 Hyman Edward David Method for plasmid preparation by conversion of open circular plasmid
US7510856B2 (en) * 2003-03-25 2009-03-31 Hyman Edward D Method for plasmid preparation by conversion of open circular plasmid to supercoiled plasmid
AT412400B (de) 2003-05-08 2005-02-25 Mayrhofer Peter Mag Dr Minicircle-herstellung
US7622252B2 (en) 2005-06-10 2009-11-24 Baylor College Of Medicine Generation of minicircle DNA with physiological supercoiling
CN106434725B (zh) 2008-07-03 2019-08-20 小利兰·斯坦福大学托管委员会 小环dna载体制剂及其制备方法和使用方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2012045722A1 *

Also Published As

Publication number Publication date
EP2439276A1 (fr) 2012-04-11
CA2813664A1 (fr) 2012-04-12
WO2012045722A1 (fr) 2012-04-12
BR112013009244A2 (pt) 2016-07-26
AU2011311637A8 (en) 2013-05-02
AU2011311637A1 (en) 2013-04-18
US20130203121A1 (en) 2013-08-08
SG189272A1 (en) 2013-05-31
IL225518A0 (en) 2013-06-27

Similar Documents

Publication Publication Date Title
DE60221801T2 (de) Cpg-freie synthetische gene und bakterielle plasmide
DE3546806C2 (fr)
DE69031172T2 (de) Modifikation der endogenen genexpression mit hilfe eines regulatorischen elements mittels homologe rekombination
DE69027526T3 (de) Herstellung von proteinen mittels homologer rekombination
DE68926892T2 (de) Verfahren zur Herstellung von Zellen, die stabil integrierte fremde DNS mit hoher Kopiezahl enthalten, durch dieses Verfahren hergestellte Zellen und Verwendung dieser Zellen zur Herstellung von durch diese fremde DNS kodierten Polypeptiden
DE69637156T2 (de) Dna-molekül, herstellung und verwendung in der gentherapie
DE60222857T2 (de) Concatemere unterschiedlich exprimierter multipler gene
DE102013220859B4 (de) Minicircles mit viralen Expressionskassetten und ihre Verwendung zur Transformation von Zellen zur Erzeugung rekombinanter Viren oder viraler Genvektoren
DE212015000061U1 (de) CRISPR-ermöglichtes Multiplex Genom Engineering
DD209476A5 (de) Verfahren zur stabilisierung und selektierung von wirtszellen, die rekombinierende dna enthalten
WO1999047536A2 (fr) Procede permettant de faire la synthese de molecules d'acide nucleique
DE102011118018B4 (de) Minicircles mit Transpositionskassetten und ihre Verwendung zur Transformation von Zellen
DE69013811T2 (de) Verfahren zur Herstellung von antiviralem Protein unter Benützung von E.coli-Transformant, das Gen, das für dieses Protein kodiert und E.coli-Vektor benützt in diesem Verfahren.
DE3382607T2 (de) Plasmide mit konditionalem unkontrolliertem replikationsverhalten.
EP2625275A1 (fr) Procédé de production par semi-synthèse de vecteurs d'adn "minicercles" à haut degré de pureté à partir de plasmides
AT412400B (de) Minicircle-herstellung
EP1025253A1 (fr) Selection par gene marqueur positif ou negatif lors d'une recombinaison homologue
DE3877337T2 (de) Verfahren zur mutagenese mittels oligonukleotid-gerichteter reparatur eines strandbruchs.
DE3782365T2 (de) Verfahren fuer die mutagenese durch eine oligonukleotidgeleitete reparatur eines strangbruchs.
DE60202196T2 (de) Orientationsgerichtete konstruktion von plasmiden
EP2130918A1 (fr) Procédé de production d'une bibliothèque de variantes de séquences d'ADN
EP2499253A2 (fr) Micro-organismes présentant une activé de sucrose mutase accrue
DE3908897C2 (fr)
EP1352074B1 (fr) Procede permettant la production de multimeres d'acide nucleique homogenes destines a des compositions pharmaceutiques
DE112022001365T5 (de) In vivo dna zusammenbau und analyse

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130503

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140502