EP2207880A1 - Caténates pour l'immunostimulation - Google Patents

Caténates pour l'immunostimulation

Info

Publication number
EP2207880A1
EP2207880A1 EP08847608A EP08847608A EP2207880A1 EP 2207880 A1 EP2207880 A1 EP 2207880A1 EP 08847608 A EP08847608 A EP 08847608A EP 08847608 A EP08847608 A EP 08847608A EP 2207880 A1 EP2207880 A1 EP 2207880A1
Authority
EP
European Patent Office
Prior art keywords
tumors
molecule
group
combination agent
agent according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP08847608A
Other languages
German (de)
English (en)
Inventor
Matthias Schroff
Burghardt Wittig
Manuel Schmidt
Janine LÖHR
Christiane Kleuss
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mologen AG
Original Assignee
Mologen AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mologen AG filed Critical Mologen AG
Priority to EP08847608A priority Critical patent/EP2207880A1/fr
Publication of EP2207880A1 publication Critical patent/EP2207880A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/17—Immunomodulatory nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy

Definitions

  • the invention relates to a multimeric, non-coding nucleic acid molecule for modulating the activity of the human or animal immune system and a production method thereof and a vaccine containing the multimeric, non-coding nucleic acid molecule, wherein multimeric, non-coding nucleic acid molecules as non-coding Nucleic acid molecules can be understood, which consist of at least two concatenated molecules (dimer) of these non-coding nucleic acid molecules.
  • pathogen-associated molecular pattems PAMPs
  • the reactions that are different for different cell types include the secretion of cytokines (eg IL-1 , IL-6, TNF- ⁇ ) and chemokines (eg IL-8 / CXCL8, MIP-1 ⁇ / ⁇ , MCP-1), activation of effector mechanisms (phagocytosis, respiratory discharge, release of bactericidal substances or lytic granules), expression of costimulatory molecules (CD80, CD86) as well as enhanced expression of MHC molecules
  • cytokines eg IL-1 , IL-6, TNF- ⁇
  • chemokines eg IL-8 / CXCL8, MIP-1 ⁇ / ⁇ , MCP-1
  • activation of effector mechanisms phagocytosis, respiratory discharge, release of bactericidal substances or lytic granules
  • costimulatory molecules CD80, CD86
  • CpG-ODN CpG oligonucleotides
  • PAMPs pathogen-associated molecular patters
  • Immunostimulatory nucleic acid sequences (ISS) carrying the designated CpG ODN are only a few bases long and contain no open reading frames for the expression of proteins.
  • the ISS are linear nucleic acid molecules whose ends are open (free hydroxyl or phosphate group) or are protected by synthetic groups.
  • the strong stimulation of the cellular immune response makes it possible to influence control circuits which, without intervention, do not lead to satisfactory immune activity for the patient.
  • this immunostimulatory DNA of the prior art has some disadvantages with respect to the modulation of the activity of the human or animal immune system. It is not always possible to modulate, in particular activate, the activity of the human or animal immune system in the desired strength.
  • the molecules according to WO 01/07055, as shown for example in FIG. 1 or in FIG Claim 11 are composed of several Deoxyribonukleotidresten which form a partially single-stranded dumbbell-shaped and covalently closed DNA molecule, which is referred to in the sense of the present invention as a monomer.
  • Monomer according to the invention therefore does not mean a structure of z.
  • a single base but means a closed dumbbell-shaped formation consisting of oligonucleotides, which in turn consist of several deoxyribonucleotide residues (see FIG. 1 or claim 11 of WO 01/07055).
  • the object of the present invention is to provide suitable immunostimulatory DNA molecules which are capable of triggering an improved immune response, as well as a process for their preparation and vaccines containing these immunostimulatory DNA molecules.
  • immune stimulation means that the mediator and effector cells of the immune system, ie in particular the currently known thymocytes with helper function and the cytotoxic thymocytes, B cells and so-called NK (natural killer) cells, are macrophages and monocytes as well as dendritic cells and their precursors, as well as cell populations with functions within the immune system which have not hitherto been unclear in their function, are stimulated by the use of nucleic acid molecules for proliferation, migration, differentiation or activity.
  • Immunomodulation means that in addition to general stimulation in the above-defined sense, the nature or character of an immune reaction is also affected, whether it is an immune reaction that is developing or maturing, or an already established reaction in the immune system their character is changed.
  • the present invention solves the problem by providing an oligomeric or multimeric non-coding nucleic acid molecule. It was quite surprising that dimers, trimers, pentamers or multimers of covalently closed immunostimulatory DNA have a surprisingly improved effect over the prior art molecules.
  • the multimeric molecule according to the invention can be prepared by a process comprising the following steps:
  • Alcohol precipitation or lyophilization in particular in the presence of MgCl 2 , until a dry residue is obtained, and then re-suspension in a buffer solution,
  • the molecule according to the invention can be characterized by the method of its preparation.
  • the manufacturing process is used to define the product.
  • the product defined by the method is novel over the molecules described in the prior art, such as e.g. Example of WO 01/07055.
  • the molecule which is described and claimed via the preparation route is defined by the physical and functional properties which result from the application of the method of its preparation to the person skilled in the art.
  • the representation of the molecule through the manufacturing process is particularly accurate, as labeling by structural features is impractical.
  • the claimed method can be carried out successfully, since all information necessary for the person skilled in the art is disclosed.
  • the process for the preparation of the product differs from the known processes of the prior art.
  • the new method provides a product other than that described in the prior art.
  • the molecules according to the invention are surprisingly better suited for immune stimulation than those of the prior art.
  • the molecules of the invention may also be prepared by the provision of 5'-phosphorylated oligodeoxyribonucleic acids in water when purified by an equivalent method to polyacrylamide gel electrophoresis. In particular by combined purification with HPLC followed by FPLC. It is known to those skilled in the art that an analogous degree of purification to a PAGE degree of purification can be achieved by the combination of several high performance purification methods such as HPLC or FPLC.
  • the sequence of the individual process steps leads to a multimeric molecule which is composed of monomers of stable chain form and consists of at least 48 nucleotides (2 monomers of 24 nucleotides).
  • the molecular chain formed contains no free 5 'or 3' ends.
  • the monomers forming the molecule according to the invention by intermolecular linking are characterized as follows:
  • CG motifs which are recognized by cellular structures
  • a molecule according to the invention consists of at least two monomers and is formed conformationally during the abovementioned synthesis.
  • the monomers combine to form chains of two, three, four, five and more intermolecularly.
  • the molecule according to the invention can also be defined as catenate.
  • the molecule according to the invention is a catenated molecule in which at least one loop constituent is linked to another loop constituent of another molecule. which is preferably joined together, so that preferably at least one, more preferably a plurality of chain-like elements are present.
  • a plurality of molecules hybridize with one another in a self-complementary region of the loop, resulting in a product according to the invention.
  • Another multimeric structure is that of the G-Quartet. Due to the orientation of its four H-bonding sites, guanine is able to form a cyclic base quartet with eight hydrogen bonds through guanine-guanine base pairing. A DNA sequence containing several consecutive guanosine nucleotides is thus able to form a higher molecular weight helical structure in which the guanine bases have a strong planarity with a special stacking interaction. Depending on the location, number and distribution of guanosine nucleotides in the sequence, different G structures can be formed.
  • the molecules according to the invention are capable of better modulating, in particular activating, the activity of the human or animal immune system than molecules of the prior art.
  • the molecules of the prior art are the known immunostimulatory nucleic acid sequences which act only as monomeric, dumbbell-like structures. Most known, immunomodifying short oligodeoxyribonucleic acid sequences contain an unmethylated cytosine-guanosine motif. The physiological action of these nucleic acids is understood as immunomodulation or modulation of the activity of the immune system in the sense of the invention.
  • various molecules are disclosed, which consist of a stem and at least one loop, as disclosed for example in Figures 1, 2 and 3. For the purposes of the invention, these molecules are a monomer structure.
  • oligomer is used several times in science with different meanings.
  • An oligomer may, for example, be a longer nucleic acid sequence, but also a structure which consists of several identical or similar molecules and lead to a larger nucleic acid. semblat was put together.
  • oligomer is to be understood as meaning molecule chains which consist of 2 to 5 monomers and form so-called dimers to pentamers. This corresponds to molecular weights corresponding to Fig. 1 up to 20OkDa.
  • multimers would be, for example, several stem-loop structures according to EP 1 196 178, which were combined with several identical or similar stem-loop structures to form a higher structure (a multimer).
  • Multimers are all molecules of the invention which are greater than 20Oda.
  • a stable intermolecular linkage of the ligation products takes place during the ligation.
  • An oligomer / multimer thus formed is conformally formed during the synthesis only under special reaction conditions. It is not possible to make the multimers from monomers once formed.
  • the monomer structures forming the multimer are not covalently linked to one another, but are linked together as catenate structures.
  • oligomer once formed (the person skilled in the art recognizes that the feature oligomer in connection with the multimerization does not have the meaning of oligodeoxyribonucleic acid sequence) or multimer is stable against heat and denaturing agents, which means that the single-molecule structures are no longer simple physical means can be obtained from the molecules of the invention. It is surprising that such oligomeric and multimeric structures, which have improved and unobvious properties compared to the monomer structures, can be obtained by comparatively simple process steps.
  • the assembly can be obtained, for example, by centrifugation, gel electrophoresis or column chromatography, by means of which highly complex structures, such as, for example, dimers, pentamers or others, can be detected and recovered, which show surprisingly better properties in the modulation of the immune system than the single-molecule structures (see FIG. 3 and 4, 5). This is shown by the fact that they lead to a different form of immune stimulation in the laboratory organism or in humans.
  • the multimer or catenate according to the invention is characterized in that the oligodeoxyribonucleic acid sequence used in the method comprises the following sequences: a) agctgtagcagcttcgggggtatcgttcttcgtgtcgttcttagctgctacagctgcagctgtagcagcttcggggggtatcgttcttcgtgtcgttcttagctgctacagctgctgctgtagcagcttcggggggtatcgttcttcgtgtcgttcttagctgctacagctgc (SEQ ID NO.1) or
  • the molecule comprises a partially single-stranded, covalently closed chain of deoxyribonucleotides.
  • the partially single-stranded covalently closed chain of deoxyribonucleotides is responsible for the molecule being effective over a longer period in the target organism into which it is introduced.
  • the molecule comprises the base sequence N 1 N 2 CGN 3 N 4 , where N 1 N 2 is an element from the group GT, GG, GA, AT or AA, N 3 N 4 Element from the group CT or TT, and C is deoxycytosine, G is deoxyguanosine, A is deoxyadenosine and T is deoxythymidine.
  • the base sequence N 1 N 2 CGN 3 N 4 is positioned in the single-stranded region of the closed chain of deoxyribonucleotides.
  • these preferred molecules show a very effective effect in stimulating the immune system.
  • the molecule according to the invention does not consist exclusively of a deoxyribonucleic acid molecule, wherein the deoxyribonucleic acid molecule,
  • N 1 N 2 is an element from the group GT, GG 1 GA, AT or AA
  • N 3 N 4 is an element from the group CT or TT
  • C is desoxycytosine
  • G is deoxyguanosine
  • A is deoxyadenosine
  • T is deoxythymidine
  • GAGAGAAC SEQ ID NO: 9
  • c) contains a deoxyribonucleic acid sequence of the base sequence AACGTTCTTCGGGG CGTT (SEQ ID NO: 11).
  • the multimender according to the application may comprise said monomer.
  • the molecule according to the invention is linked to one or more substituents by covalent bonding.
  • substituents may be, for example, peptides, proteins, saccharides, antigenic structures, lipids, DNA and / or RNA.
  • the invention relates in addition to the o. G. Process steps for the preparation of a product, also a process for the preparation of the molecule, comprising the following steps:
  • the oligodeoxyribonucleic acid sequence is provided after precipitation or lyophilization in the presence of magnesium chloride, the T4 DNALigase is added and the resulting reaction mixture is incubated at 37 ° C for at least 10 minutes, preferably for at least 30 minutes, the oligodeoxyribonucleic acid prior to its precipitation or Lyophilization is purified by HPLC followed by FPLC.
  • Precipitation or lyophilization in the presence of magnesium chloride achieves the same results with respect to the production of multimers, especially when the oligodeoxyribonucleic acid has been purified by polyacrylamide gel electrophoresis, or with a combination of HPLC and FPLC.
  • the catenate according to the invention preferably consists of 1 + x individual constituents, preferably partially single-stranded, dumbbell-shaped, covalently closed chains of deoxyribonucleotides, wherein the individual constituents have a stem region and a loop region, the stem region having at least 8 deoxyribonucleotides and the loop region min 4 deoxyribonucleotides, and in the loop range 1 to 6 CG motifs are present and x is an element of the set integers.
  • the invention also relates to a combination agent which comprises at least one molecule according to the invention and a chemotherapeutic agent.
  • the agent according to the invention is combined with known chemotherapeutic agents and the combination agent is preferred, for example.
  • B. is used against tumors.
  • the monomers according to WO 01/07055 have an immunostimulating effect and it was also known that chemotherapeutics have an effect on tumors
  • the polymers or mulitmers to be formed from the monomers in combination with the chemotherapeutic agents cause an effect that goes beyond aggregation. Between the elements of the combination according to the invention a functional interaction takes place, which leads to a synergistic effect.
  • the elements combined in the combination agent according to the invention have an effect on the uniform objective of controlling pathogens, in particular of tumors.
  • the combination agent according to the invention not every element produces only isolated individual results, but a surprising effect is achieved by the interaction of the individual elements.
  • the combination agent in the sense of the invention can also be present as a kit in which the molecule according to the invention and the chemotherapeutic agent according to the prior art are present separately.
  • the at least two constituents of the kit can be administered simultaneously or with a time delay.
  • the administration of the combination agent according to the invention can activate the immune system in such a way that a subsequent application of a chemotherapeutic agent can develop its effect particularly effectively.
  • the chemotherapeutic agent it is also possible for the chemotherapeutic agent to be applied first and then, at a later time, the molecule according to the invention to be introduced into the human or animal organism.
  • the molecule according to the invention for certain tumors, simultaneous administration of the molecule and the chemotherapeutic agent according to the invention is preferred.
  • the chemotherapeutic agent is selected from the group comprising antibodies, alkylating agents, platinum analogues, intercalents, antibiotics, mitosis inhibitors, taxanes, topoisomerase inhibitors, antimetabolites and / or L-asparaginase, hydroxycarbamide, mitotanes and / or amanitines.
  • the alkylating agents are selected from the group comprising
  • the alkylating agents are particularly effective on tumors, thereby inhibiting their growth.
  • the platinum analogues are selected from the group comprising:
  • intercalcents are selected from the group comprising:
  • Actinomycin D (dactinomycin) and / or
  • the mitosis inhibitors may be selected from the group comprising: - Alkaloids of Vinca rosea, in particular
  • the taxanes are selected from the group comprising:
  • topoisomerase inhibitors are selected from the group comprising:
  • the antimetabolites are selected from the group comprising:
  • Cytosine arabinoside (cytarabine) and / or
  • the invention also relates to a kit comprising the molecule according to the invention and the chemotherapeutic agent, optionally with information for combining the contents of the kit.
  • the invention also relates to a pharmaceutical agent which optionally comprises the molecule or the combination agent according to the invention with a pharmaceutically acceptable carrier.
  • the invention further relates to the use of the molecule, the combination agent or the pharmaceutical agent for the production of an agent for modulating a human or animal immune system or for modulating the activity of this immune system.
  • Modulation of the human or animal immune system is understood to mean any influence on the immune system which leads to the immune system in particular inhibiting tumors or cancer.
  • the modulation of the activity of the immune system can be understood synonymously or describes the activities of the immune system known to the person skilled in the art. tems, which are directed against tumors and which are surprisingly increased by the agents according to the invention in their activity.
  • the modulation is thus in particular a stimulation or increase of effects of the immune system or of the immune system itself.
  • the agents according to the invention can be used to stimulate the T cell-mediated immune response but also the T cell independent immune response. In a preferred embodiment of the invention, this process may include proliferation of B cells or B cell activation.
  • the modulation of the activity of the immune system is stimulated in such a way that cytokines are secreted or released more intensely. It may be particularly preferred for the molecule or combination agent according to the invention to be used as an adjuvant in therapeutic or prophylactic vaccination.
  • the agents according to the invention can be used particularly effectively for the treatment of a cell growth disorder, wherein in a preferred embodiment the cell growth disorder is a tumor disease.
  • the tumor disease is preferably a disease selected from the group comprising tumors of the ear, nose and throat region comprising tumors of the internal nose, the sinuses, the nasopharynx, the lips, the oral cavity, the oropharynx, the larynx, of the hypopharynx, ear, salivary and paragangliomas, tumors of the lung comprising non-small cell lung carcinomas, small cell lung carcinomas, tumors of the mediastinum, tumors of the gastrointestinal tract comprising tumors of the esophagus, stomach, pancreas, liver, gallbladder and biliary tract, small intestine , Colon and rectal cancers and anal carcinomas, genitourinary tumors including kidney, ureteral, bladder, prostate, urethra, penile and testicular tumors, gynecologic tumors including tumors of the cervix, vagina, vulva, corpus carcinoma, malignant trophoblast n disease,
  • Neoplasms myelodysplastic syndromes, paraneoplastic syndromes, metastases without known primary tumor (CUP syndrome), peritoneal carcinomatosis, immunosuppression-related malignancy including AIDS-related malignancies such as Kaposi's sarcoma, AIDS-associated lymphomas, AIDS-associated lymphomas of the central nervous system, AIDS associated Hodgkin's disease and AIDS-associated anogenital tumors, transplant-related malignancies, metastatic tumors including brain metastases, lung metastases, liver metastases, bone metastases, pleural and pericardial metastases, and malignant ascites.
  • AIDS-related malignancies such as Kaposi's sarcoma
  • AIDS-associated lymphomas such as Kaposi's sarcoma
  • AIDS-associated lymphomas AIDS-associated lymphomas of the central nervous system
  • AIDS associated Hodgkin's disease and AIDS-associated anogenital tumors transplant-related malignancies
  • oligodeoxynucleotides of the sequence CCTAGGGGTTAC- CACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTTAGGTGGTAACCCCTAGGGGTTAC- CACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTTAGGTGGTAACC (SEQ ID NO. 12) were heated for 5 min at 90 0 C and then cooled on ice to allow the formation of the hairpin structure. Self-complementary overhangs were ligated at a final concentration of 1 mg / ml DNA in the presence of T4 DNA ligase (0.1 U / ⁇ g ODN) at 37 ° C. for 24 h.
  • the oligodeoxyribonucleic acid sequence CCTAGGGGTTACCACCTTCATTGGAA- AACGTTCTTCGGGGCGTTCTTAGGTGGTAACC (SEQ ID NO: 13) at the concentration 1 mg / ml was mixed with 0.3M sodium acetate (pH 5.25), 10 mM MgCl 2 and 3 times Volume of ethanol abs. like. After centrifugation (4 ° C, 13,000 rpm) and the pellet washed once with 70% EtOH, the ODN was dried at 50 0 C for 10 min. Subsequently, the absorption in water (fc: 1 mg / ml).
  • the oligodeoxyribonucleic acid sequence CTAGGGGTTACCACCTACAAAAAAACGAAATTCGGGGCGAAGGGAGGTGGTAACCC (SEQ ID NO: 14) at the concentration of 1 mg / ml was extracted with 0.3M sodium acetate (pH 5.25), 10 mM MgCl 2 and 3 volumes of ethanol abs. like. After centrifugation (4 0 C, 13000rpm), the ODN was dried at 50 0 C for 10min. The pellet was inserted directly into the ligation mixture (0.5 U / ⁇ g ODN) and incubated for 60 min at 37 ° C.
  • the ligation mixture respectively the first lane, and the product after the T7 digestion, in each case the second lane, were applied. It shows a single band corresponding to a single molecule, the monomer (lane 6 after T7 digestion). Due to the small molecular size, the running speed is high and differs significantly from the oligomers prepared according to preparation route b) and were applied in lanes 1 and 2. There are many bands that are above the band for the single molecule and represent the di - pentamers. In comparison, the products prepared by preparation route c) are even larger and show a significantly shorter running distance in the gel, which corresponds to larger molecules, see lanes 3 and 4.
  • the molecules produced were separated on a 3% agarose gel. On the left side next to the gel image, the molecular weights of double-stranded DNA are resolved and assigned to the respective migration routes. To the right of the gel image are designated the high molecular weight products. In lanes 1-3 monomer is applied, which according to a) was produced. Where lane 3 shows the initial ODN. One recognizes a higher molecular structure (double band), which is destroyed by heating at the beginning of the manufacturing process. After ligation (lane 2) and T7 digestion (lane 1), a molecule increased to the starting ODN, which has a molecular weight of about 50 kDa and corresponds to a monomer.
  • Lane 4 again plots the starting ODN. Lane 5 ligation ligation and lane 6 ligation to T7 digestion. The preparation was carried out according to the conditions described under b) and c) for the preparation of oligomeric and multimeric molecules. This clearly shows that in addition to single molecules, the desired molecules according to the invention have also formed. Thus, at 10OkDa, a band corresponding to a dimer appears, that is, two monomer molecules linked together. The same can be said about tri-and tetramer.
  • peripheral blood mononuclear cells were obtained from whole blood or so-called "buffy coat".
  • the isolated cells were seeded in multi-well-plates.
  • the negative control consisted of unstimulated cells
  • the second was stimulated as a comparison with the monomers
  • the third with the oligomeric molecules
  • the fourth approach with the multimeric molecules.
  • the release of the cytokines interferon- ⁇ and interleukin 6 was determined by ELISA from the cell culture supernatant, see Fig. 4 and 5.
  • the stimulation of PBMCs with the oligo- and multimeric molecules compared to stimulation by monomeric single molecules achieved a doubling of INF-gamma secretion.
  • the multimeric molecules have a greater effect on stimulation compared to the oligomeric molecules.
  • Figure 5 shows IL-6 secretion as a result of stimulation. Here the difference between the molecules used is highly significant. While the monomers show a stimulation potential comparable to that of FIG. 4, that of the molecules according to the invention is many times higher.
  • the nucleic acid sequences are not heated prior to ligation and are present at the level of purification of polyacrylamide gel electrophoresis. This may be provided by itself or by HPLC purification followed by FPLC. The combination of HPLC and FPLC achieves an equivalent degree of purification to polyacrylamide gel electrophoresis. Subsequently, the sequences are lyophilized until a dry residue is obtained. Subsequently, a resuspension in buffer solution is carried out and there is an addition of a T4-DNAIigase followed by incubation at 37 ° C for 40 minutes. It turns out, surprisingly, that the obtained concatenates lead to an improved immune stimulation in mice.
  • chemotherapeutic agents antibodies, alkylating agents, platinum analogues, intercalcents, anti- biotics, mitotic inhibitors, taxanes, topoisomerase inhibitors, antimetabolites, L-asparaginase, hydroxycarbamide, mitotanes or amanitines.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Public Health (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Saccharide Compounds (AREA)

Abstract

L'invention concerne une molécule d'acides aminés multimère, non-codante, destinée à la modulation de l'activité du système immunitaire humain ou animal, ainsi qu'un procédé de fabrication de ladite molécule, et un vaccin contenant la molécule d'acides aminés multimère, non-codante. Par molécules d'acides aminés multimères, non-codantes, on entend des molécules d'acides aminés non-codantes composées d'au moins deux de ces molécules (dimère), ou des assemblages composés de plusieurs molécules d'acides aminés non-codantes.
EP08847608A 2007-11-07 2008-11-07 Caténates pour l'immunostimulation Withdrawn EP2207880A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP08847608A EP2207880A1 (fr) 2007-11-07 2008-11-07 Caténates pour l'immunostimulation

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP07075967A EP2058397A1 (fr) 2007-11-07 2007-11-07 Assemblât multimère destiné à la stimulation immunologique
EP08847608A EP2207880A1 (fr) 2007-11-07 2008-11-07 Caténates pour l'immunostimulation
PCT/EP2008/009618 WO2009059805A1 (fr) 2007-11-07 2008-11-07 Caténates pour l'immunostimulation

Publications (1)

Publication Number Publication Date
EP2207880A1 true EP2207880A1 (fr) 2010-07-21

Family

ID=38990155

Family Applications (2)

Application Number Title Priority Date Filing Date
EP07075967A Withdrawn EP2058397A1 (fr) 2007-11-07 2007-11-07 Assemblât multimère destiné à la stimulation immunologique
EP08847608A Withdrawn EP2207880A1 (fr) 2007-11-07 2008-11-07 Caténates pour l'immunostimulation

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP07075967A Withdrawn EP2058397A1 (fr) 2007-11-07 2007-11-07 Assemblât multimère destiné à la stimulation immunologique

Country Status (13)

Country Link
US (1) US20100303803A1 (fr)
EP (2) EP2058397A1 (fr)
JP (1) JP2011502492A (fr)
KR (1) KR20100087359A (fr)
CN (1) CN101883854A (fr)
AU (1) AU2008324384A1 (fr)
BR (1) BRPI0820388A2 (fr)
CA (1) CA2703983A1 (fr)
EA (1) EA201000769A1 (fr)
IL (1) IL205543A0 (fr)
MX (1) MX2010004998A (fr)
TW (1) TW200927148A (fr)
WO (1) WO2009059805A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2246433A1 (fr) * 2009-04-30 2010-11-03 Mologen AG Concatémères destinés à la modulation immunologique
US20130245102A1 (en) * 2010-10-12 2013-09-19 Research Foundation Of The City University Of New York Novel dna templates for small rna production in mammalian cells
CA2953216C (fr) 2014-06-04 2020-12-22 Exicure, Inc. Liberation polyvalente de modulateurs immunitaires par des acides nucleiques spheriques liposomaux pour des applications prophylactiques ou therapeutiques
LU92821B1 (en) 2015-09-09 2017-03-20 Mologen Ag Combination comprising immunostimulatory oligonucleotides
GB2542425A (en) * 2015-09-21 2017-03-22 Mologen Ag Means for the treatment of HIV
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
US11433131B2 (en) 2017-05-11 2022-09-06 Northwestern University Adoptive cell therapy using spherical nucleic acids (SNAs)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19935756A1 (de) * 1999-07-27 2001-02-08 Mologen Forschungs Entwicklung Kovalent geschlossenes Nukleinsäuremolekül zur Immunstimulation
EP1716234B1 (fr) * 2004-02-20 2013-10-02 Mologen AG Molecule d'acide nucleique substituee et non codante pour la stimulation immunitaire therapeutique et prophylactique chez l'homme et les animaux superieurs
WO2006015560A1 (fr) * 2004-08-09 2006-02-16 Mologen Ag Agent immunomodulateur associe a des mesures de chimiotherapie
EP2027266B1 (fr) * 2006-05-11 2010-12-22 Mologen AG Multimère pour l'immunostimulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2009059805A1 *

Also Published As

Publication number Publication date
BRPI0820388A2 (pt) 2014-10-14
WO2009059805A1 (fr) 2009-05-14
US20100303803A1 (en) 2010-12-02
TW200927148A (en) 2009-07-01
MX2010004998A (es) 2010-08-02
EA201000769A1 (ru) 2010-12-30
EP2058397A1 (fr) 2009-05-13
CA2703983A1 (fr) 2009-05-14
CN101883854A (zh) 2010-11-10
KR20100087359A (ko) 2010-08-04
JP2011502492A (ja) 2011-01-27
AU2008324384A1 (en) 2009-05-14
IL205543A0 (en) 2010-12-30

Similar Documents

Publication Publication Date Title
EP2246433A1 (fr) Concatémères destinés à la modulation immunologique
WO2009059805A1 (fr) Caténates pour l'immunostimulation
EP2027266B1 (fr) Multimère pour l'immunostimulation
DE69330724T2 (de) Antitumorzusammensetzungen enthaltend Taxanderivate
EP1716234B1 (fr) Molecule d'acide nucleique substituee et non codante pour la stimulation immunitaire therapeutique et prophylactique chez l'homme et les animaux superieurs
RU2468819C2 (ru) Новые синтетические агонисты tlr9
EP1214945B2 (fr) Methode et medicament destines a inhiber l'expression d'un gene donne
DE19935756A1 (de) Kovalent geschlossenes Nukleinsäuremolekül zur Immunstimulation
WO2007095976A2 (fr) Adjuvant sous forme d'acide nucléique modifié par un lipide
JP2009521218A (ja) 異なる長さのパリンドロームセグメントを含むパリンドローム免疫調節オリゴヌクレオチド（ｉｍｏ（ｔｍ））の免疫賦活作用
CN103415302A (zh) 调控基于toll-样受体的免疫应答的免疫调节寡核苷酸(iro)化合物
CN102300990A (zh) Tlr9的合成激动剂
WO2006015560A1 (fr) Agent immunomodulateur associe a des mesures de chimiotherapie
CN107299101A (zh) 非编码免疫调节dna 构建体
WO2003062423A2 (fr) Procede d'inhibition de l'expression d'un gene cible issu d'une aberration chromosomique
EP3317410B1 (fr) Ligands oligonucléotidiques discontinus
DE69618942T2 (de) Derivate und konjugete von mdp, eine von hämatopoitischer funktion stimulierende wirkung und deren enthaltende zusammensetzungen
DE10211558A1 (de) Neue Formen RNAi
DE69835525T2 (de) Verminderungsregulation der genexpression durch kolorektale verabreichung von synthetischen oligonukleotiden
Cerny et al. Weichteilsarkom
WO2009121616A2 (fr) Procédé de production d'un complément nutritif ou d'un agent de cicatrisation interne chez des êtres vivants
DE102006050655A1 (de) Pharmazeutische Zusammensetzung zur Behandlung allergischer Erkrankungen
DE2144529A1 (de) Verfahren zur Herstellung von Polynucleotid-Phosphorylase. Ausscheidung aus: 2121809

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20100507

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA MK RS

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110601