EP2186914A2 - Méthodes et kits pour la détection de modifications du nombre de copies d'un locus - Google Patents

Méthodes et kits pour la détection de modifications du nombre de copies d'un locus Download PDF

Info

Publication number
EP2186914A2
EP2186914A2 EP08162118A EP08162118A EP2186914A2 EP 2186914 A2 EP2186914 A2 EP 2186914A2 EP 08162118 A EP08162118 A EP 08162118A EP 08162118 A EP08162118 A EP 08162118A EP 2186914 A2 EP2186914 A2 EP 2186914A2
Authority
EP
European Patent Office
Prior art keywords
chromosome
protein
gene
methylation
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP08162118A
Other languages
German (de)
English (en)
Other versions
EP2186914A3 (fr
Inventor
David Halle
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Trisogen Biotechnology LP
Original Assignee
Trisogen Biotechnology LP
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Trisogen Biotechnology LP filed Critical Trisogen Biotechnology LP
Publication of EP2186914A2 publication Critical patent/EP2186914A2/fr
Publication of EP2186914A3 publication Critical patent/EP2186914A3/fr
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2523/00—Reactions characterised by treatment of reaction samples
    • C12Q2523/10—Characterised by chemical treatment
    • C12Q2523/125—Bisulfite(s)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2545/00—Reactions characterised by their quantitative nature
    • C12Q2545/10—Reactions characterised by their quantitative nature the purpose being quantitative analysis
    • C12Q2545/114—Reactions characterised by their quantitative nature the purpose being quantitative analysis involving a quantitation step
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers

Definitions

  • the present invention relates to methods and kits which are useful for detecting locus copy number abnormalities (e.g., amplifications) which lead to chromosomal abnormalities such as, trisomies.
  • locus copy number abnormalities e.g., amplifications
  • chromosomal abnormalities such as, trisomies.
  • genetic disorders in which the genetic component predominates over environmental factors are termed genetic disorders and typically fall into one of three categories: (i) disorders characterized by the absence, excess, or abnormal arrangement of one or more chromosomes; (ii) Mendelian or simply-inherited disorders, primarily caused by a single mutant gene and sub classified into autosomal dominant, autosomal recessive, or X-linked types; and (iii) multifactorial disorders caused by interaction of multiple genes and environmental factors.
  • Trisomies are lethal at the fetal or embryonic state, while autosomal trisomies are trisomies which allow fetal survival beyond birth.
  • Down's syndrome also known, as trisomy 21, is one of the most common genetic disorders which may be diagnosed prenatally. It is the cause of mental retardation and many physical and physiological anomalies in children born with the disorder. Many are born with congenital heart defects, and gastrointestinal abnormalities, which may be corrected by surgery. Physical features include flattened head in back, and slanted eyes, depressed nasal bridge, small hands and feet, excess skin at the back of neck at birth, reduced muscle tone and a simian crease in the palm of the hand [Down syndrome, (1994) National Down Syndrome Congress. Atlanta, GA: NDSC].
  • Ultrasound imaging of fetus - This test is performed between the 12 th -18 th weeks of pregnancy. It looks for nucaltranslucency (i.e., increased nucal thickening or swelling), shortened length of long bones and sandal gap between first and second toe. It is appreciated though, that the sensitivity of sonography for detection of fetal trisomic conditions varies with the type of chromosome abnormality, gestational age at the time of sonography, reasons for referral, criteria for positive sonographic findings, and the quality of the sonography. As an estimate, one or more sonographic findings can be identified in 50% to 70% of fetuses with trisomy 21 (Down syndrome). Thus, the presence or absence of sonographic markers can substantially modify the risk of fetal Down syndrome and is the basis of the genetic sonogram. Because maternal biochemical and sonographic markers are largely independent, combined risk estimates results in higher detection rates than either alone.
  • Maternal Serum Screening is also known as the multiple marker screening tests including the triple marker test, which looks at serum ⁇ -fetoprotein (AFP, low levels of which are indicative of Down's syndrome); human chorionic gonadotropin (hCG, high levels of which are indicative of Down's syndrome); and unconjugated estriol (uE3, low levels of which are indicative of Down's).
  • AFP serum ⁇ -fetoprotein
  • hCG human chorionic gonadotropin
  • uE3 unconjugated estriol
  • markers with the maternal age parameter can be used to diagnose Down's syndrome with a detection rate of about 70 % and a false positive rate of about 5 %. These markers can be used to diagnose Down's in the second trimester with AFP testing and ultrasound being used in the first trimester.
  • the quadruple test is now used with nucaltranslucent ultrasonography and testing for pregnancy associated plasma protein-A (PAPP-A).
  • PAPP-A pregnancy associated plasma protein-A
  • This method can increase the detection rate to 85 % with a 5 % false positive rate, thereby providing the most reliable non-invasive detection test for Down's syndrome currently available [ Wald, Kennard, hackshaw and McGuire, (1998) Health Technology Assessment, vol 2, no. 1. 1-124 .]. It should be noted, however, that currently available serum markers provide statistic results, which are indefinite and oftentimes difficult to interpret.
  • Amniocentesis - Amniocentesis is an invasive procedure in which amniotic fluid is aspirated to detect fetal anomalies in the second trimester. This test is recommended for women of increased maternal age, who are at greater risk for having a child with genetic anomalies such as Down's syndrome. Referral for amniocentesis may include unusually low or high levels of AFP. Amniocentesis is usually performed in the second trimester, but can be performed as early as the 11 th week of the pregnancy. A sample of amniotic fluid is taken at approximately 16 weeks of pregnancy. As only 20 % amniocytes are suitable for testing, the sample needs to be cultured to obtain enough dividing cells for metaphase analysis.
  • Chorionic Villi Sampling - Chorionic villi sampling involves taking a sample of the chorionic membrane, which forms the placenta, and is formed by the fetus, therefore containing fetal cells. This test can be performed at the end of the first trimester (i.e., 10-12 weeks). The procedure is performed transcervically or transabdominally. Both methods are equally safe and effective. The procedure is quick (results are available in less than 24 hours) and may involve little or no pain. The sample (i.e., uncultured sample) is then analyzed under the microscope, looking specifically at chromosomal abnormalities. The advantages of CVS are early testing within the first trimester, and the decreased risk of maternal cell contamination.
  • the disadvantages are increased risk of miscarriage, and cost. It is still important to look at maternal serum markers, although by the time AFP is looked at, it is to late to perform CVS. Positive results detect genetic disorders such as Down's at a rate of 60 to 70%. It is appreciated that 1 % of CVS show confined placental mosaicism, where the result obtained from the direct or cultured CVS is different to that of the fetus.
  • the cultured CVS is grown from cells more closely related to fetal line than the direct CVS which is closer to the placenta.
  • the risk of miscarriage is higher than that of amniocentesis. Furthermore the risk of ampotation of legs and hands during CVS is relatively high.
  • FISH Interphase fluorescence in situ hybridization
  • a slide of amniotic fluid can be analyzed using fluorescent in situ hybridization (FISH).
  • FISH fluorescent in situ hybridization
  • the test is done on uncultured interphase cells and can detect numerical chromosomal abnormalities. Results are available within 24 hours.
  • a probe derived from chromosome 21 critical region is used to diagnose Down's syndrome.
  • Another probe is used to test ploidity. The probe position may lead to false-negative results in the case of some translocations as two signals may be superimposed.
  • PCR Quantitative polymerase chain reaction
  • a trisomy 21 fetus was diagnosed in TCCs using fluorescent in situ hybridization (FISH) and semiquantitative PCR analysis of superoxide dismutase-1 (SOD 1). Later, quantitative fluorescent polymerase chain reaction (PCR) was demonstrated for simultaneous diagnosis of trisomies 21 and 18 together with the detection of DNA sequences derived from the X and Y chromosomes. Samples of DNA, extracted from amniotic fluid, fetal blood or tissues were amplified by quantitative fluorescent PCR to detect the polymorphic small tandem repeats (STRs) specific for two loci on each of chromosomes 21 and 18.
  • FISH fluorescent in situ hybridization
  • SOD 1 superoxide dismutase-1
  • Quantitative analysis of the amplification products allowed the diagnosis of trisomies 21 and 18, while sexing was performed simultaneously using PCR amplification of DNA sequences derived from the chromosomes X and Y.
  • STR markers for the detection of chromosome 21 trisomies confirmed the usefulness of quantitative fluorescent multiplex PCR for the rapid prenatal diagnosis of selected chromosomal abnormalities [ Pertl Obstet Gynecol. (2001) Sep;98(3):483-90 ].
  • Detection of aneuploidy in single cells This method is used in preimplantation genetic diagnosis.
  • DNA is obtained from lysed single cells and amplified using degenerate oligonucleotide-primed PCR (DOP-PCR).
  • DOP-PCR degenerate oligonucleotide-primed PCR
  • the product is labeled using nick translation and hybridized together with normal reference genomic DNA.
  • the comparative genomic hybridization (CGH) fluorescent ratio profiles is used to determine aneuploidy with cut-off thresholds of 0.75 and 1.25.
  • Single cells known to be trisomic for chromosomes 13, 18 or 21 were analyzed using this technique [Voullaire et al (1999), Tabet (2001), Rigola et al (2001)].
  • the Fingerprinting system is another method of performing preimplantation genetic diagnosis. Tetranucleotide microsatellite markers with high heterozygosity, known allelic size ranges and minimal PCR stutter artifacts are selected for chromosomes X, 13, 18 and 21 and optimized in a multiplex fluorescent (FL)-PCR format ( Katz et al (2002) Hum Reprod. 17(3):752-9 ]. However, these methods are limited for in vitro fertilization since isolating pure fraction of fetal cells from mother serum requires technical procedures which are not yet available.
  • Fetal cells in maternal circulation The main advantage of this technique is that it is non-invasive and therefore the procedure itself carries no risk to the pregnancy. Can potentially be performed earlier than CVS as fetal DNA has been detected at 5 weeks.
  • fetal cells trophoblasts, lymphocytes and nucleated red blood cells
  • Enriching techniques include flow/magnetic sorting, and double-density centrifugation. There are approximately 1-2 fetal cells/10 million maternal cells, and 50 % of the fetal cells will be unsuitable for karyotyping.
  • lymphocytes are unsuitable for use in this technique since such cells remain in maternal circulation for a duration of few years and therefore results may be affected by former pregnancies. This method only examines a single chromosome, compared with tradition karyotyping.
  • a method of identifying an alteration in a locus copy number comprising determining a methylation state of at least one gene in the locus, wherein a methylation state differing from a predetermined methylation state of the at least one gene is indicative of an alteration in the locus copy number.
  • the alteration in the locus copy number results from a chromosomal aberration selected from the group consisting of aneuploidy and polyploidy.
  • a method of identifying an alteration in a locus copy number in a subject comprising:(a) obtaining chromosomal DNA of the subject; and (b) determining a methylation state of at least one gene at the locus of the chromosomal DNA, wherein a methylation state differing from a predetermined methylation state of the at least one gene is indicative of an alteration in copy number of the locus, thereby identifying the alteration in the locus copy number in the subject.
  • a method of prenatally identifying an alteration in a locus copy number comprising: (a) obtaining fetal or embryonic chromosomal DNA including the locus; and (b) determining a methylation state of at least one gene in the fetal or embryonic chromosomal DNA including the locus, wherein a methylation state differing from a predetermined methylation state of the at least one gene is indicative of an alteration in the locus copy number thereby prenatally identifying the alteration in the locus copy number.
  • obtaining the fetal or embryonic chromosomal DNA is effected by: (i) amniocentesis; (ii) fetal biopsy; (iii) chorionic villi sampling; and/or maternal biopsy.
  • determining methylation state of the at least one gene is effected by: (i) restriction enzyme digestion methylation detection; (ii) bisulphate-based methylation detection; (iii) mass-spectrometry analysis; (iv) sequence analysis; and/or (v) microarray analysis.
  • a method of prenatally diagnosing Down's syndrome comprising: (a) obtaining fetal or embryonic chromosome 21; and (b) determining methylation state of at least one gene in the fetal or embryonic chromosome 21, wherein the at least one gene is selected not amplified in Down's syndrome and whereas a state of the methylation differing from a predetermined methylation state is indicative of amplification of the fetal or embryonic chromosome 21, thereby prenatally diagnosing Down's syndrome.
  • the at least one gene is selected from the group consisting of APP and cystathionine- ⁇ - synthase.
  • a method of identifying "compatible with life” genes comprising: (a) determining a methylation state of a plurality of genes in amplified chromosomal sequence regions; and (b) identifying genes of the plurality of genes which exhibit a methylation state different from a predetermined methylation state, thereby identifying the "compatible with life” genes.
  • a method of identifying "compatible with life” genes comprising: (a)determining expression level of a plurality of genes in amplified chromosomal sequence regions; and (b) identifying genes of the plurality of genes, which exhibit an expression level below a predetermined threshold, thereby identifying the "compatible with life” genes.
  • determining expression level of the plurality of genes is effected at the mRNA level.
  • determining expression level of the plurality of genes is effected at the protein level.
  • an article of manufacture comprising a packaging material and reagents identified for detecting alteration in a locus copy number being contained within the packaging material, wherein the reagents are capable of determining a methylation state of at least one gene in the locus and whereas a methylation state differing from a predetermined methylation state of the at least one gene is indicative of the alteration in the locus copy number.
  • kits for identifying an alteration in a locus copy number comprising reagents for determining a methylation state of at least one gene in the locus, the at least one gene being selected from the group consisting of APP and cystathionine- ⁇ -synthase, wherein a methylation state differing from a predetermined methylation state of the at least one gene is indicative of the alteration in the locus copy number.
  • the alteration in the locus copy number results from a chromosomal aberration selected from the group consisting of aneuploidy and polyploidy.
  • the present invention is of methods and kits which can be used to identify locus copy number abnormalities, which lead to chromosomal abnormalities. Specifically, the present invention can be used to prenatally detect locus amplifications such as trisomies.
  • Trisomies 21 Down's syndrome
  • 18 Edward's syndrome
  • 13 Patau Syndrome
  • sex chromosomes are the only live born autosomal trisomies.
  • trisomies 13 and 18 disorders tend to have much more severe clinical manifestations and only rarely do affected infants survive through the first year of life.
  • Multiple abnormalities exist in a fetus with a trisomy disorder but there is no single anomaly that is typical for a given trisomy. Rather, there exists a characteristic constellation of clinical findings that suggests a specific diagnosis. Furthermore, since some of these patients may be mosaics for the trisomy cell line, a variety of phenotypes are possible.
  • DNA methylation is a reversible mechanism by which gene expression is silenced in both prokaryotic and eukaryotic organisms. This level of control of gene expression is achieved by the ability of methylatransferases to add a methyl group to the fifth-carbon position of the cytosine pyrimidine ring especially in promoter sequence regions [ Adams (1995) Bioessays 17(2):139-45 ]. Methylated sequences in Eukaryotic cells are usually inactive [Gold and Pedersen (1994)].
  • DNA methylation is a widespread phenomenon in cancer and may be among the earliest changes occurring during oncogenesis [ Stirzaker (1997) Cancer Res. 57(11):2229-37 ]. DNA methylation has also been shown to play a central role in gene imprinting, embryonic development, X-chromosome silencing and cell-cycle regulation [ Costello (2001) J. Med. Genet. 38(5):285-303 ]. A failure to establish a normal pattern of gene methylation is the cause for a number of genetic disorders including Rett syndrome, a major form of mental retardation, Prader-Willi syndrome, Angelman's syndrome ICF syndrome and Beckwith-Wiedmann syndrome.
  • locus refers to the position or location of a gene on a chromosome.
  • the method according to this aspect of the present invention can detect gain hereinafter, locus amplification, or loss of loci located on chromosomes 1-22, X and Y.
  • locus amplification refers to an increase in the locus copy number.
  • Locus amplification and locus deficiency may result from changes in chromosome structure (e.g., duplication, inversion, translocation, deletion insertion) and/or from an increase or decrease in chromosome number (> 2n) or portions thereof (also termed a chromosome marker).
  • a change in chromosome number may be of an aneuploidic nature, involving a gain or a loss of one or more chromosomes but not a complete set of chromosomes (e.g., trisomy and tetrasomy).
  • locus amplification may result from polyploidy, wherein three or more complete sets of chromosomes are present.
  • the method according to this aspect of the present invention is effected by determining a methylation state (i.e., methylation pattern and/or level) of at least one gene in the locus.
  • Methylation state which differs from a predetermined methylation state of the at least one gene is indicative of an alteration in a locus copy number.
  • a predetermined state of methylation refers to the methylation state of an identical gene which is obtained from a non-amplified locus, preferably of the same developmental state.
  • a change i.e., pattern and/or increased level
  • methylation state of at least one allele of the at least one gene in the above-described locus is indicative of an alteration in a locus copy number according to this aspect of the present invention.
  • methylation of human DNA occurs on a dinucleotide sequence including an adjacent guanine and cytosine where the cytosine is located 5' of the guanine (also termed CpG dinucleotide sequences).
  • Most cytosines within the CpG dinucleotides are methylated in the human genome, however some remain unmethylated in specific CpG dinucleotide rich genomic regions, known as CpG islands [See Antequera, F. et al., Cell 62: 503-514 (1990 )].
  • a "CpG island” is a CpG dinucleotide rich region where CpG dinucleotides constitute at least 50% of the DNA sequence.
  • methylation state according to this aspect of the present invention is typically determined in CpG islands preferably at promoter regions. It will be appreciated though that other sequences in the human genome are prone to DNA methylation such as CpA and CpT [see Ramsahoye (2000) Proc. Natl. Acad. Sci. USA 97:5237-5242 ; Salmon and Kaye (1970). Biochim. Biophys. Acta. 204:340-351 ; Grafstrom (1985) Nucleic Acids Res. 13:2827-2842 ; Nyce (1986) Nucleic Acids Res. 14:4353-4367 ; Woodcock (1987) Biochem. Biophys. Res. Commun. 145:888-894 ].
  • Example 1-4 of the Examples section lists a number of genes which can be used to determine amplification of chromosome X, 9 and 21.
  • the at least one gene is selected according to an expression pattern thereof.
  • methylation of genes, which locus is amplified but exhibit no change in expression i.e., an expression pattern which is compatible with only two gene copies. Examples of such genes are listed in Table 1, below.
  • RNA-based approaches including hybridization-based techniques using oligonucleotides (e.g., Northern blotting, PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, microarray analysis and dot blot analysis) or protein-based approached such as chromatography, electrophoresis, immunodetection assays such as ELISA and western blot analysis, immunohistochemistry and the like, which may be effected using specific antibodies.
  • oligonucleotides e.g., Northern blotting, PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, microarray analysis and dot blot analysis
  • protein-based approached such as chromatography, electrophoresis, immunodetection assays such as ELISA and western blot analysis, immunohistochemistry and the like, which may be effected using specific antibodies.
  • This assay is based on the inability of some restriction enzymes to cut methylated DNA.
  • the enzyme pairs HpaII-MspI including the recognition motif CCGG, and SmaI-XmaI with a less frequent recognition motif, CCCGGG.
  • HpaII is unable to cut DNA when the internal cytosine in methylated, rendering HpaII-MspI a valuable tool for rapid methylation analysis.
  • the method is usually performed in conjunction with a Southern blot analysis. Measures are taken to analyze a gene sequence which will not give a difficult to interpret result.
  • a region of interest flanked with restriction sites for CG methylation insensitive enzymes is first selected.
  • Such sequence is selected not to include more than 5-6 sites for HpaII.
  • the probe(s) used for Southern blotting or PCR should be located within this region and cover it completely or partially. This method has been successfully employed by Buller and co-workers (1999) Association between nonrandom X-chromosome inactivation and BRCA1 mutation in germline DNA of patients with ovarian cancer J. Natl. Cancer Inst. 91(4):339-46 .
  • Genomic sequencing The genomic sequencing technique [Clark et al., (1994) supra] is capable of detecting every methylated cytosine on both strands of any target sequence, using DNA isolated from fewer than 100 cells.
  • sodium bisulphite is used to convert cytosine residues to uracil residues in single-stranded DNA, under conditions whereby 5-methylcytosine remains non-reactive.
  • the converted DNA is amplified with specific primers and sequenced. All the cytosine residues remaining in the sequence represent previously methylated cytosines in the genome.
  • This method utilizes defined procedures that maximize the efficiency of denaturation, bisulphite conversion and amplification, to permit methylation mapping of single genes from small amounts of genomic DNA, readily available from germ cells and early developmental stages.
  • Methylation-specific PCR This is the most widely used assay for the sensitive detection of methylation. Briefly, prior to amplification, the DNA is treated with sodium bisulphite to convert all unmethylated cytosines to uracils. The bisulphite reaction effectively converts methylation information into sequence difference. The DNA is amplified using primers that match one particular methylation state of the DNA, such as that in which DNA is methylated at all CpGs. If this methylation state is present in the DNA sample, the generated PCR product can be visualized on a gel.
  • MSP Methylation-specific PCR
  • Real-time fluorescent MSP (MethyLight) -
  • the use of real time PCR employing fluorescent probes in conjunction with MSP allows for a homogeneous reaction which is of higher throughput. If the probe does not contain CpGs, the reaction is essentially a quantitative version of MSP.
  • the fluorescent probe is typically designed to anneal to a site containing one or more CpGs, and this third oligonucleotide increases the specificity of the assay for completely methylated target strands. Because the detection of the amplification occurs in real time, there is no need for a secondary electrophoresis step. Since there is no post PCR manipulation of the sample, the risk of contamination is reduced.
  • the MethyLight probe can be of any format including but not limited to a Taqman probe or a LightCycler hybridization probe pair and if multiple reporter dyes are used, several probes can be performed simultaneously [ Eads (1999) Cancer Res. 59:2302-2306 ; Eads (2000) Nucleic Acids Res. 28:E32 ; Lo (1999) Cancer Res. 59:3899-390 ].
  • the advantage of quantitative analysis by MethyLight was demonstrated with glutathione-S-transferase-P 1 (GSTP1) methylation in prostate cancer [ Jeronimo (2001) J. Natl. Cancer Inst. 93:1747-1752 ]. Using this method it was possible to show methylation in benign prostatic hyperplasia samples, prostatic intraexpithelial neoplasma regions and localized prostate adenocarcinoma.
  • DMH Differential methylation hybridization
  • Array-based techniques are used when a number (e.g., > 3) of methylation sites in a single region are to be analyzed.
  • CpG dinucleotide nucleic acid fragments from a genomic library are generated, amplified and affixed on a solid support to create a CpG dinucleotide rich screening array.
  • Amplicons are generated by digesting DNA from a sample with restriction endonucleases which digest the DNA into fragments but leaves the methylated CpG islands intact. These amplicons are used to probe the CpG dinucleotide rich fragments affixed on the screening array to identify methylation patterns in the CpG dinucleotide rich regions of the DNA sample. Unlike other methylation analysis methods such as Southern hybridization, bisulfite DNA sequencing and methylation-specific PCR which are restricted to analyzing one gene at a time, DMH utilizes numerous CpG dinucleotide rich genomic fragments specifically designed to allow simultaneous analysis of multiple of methylation-associated genes in the genome (for further details see U.S. Pat. No. 6,605,432 ).
  • kits may be used to detect methylation state of genes. Examples include, but are not limited to, the EZ DNA methylation kitTM (available from Zymo Research, 625 W Katella Ave, Orange, CA 92867, USA),
  • oligonucleotides for the bisulphate-based methylation detection methods described hereinabove are designed according to the technique selected.
  • oligonucleotide refers to a single stranded or double stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally-occurring bases, sugars and covalent internucleoside linkages (e.g., backbone) as well as oligonucleotides having non-naturally-occurring portions which function similarly to respective naturally-occurring portions (see disclosed in U.S. Pat.
  • the most critical parameter affecting the specificity of methylation-specific PCR is determined by primer design. Since modification of DNA by bisulfite destroys strand complementarity, either strand can serve as the template for subsequent PCR amplification, and the methylation pattern of each strand can then be determined. It will be appreciated, though, that amplifying a single strand (e.g., sense) is preferable in practice. Primers are designed to amplify a region that is 80-250 bp in length, which incorporates enough cytosines in the original strand to assure that unmodified DNA does not serve as a template for the primers.
  • the number and position of cytosines within the CpG dinucleotide determines the specificity of the primers for methylated and unmethylated templates.
  • 1-3 CpG sites are included in each primer and concentrated in the 3' region of each primer. This provides optimal specificity and minimizes false positives due to mispriming.
  • the length of the primers is adjusted to give nearly equal melting/annealing temperatures.
  • annealing temperatures is selected maximal to allow annealing and subsequent amplification.
  • primers are designed with an annealing temperature 5-8 degrees below the calculated melting temperature.
  • Oligonucleotides designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art such as enzymatic synthesis or solid phase synthesis.
  • Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example, " Molecular Cloning: A laboratory Manual” Sambrook et al., (1989 ); " Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed.
  • the hereinabove-described methodology can be used to detect pathologies which are associated with alterations in locus copy number (described above).
  • pathologies include but are not limited to trisomies including trisomy 1, trisomy 2, trisomy 3, trisomy 4, trisomy 5, trisomy 6, trisomy 7, trisomy 8, trisomy 9, trisomy 10, trisomy 11, trisomy 12, trisomy 13 (Patau's syndrome), trisomy 14, trisomy 15, trisomy 16, trisomy 17, trisomy 18 (Edward's syndrome), trisomy 19, trisomy 20, trisomy 21 (Down's syndrome), trisomy 22, triplo X syndrome (Kleinfelter syndrome), triplo Y syndrome, partial trisomy 6q, trisomy 9p, trisomy 11q, trisomy 14 mosaic, trisomy 22 mosaic; monosomies such as monosomy 1 and monosomy X (Turner syndrome) tetrasomies such as teterasomy 18p; triploidy such as the triploid syndrome (see the national organization for rare diseases http://www.rarediseases.org/ and chromosomal mosaicis
  • a DNA sample is obtained from the individual subject (i.e., mammal) and analyzed as described hereinabove.
  • Preferred subjects according to this aspect of the present invention are humans of any developmental stage (e.g., pre-implanted embryo subjects, embryo subjects, fetal subjects, neo-natal subjects and post natal subjects).
  • Post natal examination is typically effected to rule out the classical chromosomal syndromes and genotyping individuals with multiple congenital anomalies (MCA), parents or siblings of individuals with chromosomal abnormalities, children of individuals with balanced or structural chromosomal anomalies, couples with histories of two or more fetal losses, couples with infertility problems, individuals with ambigious genitalia, females with primary amenorrhea, individuals with mental retardation and males and females with pubertal failure.
  • MCA congenital anomalies
  • DNA is obtained from a biological sample of the individual subject (i.e., neo-natal, post-natal).
  • biological sample refers to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, urine the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vivo cell culture constituents.
  • tissue biopsies, blood or bone marrow samples are tissue biopsies, blood or bone marrow samples.
  • Blood is preferably collected in sodium heparin or EDTA-coated-tubes. Newborn requires a minimum of 1-2 ml blood, child or adult requires a minimum of 3-5 ml blood. For white blood cell analysis, cells must exceed 10,000 with 10% immature cells.
  • Bone Marrow (0.5-2 cc bone marrow) is collected in bone marrow transport media or sodium heparin tubes
  • Tissue Biopsies [3mm of specimen e.g., placenta, cord, skin (typically used for testing degree of mosaicism)] is collected in sterile physiologic saline or in sterile tissue culture media.
  • lymphocytes are obtained and subjected to external stimulating factors (i.e., mitogens) to induce cell division (i.e., mitosis).
  • mitogens i.e., mitogens
  • the stimulated cells can be harvested at any time following 45-96 hours of incubation.
  • genomic DNA is preferably extracted such as by using a the QIAamp blood kit which is available from Qiagen (28159 Avenue Stanford Valencia CA 91355) and analyzed as described above.
  • chromosomal abnormalities are a primary reason for miscarriage and birth defects
  • the above-described methodology is preferably used to identify locus amplifications in unborn infants. It is well established that methylation of fetal DNA obtained from the blood of the mother can be detected using bisulfite modification, allowing the use of the epigenetic markers of the present invention in prenatal screening [see Poon et al. (2002) Clin. Chem. 48:35-41 ].
  • Methods of obtaining DNA from embryonic (i.e., the developing baby from conception to 8 weeks of development) or fetal (i.e., the developing baby from ninth weeks of development to birth) cells are well known in the art. Examples include but are not limited to maternal biopsy (e.g., cervical sampling, amniocentesis sampling, blood sampling), fetal biopsy (e.g., hepatic biopsy) and chorionic vilus sampling (see Background section and U.S. Pat. No. 6,331,395 ).
  • maternal biopsy e.g., cervical sampling, amniocentesis sampling, blood sampling
  • fetal biopsy e.g., hepatic biopsy
  • chorionic vilus sampling see Background section and U.S. Pat. No. 6,331,395 .
  • Isolation of fetal DNA from maternal blood is preferably used according to this aspect of the present invention since it is a non-invasive procedure which does not pose any risk to the developing baby [see Lo (1998) Am. J. Hum. Genet. 62(4): 768-75 ].
  • Cell free fetal DNA can be collected from maternal circulation and analyzed as described above [see Bauer (2002) Am. J. Obstet. Gynecol. 186:117-20 ; Bauer (2001) Ann. NY Acad. Sci. 945:161-3 ; Pert1 (2001) Obstet. Gynecol. 98:483-90 ; Samura (2000) Hum. Genet. 106:45-9 ].
  • fetal cells can be enriched from maternal blood using antibody capture techniques in which an immobilized antibody binds to fetal cells and captures the fetal cells to facilitate their enrichment
  • antibody capture techniques in which an immobilized antibody binds to fetal cells and captures the fetal cells to facilitate their enrichment
  • Fetal cells can also be labeled with antibodies and other specific binding moieties to facilitate cell sorting procedures such as flow cytometry [Herzenberg et al., "Fetal cells in the blood of pregnant women: Detection and enrichment by fluorescence-activated cell sorting", Proc. Natl Acad. Sci. (USA) 76: 1453-1455 (1979 ); Bianchi et al., "Isolation of fetal DNA from nucleated erythrocytes in maternal blood” Proc. Natl Acad. Sci.
  • PCR techniques are typically used in conjunction in order to increase the relative amount of fetal DNA and thus permit analysis [ Bianchi et al., "Isolation of fetal DNA from nucleated erythrocytes in maternal blood", Proc. Natl Acad. Sci (USA) 87: 3279-3283 (1990 ); Adkinson et al., "Improved detection of fetal cells from maternal blood with polymerase chain reaction", Am. J. Obstet. Gynecol. 170: 952-955 (1994 ); Takabayashi et al., “Development of non-invasive fetal DNA diagnosis from maternal blood” Prenatal Diagnosis 15: 74-77 (1995 )].
  • blood 50 ml
  • the mono nuclear cell (MNC) fraction is isolated by centrifugation on Ficoll-hypaque, and cultured at 5 ⁇ 10 6 / ml for 7 days in alpha medium with 10% FCS, using SCF 100 ng/ml, IL-3 100 ng/ml, and IL-6 100 u/ml.
  • the nonadherent cells are then recovered and replated at 3 ⁇ 10 5 /ml in alpha medium with 30 % FCS, 1 % BSA, 10 -4 M ⁇ -mercaptoethanol, and penicillin and streptomycin, as well as SCF 100 ng/ml, IL-3 100 ng/ml, and IL-6 100 mu/ml. All incubations are done in humidified incubators with 5% CO 2 and either room air or 5 % oxygen. After 21 days, the cells are recovered. Cells are centrifuged and DNA extracted using standard methods, for methylation analysis as described above.
  • Kits for enriching fetal cells from maternal blood are available from AVIVA Biosciences Corporation (San Diego, CA., http://www.avivabio.com/Technology/ fetal_cell_isolation.html).
  • embryonic or fetal DNA may also be obtained following fetal demise or a miscarriage.
  • cultures are initiated from the embryonic or fetal tissue using enzymatically dissociated cells and pieces of tissue (explants). When the tissue is placed in appropriate culture conditions, the cells attach to the surface and grow as monolayers.
  • Chromosomal information obtained using the present methodology may be further validated using a number of cytological (e.g., Giemsa staining) and hybridization-based techniques (e.g., FISH) which are well known in the art (see for example U.S. Pat. Nos. 5,906,919 and 5,580,724 ).
  • cytological e.g., Giemsa staining
  • FISH hybridization-based techniques
  • Reagents for determining locus amplification as described hereinabove can be presented, in a pack or dispenser device, such as a diagnostic kit.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for diagnosis.
  • the present invention can also be used to detect pathologies which are associated with an aberrant DNA methylation mechanism which lead to abnormal methylation, as described above.
  • pathologies which are associated with an aberrant DNA methylation mechanism which lead to abnormal methylation, as described above.
  • examples include but are not limited to Pradi-Willi, Angelman, Beckwith-Wiedemann, Rett and ICF syndromes.
  • the ICF syndrome is caused by abnormal function of a DNA methyltransferase enzyme termed Dnmt3b.
  • Dnmt3b DNA methyltransferase enzyme
  • MeCP2 abnormalities in one of the proteins recognizing and binding mC
  • sex determination (e.g., prenatal) is also contemplated by the present invention, since genes on the additional copy of chromosome X of females are suppressed by DNA methylation [ Goto (1998) Microbiol. Mol. Biol. Rev. 62(2):362-78 ].
  • the method is effected by, determining a methylation state of a plurality of genes in amplified chromosomal sequence regions as described above.
  • genes of the plurality of genes, which exhibit a methylation state different from a predetermined methylation state are identified to thereby identify the "compatible with life" genes.
  • Such a method can be effectively employed to annotate genes and to identify novel therapeutic targets.
  • DNA extraction - DNA is extracted from plasma and amniotic fluid samples using the QIAamp Blood kit (Qiagen, 28159 Avenue Stanford Valencia CA 91355). 800 ⁇ l of plasma or amniotic fluid is used for DNA extraction per column. DNA is eluted using 50-110 ⁇ l of elution buffer. DNA is extracted from the buffy coat of white blood using a Nucleon DNA Extraction Kit (Scotlabs Woburn, MA) according to the manufacturer's instructions.
  • the solution is incubated at 50 °C for 10 minutes to thereby generate single stranded DNA.
  • Hydroquinone [30 ⁇ l of 10 mM hydroquinone (Sigma), freshly prepared by adding 55 mg of hydroquinone to 50 ml of water] is added to each tube. Thereafter, 520 ⁇ l of freshly prepared 3M Sodium bisulfite (Sigma S-8890, prepared by adding 1.88 gm of sodium bisulfite per 5 ml of H 2 O and adjusting pH to 5.0 with NaOH] is added to the solution. Measures are taken to assure that the DNA solution is homogeneously mixed.
  • the DNA solution is layered with mineral oil and allowed to incubate at 50 °C for 16 hours or at 70 °C for 1-2 hours.
  • glycogen 1 ⁇ l glycogen is added as carrier (Boehringer Ingelheim GmbH, Germany), 33 ⁇ l of 10 M NH 4 Ac, and 3 volumes of ethanol. DNA is precipitated for at least 1 hour to overnight at -20°C and washed with 70 % ethanol. Dry pellet is resuspend in 20 ⁇ l water and stored at -20 °C.
  • Amplification reaction - 1 ⁇ l aliquot of sulfonated DNA solution is added to 50 ⁇ l of PCR reaction mixture containing 1XGC buffer 2 (TaKaRa, Shuzo, Kyoto, Japan), 2.5 mM each of dNTP, 5 U of TaKaRa LA Taqe (TaKaRa, Shuzo, Kyoto, Japan), and 50 pmol of the antisense primers. Reaction mixture is incubated at a temperature of 94 °C for 5 minutes.
  • the DNAs are amplified for 8 cycles at 94 °C for 1 min, 60 °C for 1.5 min and 72 °C for 2 min.
  • Methylation in the resulting PCR product is detected by restriction enzyme analysis or direct sequencing.
  • Detection of methylation site by restriction enzymes The chemical modification of methylcytosine to thymine as descried above change the sites of HpaII and HahI restriction enzymes such that these enzymes cannot digest the DNA in their respective sites. Cytosine methylation does not allow methylation sensitive enzymes to digest at these sites while other enzymes such as Mspl which are methylation tolerant will produce a regular pattern of restriction.
  • the use of such enzyme on bisulphate treated DNA allows to distinguish methylation sites using specific restriction enzyme (see further details in Example 3 below).
  • Methylation with McrBC - McrBC is obtained from New England Biolabs.
  • the enzyme is added to 5 ⁇ g of genomic DNA and reaction is incubated for overnight at 37 °C according to manufacturers instructions.
  • the enzyme is inactivated by incubation in 65 °C for 20 minutes.
  • 50 ⁇ g of the digested DNA is used as a template for PCR reaction.
  • Promoter specific primers are used.
  • Product is analyzed by agarose gel resolution.
  • Direct sequencing of PCR product - Resultant PCR product is purified using commercially available kits (e.g., Geneclean etc.) and sequenced by commercially available automatic sequencers.
  • Allele specific oligonucleotide hybridization In this assay a large fragment that contain all candidate methylation sites on a gene of interest is amplified.
  • the PCR product contain one nucleotide labeling by flurocein or other flurophore (Cy3,Cy5).
  • the second way to label the product is by radioactive nucleotide ( 32 P, 33 P, 35 S, 3 H or 14 C) which incorpotate into the PCR product.
  • the PCR product is than hybridized with specific oligonucleotide for methylated cytosine (i.e., thymine) vs. cytosine.
  • the hybridization to the oligonucleotide might be done on glass or nitrocelluse using the microarray methods.
  • kits for detection mutations can be done by commercially available "Pronto" kits of "Gamidagene” company. These kits are designed to detect mutation and/or single nucleotide polymorphisms (SNP)in conujunction with specific probes designed and configured to recognize a methylation site of interest.
  • SNP single nucleotide polymorphisms
  • other methods that can recognize a mutation in a nucleotide sequence may be used too.
  • the amplification refractory mutation syatem-ARMS. In this method two complementary reactions are used, one contains a primer specific for the normal allele and the other contains the mutant allele (both have a common 2nd primer). Since the PCR primer perfectly matches the variant DNA, the preferential amplification of the perfectly matched allele genotyping is identified.
  • the methyl cytosine that is converted to thymine by bisulfite is detectable by this method.
  • Table 2 below, lists the assigned functions of 122 genes of chromosome 21 as annotated by Gardiner and Davisson Genome Biology 2000 1(2):reviews 0002.1-0002.9 . The majority have complete or presumably complete cDNA sequences. Functional annotations were assigned based on literature reports of direct experiment or on inferences from similarities to other proteins. Annotation of genes having only partial structural information was based on specific functional domain therein and are indicated by (*)(Gardiner K. http://genomebiology.com/2000/1/2/reviews/0002.1)
  • Functional categories were chosen to be broadly descriptive; each gene appears in only one category. Table 2 Functional categories Number of genes Functional annotations Transcription factors, regulators, and modulators 17 GABPA, BACH1, RUNX1, SIM2, ERG, ETS2 (transcription factors); ZNF294, ZNF295, Pred65, *ZNF298, APECED (zinc fingers); KIAA0136 (leucine zipper); GCFC (GC-rich binding protein); SON (DNA binding domain); PKNOX1 (homeobox); HSF2BP (heat shock transcription factor binding protein); NRIP1 (modulator of transcriptional activation by estrogen) Chromatin structure 4 H2BFS (histone 2B), HMG14 (high mobility group), CHAF1B (chromatin assembly factor), PCNT (pericentrin, an integral component of the pericentriolar matrix of the centrosome) Proteases and protease inhibitors 6 BACE (beta-site APP cleaving enzyme); TMPRSS2, TMPRSS3 (transme
  • Deposition of fibrillar amyloid proteins intraneuronally, as neurofibrillary tangles, extracellular, as plaques and in blood vessels, is characteristic of both Alzheimer's disease (AD) and aged down's syndrome patients.
  • the major protein found within these deposits is a small, insoluble and highly aggregating polypeptide, a4, that is thought to be derived from aberrant catabolism of its precursor, the amyloid protein precursor which is localized to chromosome 21 (21q21.2).
  • methylation of the APP promoter region is determined by bisulphite sequencing.
  • Table 3 Primer ID Oligonucleotide sequence (5'-3' )/SEQ ID NO: Position in X127522 PCR product size (bp) APP-F tggttttagatttttttttttattg (1) 3449-3473 272 APP-R acctaccactaccaaaaaactaac (2) 3696-3721
  • Table 4 below lists preferable PCR conditions. Table 4 Temperture (°C) Time Cycle no. 95 10 min 94 30 sec 35 62 30 sec. 72 30 sec. 72 10 min
  • the resultant PCR product is sequenced to thereby identify cytosine substitution to thymidine.
  • An amplified PCR product from the APP promoter (using primers APP-F and APP-R, Figure 1b ) is shown in Figure 1a .
  • the resultant PCR product can be hybridized to an olignonucleotide microarray.
  • Table 5 - Amyloid precursor protein (APP) gene (GenBank Accession NoX127522) Chromosome 21 WT probe (5'-3') / SEQ ID NO: Methylation probe (5'-3') / SEQ ID NO: Position (gi35230) gagggggtgtgtggg/(5) gagggggcgtgtggg/(6) 3509-3523 gttaaggtgttgtat/(7) gttaaggcgttgtat/(8) 3535-3549 ttgtgggtggggt/(9) ttgtgggcgtggggt/(10) 3550-3563 ttttggtgtgagtg/(11) ttttttggcgtgagtg/(
  • DNA extraction - Cells were centrifuged for 10 minutes 2,500 rpm. Cell pellets were resuspended in lysis buffer including 75 mM NaCl and 25 mM EDTA and vortexed well to disintegrate plasma membrane. Thereafter, 10 % SDS solution (1/10 of the final volume) was added to the mixture and the solution was mixed by inversion. The solution was incubated over night at 55 °C in the presence of Proteinase K (10mg/ml, 1/10 of the final volume). An equal volume of Phenol:Chloroform (1:1) was added to the solution, mixed well by inversion (5 min) and centrifuged for 15 minutes at 14,000 x g to reach phase separation.
  • Chloroform was added to the upper phase, the solution was well mixed by inversion for 5 min, centrifuged at 14,000 x g for 5 min to reach phase separation, collecting the upper phase, to which 3 M sodium acetate (1/10 of final volume) was added and mixed well by inversion. DNA was ethanol precipitated (70 %) for over night and concentration and purity were thereafter determined.
  • DNA molecules i.e., bisulfite-treated or non-treated
  • HpaII 30 units, NEB Enzyme, New England Biolabs. Inc. Beverly MA 01915-5599 USA.
  • incubation was allowed to proceed for overnight including a second addition of fresh enzyme following 8 hours of incubation.
  • the resultant PCR product of about 300 bp was resolved and visualized on a 2.5 % agarose gel.
  • MSP Methylation specific PCR
  • DNA was bisulfite treated as described in the Experimental procedures hereinabove.
  • PCR conditions for amplifying exon 1 of Androgene receptor from bisulfite modified DNA are listed in Tables 15 and 16 below.
  • Table 15 Temperature Time Cycles No. 94°C 4 min 94°C 45 sec 35 59°C 45 sec 72°C 1 min 72°C 7 min
  • Table 16 - Step II Mix 1 Buffer 10X NEB 0.1 of final volume dNTPs 2mM 0.1 of final volume AR-F-34 10pmol/ ⁇ l 0.1 of final volume AR-R-282 10pmol/ ⁇ l 0.1 of final volume Water Complete to the final volume DNA (product of step I) 0.05 of final volume Enzyme* 1 unit *NEB Enzyme
  • PCR product of step II was resolved in 2.5 % agarose gel and purified by commercially available purification kit (GFX PCR cat.No, 27-9602-01 of Amersham Bioscience Piscataway Bioscience NJ 08855-USA) and then subcloned to pGEM plasmid (pGEM-T Easy Vector Vector System I Cat. No. A1360 or pGEM-T Vector Vector System I Cat. No. A3600 Promega Corporation Madison WI USA). Accurate sequencing was confirmed by sequencing of 5-10 clones of each PCR product. Sequencing was effected by an ABI Sequencer machine.
  • Figures 3 and 4 depict the results of Androgen receptor methylation state in males, females and Kleinfelter Syndrome affected subjects as determined by restriction enzyme based analysis and by methylation specific PCR (MSP).
  • MSP methylation specific PCR
  • oligonucleotide microarray may be advantageous.
  • Oligonucleotides which may be efficiently used in such a microarray are listed in Table 17, below.
  • Table 17 WT probe (5'-3') / SEQ ID NO: Methylation probe (5'-3') / SEQ ID NO: Position (M00044) ggtttattttttggttgttgtt/63 ggtttattttcggttgttgtt/66 1142-1162 ggtttattttttggtcgttgtt/67 ggtttattttt tg gt tg cg tt/68 ggtttatttt cg gt cg t tg tt/69 ggtttatttttg gt cg t t/70 ggtttatttt tg gt tg t cg tt/71 ggtttatttttt
  • genes which are located on amplified chromosomes or chromosome regions are usually not overexpressed probably due to methylation of upstream promoter regions which lead to specific gene silencing.
  • Table 18 shows the ratio of chromosome 21 gene expression in amniotic cells obtained from a Down's syndrome affected subject versus amniotic cells obtained from a normal subject.
  • a X ⁇ 1.5 ratio is indicative of gene silencing ( www.hgu.mrc.ac.uk/Research/Cellgcn/Supplements/Unigene/t21all.htm ).
  • Table 18 Gene Name Accession No.
  • DSCAM and IFNAR1 genes of chromosome 21 are partially methylated in chromosome 21 trisomy
  • the Down syndrome cell adhesion molecule (DSCAM) gene (GenBank ACCESSION NO: AF217525) was chosen to show methylation pattern of a partially silenced gene (i.e., X ⁇ 1.5) in chromosome 21 trisomy.
  • Sequencing based analysis of DSCAM methylation - Tables 19-21 below list primers and PCR conditions which were used to amplify DSCAM from tissues and cells from healthy subjects and Down's syndrome affected subjects.
  • PCR reaction was effected using the primers listed in Table 19 below and the reaction mixture reagents and concentration described in Table 14 above.
  • Table 19 Primer name Primer Sequence (5'-3')/SEQ ID NO: I Position (AL163283) DSCAM-fl-bis 333350-333379 DSCAM-r1-bis 333456-333481 DSCAM-nes-fl-bis 333344-333373
  • Table 20 Step 1 Temperature Time No. Of cycles. 94°C 4 min 94°C 45 sec 35 52°C 45 sec 72°C 1 min 72°C 7 min * Reaction was effected in Buffer B-DS using primers_ DSCAM-nes-fl-bis and DSCAM-rl-bis.
  • the resultant PCR product was 142 bp.
  • PCR product was used as a template for a second PCR reaction (1/20 of final volume).
  • Table 21 - Step 2 Temperature Time No. of cycles 94°C 4 min 94°C 45 sec 35 53°C 45 sec 72°C 1 min 72°C 7 min Reaction was effected in Buffer NEB using primers DSCAM-fl-bis and DSCAM-rl-bis.
  • the resultant PCR product was 135 bp.
  • PCR reaction mixture was loaded on 3 % agarose gel and the 135 bp product was purified as described in Example 3 above. Sequence identity of the product was confirmed by sequencing as is also described hereinabove.
  • Interferon (alpha, beta and omega) Receptor 1 (IFNAR1, GenBank Accession No: AU137565) is partially silenced in chromosome 21 trisomy.
  • the methylation pattern of IFNAR1 was examined in cells and tissues as described in Example 5a.
  • the native sequence of IFNAR1 promoter is given in Figure 5a .
  • a putative sequence obtained following bisulfile treatrment is shown in Figure 5b .
  • Sequencing based analysis of DSCAM methylation -_Tables 23-25 below list primers and PCR conditions which were used to amplify IFNAR1 from tissues and cells from healthy subjects and Down's syndrome affected subjects.
  • PCR reaction was effected using the primers listed in Table 23 below and the reaction mixture reagents and concentration described in Table 14 above.
  • Table 23 Primer name Position in (AY654286) Sequence (5'-3') / SEQ ID NO: IFNR-f4-bis 1327-1351 TTTTAGTTTTATTTGGTTTTTAGGT/247 IFNR-r4-bis 1372-1396 AAAAAACCTTAACCTTCACAAAATC/248 IFNR-nes-f-bis 1533-1557 Table 24 - Step 1 Temperature Time No.
  • the resultant PCR product was 231 bp.
  • PCR product was used as a template for a second PCR reaction (1/20 of final volume).
  • Table 25 - Step 2 Temperature Time No. of Cycles 94°C 4 min 94°C 45 sec 35 56°C 45 sec 72°C 1 min 72°C 7 min Reaction was effected in Buffer NEB using primers IFNR-nes-f-bis and IFNR-r4-bis
  • the resultant PCR product was 186 bp.
  • Table 26 shows ratio of chromosome 13 gene expression in amniotic cells obtained from trisomy 13 genotyped subjects versus amniotic cells obtained from normal subjects (www.hgu.mrc.ac.uk/Research/Cellgen/Supplements/Unigene/t13all.htm.).
  • Trisomy 9 is a rare chromosomal disorder. Characteristic features include delayed growth of the fetus, heart defects present at birth, facial abnormalities (e.g., low-set and/or malformed ears), an abnormally small head, kidney and/or genital abnormalities, skeletal abnormalities (e.g., fixed and/or dislocated joints), and/or malformations of the brain.
  • facial abnormalities e.g., low-set and/or malformed ears
  • an abnormally small head e.g., kidney and/or genital abnormalities
  • skeletal abnormalities e.g., fixed and/or dislocated joints
  • p16 on chromosome 9 plays a central role in cell cycle and in many pathologies including melanoma, bladder and lung cancer.
  • Expression of p16, a tumor suppressor gene, is repressed in a variety of cancers such as bladder, colon and retinoblastoma. Methylation of CpG islands in the p16 promoter has been shown to be responsible for inactivation of this gene in certain cases [ Sharpless (2003) Oncogene. 22(20):3092-8 ; Virmani (2003) Methods Mol Biol. 2003;222:97-115 ].
  • the CpG WIZ® p16 Amplification Kit (Chemicon International, Inc.) is used for determining the methylation status of the p16 promoter by methylation-specific PCR (MSP).
  • MSP methylation-specific PCR
  • the kit contains primers targeted to regions of the promoter where the sequences are most divergent following bisulfite treatment. PCR parameters have been identified such that all primer sets in the kit amplify under the same conditions. Control genomic DNA samples (methylated and unmethylated) for p16 are also included.
  • Bisulfite conversion is carried out using the CpGenome DNA Modification Kit (Intergen, New York, NY). 1 ⁇ g of DNA is treated with sodium bisulfite according to manufacturers recommendations. Following conversion, the bisulfite-treated DNA is resuspended in a total volume of 25 ⁇ l.
  • Table 27 below summarizes the methods which are used to detect methylation state of the above-described genes. Table 27 Method Example Trisomy DNA Sequencing *APP,AR. p16,DSCAM BACH1 ETS2 INFAR1 21,X,9 Restriction enzyme Androgen Receptor X MSP Androgen Receptor X, Microarray APP 21,X Commercial kit for mutation's s detection p16 9

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Ultra Sonic Daignosis Equipment (AREA)
  • Channel Selection Circuits, Automatic Tuning Circuits (AREA)
  • Image Analysis (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
  • Duplication Or Marking (AREA)
EP08162118A 2003-09-22 2004-09-20 Méthodes et kits pour la détection de modifications du nombre de copies d'un locus Withdrawn EP2186914A3 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50421103P 2003-09-22 2003-09-22
EP04770537A EP1668154B1 (fr) 2003-09-22 2004-09-20 Procedes utilises pour detecter une modification dans le nombre de copies d'un locus

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
EP04770537.1 Division 2004-09-20
WOPCT/IL2004/000866 Previously-Filed-Application 2004-09-20
EP04770537A Division EP1668154B1 (fr) 2003-09-22 2004-09-20 Procedes utilises pour detecter une modification dans le nombre de copies d'un locus

Publications (2)

Publication Number Publication Date
EP2186914A2 true EP2186914A2 (fr) 2010-05-19
EP2186914A3 EP2186914A3 (fr) 2010-07-21

Family

ID=34375458

Family Applications (2)

Application Number Title Priority Date Filing Date
EP04770537A Expired - Lifetime EP1668154B1 (fr) 2003-09-22 2004-09-20 Procedes utilises pour detecter une modification dans le nombre de copies d'un locus
EP08162118A Withdrawn EP2186914A3 (fr) 2003-09-22 2004-09-20 Méthodes et kits pour la détection de modifications du nombre de copies d'un locus

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP04770537A Expired - Lifetime EP1668154B1 (fr) 2003-09-22 2004-09-20 Procedes utilises pour detecter une modification dans le nombre de copies d'un locus

Country Status (10)

Country Link
EP (2) EP1668154B1 (fr)
JP (1) JP5013869B2 (fr)
KR (1) KR20060101470A (fr)
CN (1) CN1882700A (fr)
AT (1) ATE415495T1 (fr)
AU (1) AU2004274724B2 (fr)
CA (1) CA2540141C (fr)
DE (1) DE602004018009D1 (fr)
WO (1) WO2005028674A2 (fr)
ZA (1) ZA200602319B (fr)

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050282213A1 (en) * 2003-09-22 2005-12-22 Trisogen Biotechnology Limited Partnership Methods and kits useful for detecting an alteration in a locus copy number
US7707039B2 (en) 2004-02-15 2010-04-27 Exbiblio B.V. Automatic modification of web pages
WO2006137066A2 (fr) * 2005-06-21 2006-12-28 Allelis Diagnostics Ltd. Methodes de diagnostic du cancer et du desequilibre chromosomique utilisant des variations interalleliques epigenetiques
US7901884B2 (en) * 2006-05-03 2011-03-08 The Chinese University Of Hong Kong Markers for prenatal diagnosis and monitoring
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
US20080014589A1 (en) 2006-05-11 2008-01-17 Link Darren R Microfluidic devices and methods of use thereof
US8772046B2 (en) 2007-02-06 2014-07-08 Brandeis University Manipulation of fluids and reactions in microfluidic systems
EP2217728A4 (fr) * 2007-11-30 2011-01-05 Genomictree Inc Coffret et puce de diagnostic pour le cancer de la vessie utilisant un gène marqueur de méthylation spécifique du cancer de la vessie
WO2010009365A1 (fr) 2008-07-18 2010-01-21 Raindance Technologies, Inc. Bibliothèque de gouttelettes
US12038438B2 (en) 2008-07-18 2024-07-16 Bio-Rad Laboratories, Inc. Enzyme quantification
US8962247B2 (en) 2008-09-16 2015-02-24 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US8476013B2 (en) * 2008-09-16 2013-07-02 Sequenom, Inc. Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US8528589B2 (en) 2009-03-23 2013-09-10 Raindance Technologies, Inc. Manipulation of microfluidic droplets
PL2529032T3 (pl) * 2010-01-26 2017-07-31 Nipd Genetics Ltd Sposoby i kompozycje do nieinwazyjnego prenatalnego diagnozowania aneuploidii płodu
US9652585B2 (en) * 2010-03-16 2017-05-16 Bluegnome Limited Comparative genomic hybridization array method for preimplantation genetic screening
BR112013020220B1 (pt) * 2011-02-09 2020-03-17 Natera, Inc. Método para determinar o estado de ploidia de um cromossomo em um feto em gestação
EP3736281A1 (fr) 2011-02-18 2020-11-11 Bio-Rad Laboratories, Inc. Compositions et méthodes de marquage moléculaire
EP2714970B1 (fr) 2011-06-02 2017-04-19 Raindance Technologies, Inc. Quantification d'enzyme
US8658430B2 (en) 2011-07-20 2014-02-25 Raindance Technologies, Inc. Manipulating droplet size
ES2930180T3 (es) 2012-03-02 2022-12-07 Sequenom Inc Métodos para enriquecer ácido nucleico canceroso a partir de una muestra biológica
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
JP2015521862A (ja) 2012-07-13 2015-08-03 セクエノム， インコーポレイテッド 非侵襲性の出生前診断に有用な母体サンプル由来の胎児核酸のメチル化に基づく富化のためのプロセスおよび組成物
EP2971100A1 (fr) 2013-03-13 2016-01-20 Sequenom, Inc. Amorces pour analyse de la méthylation de l'adn
WO2015138774A1 (fr) 2014-03-13 2015-09-17 Sequenom, Inc. Méthodes et procédés d'évaluation non invasive de variations génétiques
EA038117B1 (ru) 2015-05-22 2021-07-08 ЭнАйПиДи ДЖЕНЕТИКС ПАБЛИК КОМПАНИ ЛИМИТЕД Мультиплексный параллельный анализ целевых геномных областей с целью неинвазивного пренатального тестирования
CN105316420A (zh) * 2015-12-01 2016-02-10 钦州市妇幼保健院 一种单管四色双重相对荧光定量pcr技术快速检测人13号和18号染色体数目的试剂盒
CN108330187B (zh) * 2017-01-20 2021-12-10 复旦大学附属儿科医院 一种对细胞中x染色体定量检测的方法和试剂盒
CN108949959A (zh) * 2018-08-09 2018-12-07 南通市第人民医院 法洛四联症患者基因甲基化异常的识别与机制研究方法
CN114634982A (zh) * 2020-12-15 2022-06-17 广州市基准医疗有限责任公司 一种检测多核苷酸变异的方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999001580A1 (fr) * 1997-07-03 1999-01-14 Case Western Reserve University Compositions et procedes de detection de dysfonctionnements d'empreinte genomique
WO2003020974A2 (fr) * 2001-08-31 2003-03-13 The Chinese University Of Hong Kong Methodes de detection d'adn provenant de differents individus

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999001580A1 (fr) * 1997-07-03 1999-01-14 Case Western Reserve University Compositions et procedes de detection de dysfonctionnements d'empreinte genomique
WO2003020974A2 (fr) * 2001-08-31 2003-03-13 The Chinese University Of Hong Kong Methodes de detection d'adn provenant de differents individus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KUROMITSU JUNRO ET AL: "A unique downregulation of h2-calponin gene expression in Down syndrome: A possible attenuation mechanism for fetal survival by methylation at the CpG island in the trisomic chromosome 21" MOLECULAR AND CELLULAR BIOLOGY, vol. 17, no. 2, 1997, pages 707-712, XP002312806 ISSN: 0270-7306 *
MOORE MATHEW W ET AL: "A multiplex methylation PCR assay for identification of uniparental disomy of chromosome 7." HUMAN MUTATION, vol. 21, no. 6, June 2003 (2003-06), pages 645-648, XP008041204 ISSN: 1098-1004 *
PENA S D J ET AL: "Fetal diagnosis of monosomy X (Turner syndrome) with methylation-specific PCR [5]" PRENATAL DIAGNOSIS, vol. 23, no. 9, 1 September 2003 (2003-09-01), pages 769-770, XP008041340 ISSN: 0197-3851 *
SLATER H R ET AL: "Prenatal diagnosis of Prader-Willi syndrome using PW71 methylation analysis--uniparental disomy and the significance of residual trisomy 15." PRENATAL DIAGNOSIS, vol. 17, no. 2, February 1997 (1997-02), pages 109-113, XP008041205 ISSN: 0197-3851 *

Also Published As

Publication number Publication date
ATE415495T1 (de) 2008-12-15
CA2540141C (fr) 2012-09-04
JP2007505641A (ja) 2007-03-15
AU2004274724A2 (en) 2005-03-31
KR20060101470A (ko) 2006-09-25
EP1668154B1 (fr) 2008-11-26
EP1668154A2 (fr) 2006-06-14
CA2540141A1 (fr) 2005-03-31
AU2004274724A1 (en) 2005-03-31
WO2005028674A3 (fr) 2005-09-01
EP2186914A3 (fr) 2010-07-21
JP5013869B2 (ja) 2012-08-29
AU2004274724B2 (en) 2009-09-10
ZA200602319B (en) 2007-08-29
CN1882700A (zh) 2006-12-20
WO2005028674A2 (fr) 2005-03-31
DE602004018009D1 (de) 2009-01-08

Similar Documents

Publication Publication Date Title
EP1668154B1 (fr) Procedes utilises pour detecter une modification dans le nombre de copies d'un locus
US20140193817A1 (en) Methods and kits useful for detecting an alteration in a locus copy number
JP5789605B2 (ja) 染色体異数性の検出方法
US7485418B2 (en) Aberrantly methylated genes in pancreatic cancer
Cirigliano et al. Rapid prenatal diagnosis of common chromosome aneuploidies by QF‐PCR, results of 9 years of clinical experience
EP2529032B1 (fr) Procédés et compositions pour le diagnostic prénatal non invasif d'aneuploïdies foeligtales
EP2010676B1 (fr) Procede et kit pour quantification moleculaire de chromosomes
US20060183128A1 (en) Methods and compositions for differentiating tissues for cell types using epigenetic markers
US20050123914A1 (en) Method of isolating cells and uses thereof
JP2005514956A (ja) 胎児ｄｎａの検出および対立遺伝子の定量化のための方法
EP2298932A1 (fr) Procédé et l'ADN pour l'analyse d'expression du gène, particulièrement la méthylation de KAAG1, employant à classifier des cellules et tissus
AU2013258880A1 (en) Diagnostic gene marker panel for colorectal cancer
EP4108779A1 (fr) Procédé d'évaluation et de prédiction de maladies dérivées du placenta et kit associé
MX2011000566A (es) Genotipificacion no invasora de rhd fetal a partir de sangre completa materna.
US20090123919A1 (en) Diagnosing Pathological Conditions Using Interallelic Epigenetic Variations
Geifman‐Holtzman et al. Detection of fetal HLA‐DQα sequences in maternal blood: A gender‐independent technique of fetal cell identification
US20050112613A1 (en) Methods and reagents for predicting the likelihood of developing short stature caused by FRAXG
JP2004000128A (ja) 造血器腫瘍細胞検出方法および造血器腫瘍細胞検出キット
Puszyk Epigenetics of cell-free plasma DNA for non-invasive prenatal diagnosis of fetal aneuploidies
Schiffman Integrating mutation panel testing and copy number in clinical genomic studies

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AC Divisional application: reference to earlier application

Ref document number: 1668154

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT MK

PUAL Search report despatched

Free format text: ORIGINAL CODE: 0009013

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT MK

AKY No designation fees paid
REG Reference to a national code

Ref country code: DE

Ref legal event code: R108

Effective date: 20110301

Ref country code: DE

Ref legal event code: 8566

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110401