EP2066691A1 - Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik - Google Patents

Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik

Info

Publication number
EP2066691A1
EP2066691A1 EP07822317A EP07822317A EP2066691A1 EP 2066691 A1 EP2066691 A1 EP 2066691A1 EP 07822317 A EP07822317 A EP 07822317A EP 07822317 A EP07822317 A EP 07822317A EP 2066691 A1 EP2066691 A1 EP 2066691A1
Authority
EP
European Patent Office
Prior art keywords
acid
amino acid
phase
resilinprotein
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP07822317A
Other languages
English (en)
French (fr)
Inventor
Claus Bollschweiler
Burghard Liebmann
Marcus Fehr
Daniel HÜMMERICH
Arne Ptock
Evelyn Raunft
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Priority to EP07822317A priority Critical patent/EP2066691A1/de
Publication of EP2066691A1 publication Critical patent/EP2066691A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A61Q17/04—Topical preparations for affording protection against sunlight or other radiation; Topical sun tanning preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • A61Q5/12—Preparations containing hair conditioners
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q1/00—Make-up preparations; Body powders; Preparations for removing make-up
    • A61Q1/02—Preparations containing skin colorants, e.g. pigments
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/002—Aftershave preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/004—Aftersun preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/04—Preparations for care of the skin for chemically tanning the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/10—Washing or bathing preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • A61Q5/02—Preparations for cleaning the hair
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • A61Q5/06—Preparations for styling the hair, e.g. by temporary shaping or colouring

Definitions

  • the present invention relates to the use of natural, recombinant and synthetic Resilinproteinen in cosmetics, in particular in the skin cosmetics.
  • WO 2004/104042 describes the preparation of a natural proresilin fragment and the further processing by cross-linking into a bioelastomer and its use.
  • WO 2004/104043 describes protein sequences based on repetitive sequences of natural Resilinproteine, as well as the further processing by cross-linking to bioelastomers and their use.
  • the present invention relates to novel cosmetic or dermatological compositions which contain as active ingredient at least one natural, recombinant or synthetic resiline of insects or an analogue of such a protein.
  • compositions which are presented as products for hair treatment, skin care products, make-up products, or sun protection products based on a resilin protein of insects.
  • resilin proteins in addition to their known properties, can impart unexpected properties to cosmetic or dermatological compositions and, in particular, can improve the hydrating or softening effect.
  • the Resilines behave like good film formers and, above all, have a low surface density.
  • the present invention therefore relates, as a new technical product, to a cosmetic or dermatological composition containing an effective amount of at least one natural recombinant or synthetic resin or an analog of such a protein.
  • the resilins are preferably natural resilin which is obtained from insects.
  • the resilins are preferably recombinant resilins of insects.
  • a natural DNA sequence coding for Resilin or Resilin fragments is isolated from insects, heterologously expressed in an expression organism and the recombinant Resilinprotein isolated therefrom.
  • the nucleotide sequence of the isolated DNA can be further modified by molecular biological methods.
  • the resilins are preferably synthetic resilins.
  • Gene sequences coding for protein sequences based on repeating units of natural resilin proteins are synthesized by chemical and molecular biological methods.
  • the synthetic genes are heterologously expressed in an expression organism and the synthetic resilin protein is isolated therefrom.
  • the recombinant and synthetic resilins have the advantage that they have a peptide sequence whose physicochemical properties can be adjusted depending on the desired cosmetic or dermatological applications.
  • compositions according to the invention may contain at least one natural or recombinant or synthetic Resilinprotein in an effective amount.
  • Resilinproteine containing a plurality of repeating units, preferably 1-100, more preferably 10-40, and advantageously 15-33 repeating units with the consensus sequence SXXYGXP, where S is a serine, X is any Amino acid, Y is a tyrosine, G is a glycine and P is a proline.
  • S is a serine
  • X is any Amino acid
  • Y is a tyrosine
  • G is a glycine
  • P is a proline.
  • X is selected from the group of charged and polar amino acids.
  • the repeating unit contains the consensus sequence:
  • X 4 is proline, alanine, threonine or serine S serine
  • X5 is a charged or polar amino acid
  • X ⁇ is a charged or polar amino acid
  • Y is a tyrosine
  • G is a glycine X7, a proline, alanine, threonine or serine
  • Xe is a glycine, alanine, threonine or serine
  • Xg is a glycine a polar amino acid or no amino acid
  • X10 a glycine is a polar amino acid or no amino acid
  • X11 is any or no amino acid.
  • Xi is, if present, a G, Y, A or N, preferably a G.
  • X2, if present, is a basic amino acid, G, L, Q, preferably G.
  • X3, if present, is R, K, T or P; X 4 is preferably a P;
  • X5 is preferably a D, T or S; X ⁇ is preferably an S, Q or T; X7 is preferably an A; Xs is preferably a G; Xg, if present, is preferably a G, Q or S, most preferably a G; X10, if present, is preferably a G, S or N, most preferably a G; X11 if present is preferably a G, Q, P, S or N.
  • At least one of the amino acids Xe, Xg and X10 is a G, preferably
  • consensus sequence refers to an amino acid (or nucleotide) sequence that uniquely identifies amino acids found at a particular position in terms of residue and position, while other amino acids are not specified, but instead of wildcard X instead of the amino acid commonly used one letter codes for amino acids.
  • the one-letter code for amino acids used herein is known to those skilled in the art.
  • the repeating units of the resilin proteins may be the same or different.
  • the repeating units may be linked by linkers which preferably contain 1 to 30 amino acids, more preferably 1 to 20 amino acids.
  • the amino acid sequence of a linker can be derived from other proteins, preferably structural proteins, or have no natural role model or be completely absent.
  • the distance of an amino acid within a repeat unit to the equivalency amino acid within the adjacent repeat unit may be 8 to 50 amino acids, preferably 8 to 34, and more preferably 10 to 25 and most preferably 10 to 16 amino acids. Any number of repeating units, preferably from 1 to 100, more preferably from 10 to 65, and most preferably from 15 to 35, may be added together.
  • the protein contains the repeat unit GAPGGGNGGRPSDTY or GAPGGGNGGRPSSSY.
  • sequence of the protein or parts thereof corresponds to SEQ ID NO 1 or parts of this sequence.
  • Amino acid 1-15 of SEQ ID NO: 1 represents a T7 tag fused to the actual resilin protein.
  • the resilin proteins according to the invention can be produced with or without such tags. It is also possible to replace the T7 tag with other similarly effective tags that can facilitate the identification and isolation of the resilin proteins.
  • sequence of the protein or parts thereof corresponds to SEQ ID NO 3 or parts of this sequence.
  • sequence of the protein or parts thereof corresponds to the peptide sequence or parts thereof of the resilin protein from other insects such as e.g. Anopheles gambiae, Apis mellifera, Ctenocephalides felis, Haematobia irritans exigua.
  • insects such as e.g. Anopheles gambiae, Apis mellifera, Ctenocephalides felis, Haematobia irritans exigua.
  • the peptide sequences of these proteins are published in WO04 / 104042, which is incorporated herein by reference.
  • the resilin protein is part of a hybrid protein.
  • the hybrid protein consists of one or more resilin or derived sequences or fragments of these sequences, as well as one or more further protein sequences or fragments of these sequences.
  • These further proteins may preferably be structural proteins, such as e.g. Silk protein, spider silk protein, keratin, elastin, collagen, gluten, abductin, mussel byssus protein.
  • Resilinproteinen takes place by expression of natural or synthetically produced gene sequences. Methods for the isolation and modification of natural gene sequences are known to the person skilled in the art.
  • Nonlimiting examples of prokaryotic expression organisms are Escherichia coli, Bacillus subtilis, Bacillus megaterium, Corynebacterium glutamicum, etc.
  • Nonlimiting examples of eukaryotic expression organisms are yeasts such as Saccharomyces cerevisiae, Pichia pastoris and others, filamentous fungi such as Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Trichoderma reesei, Acremonium chrysoum, etc., mammalian cells, such as Heia cells, COS cells, CHO cells, among others, insect cells, such as Sf9 cells, MEL cells, among others, plants or plant cells, such as Solanum tuberosum, Nicotiana, and others ,
  • the term "effective amount" of at least one natural, recombinant or synthetic resilin protein of insects or an analogous compound corresponds to an amount of from about 0.001 to 30% by weight, but preferably from 0.01 to 15% by weight. %, based on the total weight of the composition, wherein the proportion may vary depending on the type of cosmetic or dermatological composition.
  • “functional equivalents” are in particular also understood as meaning mutants which, in at least one sequence position of the abovementioned amino acid sequences, have a different amino acid than the one specifically mentioned but nevertheless possess one of the abovementioned properties.
  • “Functional equivalents” thus include those represented by multiple amino acid additions, substitutions, deletions and / or inversions of available mutants, said changes may occur in any sequence position, as long as they lead to a mutant with the property profile according to the invention. Functional equivalence is especially given when the reactivity patterns between mutant and unchanged polypeptide are qualitatively consistent.
  • “Functional equivalents” in the above sense are also “precursors” of the described polypeptides as well as “functional derivatives” and “salts” of the polypeptides. "Precursors” are natural or synthetic precursors of the polypeptides with or without the desired biological activity.
  • Salts are understood as meaning both salts of carboxyl groups and acid addition salts of amino groups of the protein molecules of the invention.
  • Salts of carboxyl groups can be prepared in a manner known per se and include inorganic salts such as, for example, sodium, calcium, ammonium, egg salts and salts with organic bases, such as, for example, amines, such as triethanolamine, arginine, lysine, piperidine, etc.
  • Acid addition salts for example salts with mineral acids, such as hydrochloric acid or sulfuric acid, and salts with organic acids, such as acetic acid and Oxalic acid are also the subject of the invention.
  • “Functional derivatives” of polypeptides of the invention may be attached to functional amino acid side groups or to their N- or C-terminal end by known means Techniques are also produced. Such derivatives include, for example, aliphatic esters of carboxylic acid groups, amides of carboxylic acid groups, obtainable by reaction with ammonia or with a primary or secondary amine; N-acyl derivatives of free amino groups prepared by reaction with acyl groups; or O-acyl derivatives of free hydroxy groups prepared by reaction with acyl groups.
  • effector molecule refers to molecules which have a certain, predictable effect. These may be either proteinaceous molecules such as enzymes or non-proteinogenic molecules such as dyes, sunscreens, vitamins, provitamins, antioxidants and fatty acids, conditioners or metal ion-containing compounds.
  • enzymes and proteins with specific binding properties are preferred.
  • oxidases peroxides, proteases, glucanases, mutanase, tyrosinases, laccases, metal binding enzymes, lactoperoxidase, lysozyme, amyloglycosidase, glucose oxidase, superoxide dismutase, photolyase, T4 endonuclease, catalase, thioredoxin, thioredoxin Reductase.
  • effector molecules hydrophobins, collagen, carotenoid-binding proteins, heavy-metal-binding proteins, odorant-binding proteins, cellulose-binding proteins, starch-binding proteins, keratin-binding proteins.
  • hydrolysates of proteins from plant and animal sources for example hydrolyzates of proteins of marine origin.
  • carotenoids are preferred.
  • carotenoids are to be understood as meaning the following compounds and their esterified or glycosylated derivatives: .beta.-carotene, lycopene, lutein, astaxanthin, zeaxanthin, cryptoxanthin, citranaxanthin, canthaxanthin, bixin, .beta.-apo-4-carotenal, .beta.-apo 8 -carotinal, ⁇ -apo-8-carotenoic acid ester, neurospores, echinenone, adonirubin, violaxxin, torules, torularhodin, singly or as a mixture.
  • Rotinoids are beta-carotene, lycopene, lutein, astaxanthin, zeaxanthin, citranaxanthin and canthaxanthin.
  • Further preferred effector molecules are UV light protection filters.
  • organic substances capable of absorbing ultraviolet rays and absorbing the absorbed energy in the form of longer wavelength radiation, e.g. Heat, give it up again.
  • the organic substances may be oil-soluble or water-soluble.
  • oil-soluble UV-B filters e.g. the following substances are used:
  • 4-aminobenzoic acid derivatives preferably 2-ethylhexyl 4- (dimethylamino) benzoate, 2-octyl 4- (dimethylamino) benzoate and 4- (dimethylamino) benzoic acid ester;
  • esters of cinnamic acid preferably 2-ethylhexyl 4-methoxycinnamate, 4-propyl methoxy cinnamate, isoamyl 4-methoxycinnamate, 4-isoacetyl methoxycinnamate, 2-cyano-3-phenylcinnamic acid 2-ethylhexyl ester (octocrylene);
  • Esters of salicylic acid preferably 2-ethylhexyl salicylate, 4-isopropylbenzyl salicylate, homomenthyl salicylate;
  • benzophenone preferably 2-hydroxy-4-methoxybenzophenone, 2-hydroxy-4-methoxy-4'-methylbenzophenone, 2,2'-dihydroxy-4-methoxybenzophenone;
  • Esters of benzalmalonic acid preferably di-2-ethylhexyl 4-methoxybenzmalonate
  • Triazine derivatives such as 2,4,6-trianilino- (p-carbo-2'-ethyl-1 '-hexyloxy) -1, 3,5-triazine (octyl tyltriazone) and Dioctyl Butamido Triazone (Uvasorb HEB ®):
  • Propane-1,3-diones e.g. 1- (4-tert-butylphenyl) -3- (4'-methoxyphenyl) propane-1,3-dione.
  • Suitable water-soluble substances are:
  • Sulfonic acid derivatives of the 3-benzylidene camphor e.g. 4- (2-Oxo-3-bornylidenemethyl) benzenesulfonic acid and 2-methyl-5- (2-oxo-3-bomylidene) -sulfonic acid and its salts.
  • esters of cinnamic acid preferably 4-methoxycinnamic acid 2-ethylhexyl ester, 4-methoxycinnamic acid isopentyl ester, 2-cyano-3-phenylcinnamic acid 2-ethylhexyl ester (octocrylene).
  • Typical UV-A filters are:
  • benzoylmethane such as 1- (4'-tert-butylphenyl) -3- (4'-methoxyphenyl) propane-1,3-dione, 4-tert. Butyl 4'-methoxydibenzoylmethane or 1-phenyl-3- (4'-isopropylphenyl) -propane-1,3-dione;
  • Amino-hydroxy-substituted derivatives of benzophenones e.g. N, N-diethylamino-hydroxybenzoyl-n-hexylbenzoate.
  • UV-A and UV-B filters can also be used in mixtures.
  • Suitable UV filter substances are mentioned in the following table.
  • secondary light stabilizers of the antioxidant type which interrupt the photochemical reaction chain which is triggered when UV radiation penetrates into the skin.
  • these are superoxide dismutase, catalase, tocopherols (vitamin E), coenzyme Q10, ubiquinones, quinones and ascorbic acid (vitamin C).
  • anti-irritants that have an anti-inflammatory effect on UV-damaged skin.
  • Such substances are, for example, bisabolol, phytol and phytantriol.
  • effector molecules are furthermore inorganic pigments which block UV radiation.
  • pigments based on metal oxides and / or other sparingly water-soluble or insoluble metal compounds selected from the group consisting of the oxides of zinc (ZnO), titanium (TiO 2), iron (eg Fe 2 O 3), zirconium (ZrO 2), silicon (SiO 2), Manganese (eg MnO), aluminum (Al2O3), Cers (eg Ce2O3), mixed oxides of the corresponding metals and mixtures of such oxides.
  • the inorganic pigments may be present in coated form, i. that they are superficially treated.
  • This surface treatment can be, for example, that the pigments are provided in a manner known per se, as described in DE-A-33 14 742, with a thin hydrophobic layer.
  • Retinoids in the context of the present invention are vitamin A alcohol (retinol) and its derivatives such as vitamin A aldehyde (retinal), vitamin A acid (retinoic acid) and vitamin A esters (eg retinyl acetate, retinyl propionate and retinyl palmitate).
  • retinoic acid encompasses both all-trans retinoic acid and 13-cis retinoic acid.
  • retinol and retinal preferably include the all-trans compounds.
  • the preferred retinoid used for the suspensions of the invention all-trans-retinol, hereinafter referred to as retinol.
  • vitamins are vitamins, provitamins and vitamin precursors from groups A, C, E and F, in particular 3,4-didehydroretinol, .beta.-carotene (provitamin of vitamin A), ascorbic acid (vitamin C) and the palmitic acid esters, glucosides or phosphates of ascorbic acid, tocopherols, especially ⁇ -tocopherol and its esters, eg the acetate, nicotinate, phosphate and succinate; vitamin F, which is understood as meaning essential fatty acids, especially linoleic acid, linolenic acid and arachidonic acid.
  • vitamins, provitamins and vitamin precursors from groups A, C, E and F in particular 3,4-didehydroretinol, .beta.-carotene (provitamin of vitamin A), ascorbic acid (vitamin C) and the palmitic acid esters, glucosides or phosphates of ascorbic acid,
  • vitamins, provitamins or vitamin precursors of the vitamin B group or derivatives thereof which are preferably to be used according to the invention and the derivatives of 2-furanone include, inter alia:
  • Vitamin B 1 trivial name thiamine, chemical name 3 - [(4'-amino-2'-methyl-5'-pyrimidinyl) methyl] -5- (2-hydroxyethyl) -4-methylthiazolium chloride.
  • Vitamin B 2 trivial name riboflavin, chemical name 7,8-dimethyl-10- (1-D-ribityl) -benzo [g] pteridine-2,4 (3H, 10H) -dione.
  • riboflavin z As in whey, other riboflavin derivatives can be isolated from bacteria and yeasts.
  • a stereoisomer of riboflavin which is also suitable according to the invention is lyxoflavin which can be isolated from fishmeal or liver and carries a D-arabityl residue instead of D-ribityl.
  • Vitamin B 3 Vitamin B 3 .
  • the compounds nicotinic acid and nicotinamide (niacinamide) are often performed.
  • the nicotinic acid amide is preferred.
  • Vitamin B 5 pantothenic acid and panthenol.
  • Panthenol is preferably used.
  • Derivatives of panthenol which can be used according to the invention are, in particular, the esters and ethers of panthenol and also cationically derivatized panthenols.
  • Particularly preferred derivatives are the commercially available substances dihydro-3-hydroxy-4,4-dimethyl-2 (3H) -furanone with the trivial name pantolactone (Merck), 4 hydroxymethyl- ⁇ - butyrolactone (Merck), 3,3-dimethyl-2-hydroxy- ⁇ -butyrolactone (Aldrich) and 2,5-dihydro-5-methoxy-2-furanone (Merck), expressly including all stereoisomers.
  • these effector molecule compounds impart moisturizing and skin-soothing properties to the resilin proteins according to the invention.
  • Vitamin B 6 which is understood here not a single substance, but the known under the common names pyridoxine, pyridoxamine and pyridoxal derivatives of 5-hydroxymethyl-2-methylpyridin-3-ols.
  • Vitamin B 7 also known as vitamin H or "skin vitamin”.
  • Biotin is (3aS, 4S, 6aR) -2-oxohexahydrothienol [3,4-d] imidazole-4-valeric acid.
  • Panthenol, pantolactone, nicotinamide and biotin are very particularly preferred according to the invention.
  • suitable derivatives salts, esters, sugars, nucleotides, nucleosides, peptides and lipids
  • suitable derivatives can be used as effector molecules.
  • lipophilic oil-soluble antioxidants from this group, tocopherol and its derivatives, gallic acid esters, flavonoids and carotenoids, and butylhydroxytoluene / anisole are preferred.
  • water-soluble antioxidants are amino acids, eg. As tyrosine and cysteine and their derivatives and tanning agents, especially those of plant origin are preferred.
  • peroxide decomposed i.
  • Compounds which are able to decompose peroxides particularly preferably lipid peroxides.
  • organic substances such as e.g. Pyridine-2-thiol-3-carboxylic acid, 2-methoxy-pyrimidinol-carboxylic acids, 2-methoxy-pyridinecarboxylic acids, 2-dimethylaminopyrimidinolcarboxylic acids, 2-dimethylaminopyridinecarboxylic acids.
  • Triterpenes in particular triterpenic acids such as ursolic acid, rosmarinic acid, betulinic acid, boswellic acid and bryonic acid.
  • Another preferred effector molecule is lipoic acid and suitable derivatives (salts, esters, sugars, nucleotides, nucleosides, peptides and lipids).
  • Further preferred effector molecules are fatty acids, in particular saturated fatty acids which carry an alkyl branching, particularly preferably branched eicosanoic acids, such as 18-methyl-eicosanoic acid.
  • Further preferred effector molecules are dyes, for example food dyes, semipermanent dyes, reactive or oxidation dyes.
  • the oxidation dyes it is preferable to link a component as effector molecule with the Resilinproteinen and then to couple at the site of action, ie after application to skin, oxidatively with the second dye component.
  • oxidation dyes it is also preferable to carry out the coupling of the color components before the linkage with the resilin proteins.
  • the reactive dyes can furthermore preferably be linked to the resilin proteins as a component as the effector molecule and then applied to the skin. Furthermore, those dyes which are linked as effector molecule with the Resilinproteinen be applied by application to skin in decorative cosmetics.
  • Suitable dyestuffs are all customary hair dyestuffs for the molecules according to the invention. Suitable dyes are the expert from manuals of cosmetics such as Schrader, bases and formulations of cosmetics, Weghig Verlag, Heidelberg, 1989, ISBN 3-7785-1491-1 known.
  • Particularly advantageous dyes are those mentioned in the following list.
  • the Color Index Numbers (CIN) are taken from the Rowe Color Index, 3rd Edition, Society of Dyers and Colourists, Bradford, England, 1971.
  • the effector molecules are linked to the resilin protein.
  • the connection between effector molecule and protein and may be both a covalent bond and based on ionic or van der Waals interactions or hydrophobic interactions or hydrogen bonds or adsorption.
  • the covalent linking of the effector molecule can take place via the side chains of the polypeptide sequence of the resilin protein, in particular via amino functions or hydroxyl functions or carboxylate functions or thiol functions.
  • Preferred is a linkage via the amino functions of one or more lysine residues, via the carboxylate functions of one or more glutamate or aspartate residues, via the thiol function of one or more cysteine residues or via the N-terminal or C-terminal function of the resilin protein.
  • amino acids with suitable functions e.g., cysteines, lysines, aspartates, glutamates
  • amino acids with suitable functions e.g., cysteines, lysines, aspartates, glutamates
  • amino acids of the resilin protein can be substituted by such amino acid functions.
  • the linkage of the effector molecules with the Resilinprotein can be done directly, ie as a covalent linkage of two existing chemical functions.
  • the chemical functions of the resilin proteins described above are linked to reactive groups contained in the effector molecules.
  • reactive groups are sulfhydryl-reactive groups, for example maleimides, pyridyl disulfides, ⁇ -haloacetyls, vinyl sulfones, sulfatoalkyl sulfones (preferably sulfatoethyl sulfones), amine-reactive groups (for example succinimidyl esters, carbodiimde, hydroxymethyl phosphine, imidoester, PFP).
  • sulfhydryl-reactive groups for example maleimides, pyridyl disulfides, ⁇ -haloacetyls, vinyl sulfones, sulfatoalkyl sulfones (preferably s
  • carboxy-reactive groups eg, amines, etc.
  • hydroxyl-reactive groups eg, isocyanates, etc.
  • unselective groups eg, arylazides, etc.
  • photoactivatable groups eg, perfluorophenyl azide, etc.
  • the linkage can also be via a so-called linker, i.
  • An at least bifunctional molecule is formed which binds with one or more functions with the effector molecule and is linked to the resilin protein with one or more other functions.
  • the use of such tailored linker allows the exact adaptation of the linkage to the desired effector molecule. In addition, it is thereby possible to link several effector molecules with a resident protein in a defined manner.
  • the linker used depends on the functionality to be coupled. Suitable are e.g. Molecules that couple to a Resilinproteine means
  • Sulfhydryl-reactive groups e.g. Maleimides, pydridyl disulfides, ⁇ -haloacetyls, vinylsulfones, sulfatoalkyl sulfones (preferably sulfatoethyl sulfones), amine-reactive groups (eg succinimidyl esters, carbodiimde, hydroxymethyl phosphine, imido esters, PFP esters, aldehyde, isothiocyanate etc.), carboxy-reactive groups ( eg amines, etc.), hydroxyl-reactive groups (eg isocyanates etc.), unselective groups (eg arylazides etc.) and photoactivatable groups (eg perfluorophenyl azide etc.) and to effector molecules by means of - sulfhydryl-reactive groups (eg maleimides, pydridyl disulfides , ⁇ -
  • Hydroxyl-reactive groups e.g., isocyanates, etc.
  • thymine-reactive groups e.g., psoralen, etc.
  • nonselective groups e.g., aryl azides, etc.
  • photoactivatable groups e.g., perfluorophenyl azide, etc.
  • metal-complexing groups e.g., EDTA, hexahis, ferritin.
  • Antibodies and fragments e.g., single-chain antibodies, F (ab) fragments of antibodies, catalytic antibodies.
  • Spacerelemete can be composed of, for example, alkyl chains, ethylene glycol and polyethylene glycols.
  • linker and / or spacer elements which have a potential cleavage site for a protease, lipase, esterase, phosphatase, hydrolase, ie are enzymatically cleavable.
  • Examples of enzymatically cleavable linkers which can be used in the molecules according to the invention are mentioned, for example, in WO 98/01406, to the entire contents of which reference is hereby expressly made.
  • linkers and spacers which are thermally dissociable, photocleavable.
  • Corresponding chemical structures are known to the person skilled in the art and are integrated between the molecule parts effector molecule and resilin protein.
  • effector molecule consists of a polypeptide sequence
  • linkage of effector and resilin protein may take place as a so-called fusion protein, i. a continuous polypeptide sequence composed of effector and resine protein subsequences is used.
  • spacer elements between effector and resilin protein, for example polypeptide sequences which have a potential cleavage site for a protease, lipase, esterase, phosphatase, hydrolase or ONgo and polypeptide sequences which permit easy purification of the fusion protein, For example, so-called His-tags, ie Oligohistidinreste.
  • the covalently or non-covalently coupled to Resilinproteine effector molecules may be active in their bonded form.
  • the effector molecules coupled to resilin proteins can also be released from the resilin proteins.
  • the release of covalently coupled effector molecules from the resiliproteins can be achieved by cleavage of specifically incorporated cleavable spacers or coupling linkers, e.g. thermally cleavable, photocleavable or enzymatically cleavable, but also by proteolytic degradation (e.g., by proteases).
  • the Resilinproteine be formulated with conventional other active ingredients and excipients found in cosmetics.
  • the resilin proteins according to the invention are preferably used for skin cosmetics.
  • auxiliaries and additives for the production of hair cosmetic, nail cosmetic or skin cosmetic preparations are familiar to the expert and can from manuals of cosmetics, such as Schrader, bases and formulations of cosmetics, Weghig Verlag, Heidelberg, 1989, ISBN 3-7785-1491-1 , are taken.
  • the cosmetic agents according to the invention may be skin-cosmetic, nail-cosmetic, hair-cosmetic, dermatological, hygienic or pharmaceutical agents.
  • the agents according to the invention are preferably in the form of a gel, foam, spray, ointment, cream, emulsion, suspension, lotion, milk or paste. If desired, liposomes or microspheres can also be used.
  • the cosmetically or pharmaceutically active agents according to the invention may additionally contain cosmetically and / or dermatologically active agents as well as excipients.
  • the cosmetic compositions according to the invention preferably comprise at least one resilin protein and at least one different constituent selected from cosmetically active ingredients, emulsifiers, surfactants, preservatives, perfume oils, thickeners, hair polymers, hair and skin conditioners, graft polymers, water-soluble or dispersible silicone-containing polymers, Sunscreens, bleaches, gelling agents, conditioners, colorants, tinting agents, tanning agents, dyes, pigments, bodying agents, moisturizers, restoats, collagen, protein hydrolysates, lipids, antioxidants, defoamers, antistatic agents, emollients and plasticizers.
  • the Resilinproteine can also be contained in encapsulated form in the cosmetic preparations.
  • the antioxidants are selected from the group consisting of amino acids (eg glycine, histidine, tyrosine, tryptophan) and their derivatives, imidazolones (eg urocaninic acid) and their derivatives, peptides such as D, L-carnosine, D-carnosine, L Carnosine and its derivatives (eg anserine), carotenoids, carotenes (eg .beta.-carotene, lycopene) and their derivatives, chlorogenic acid and its derivatives, lipoic acid and derivatives thereof (eg dihydrolipoic acid), aurothioglucose, propylthiouracil and other thiols (eg thiorodoxin , Glutathione, cysteine, cystine, cystamine and their glycosyl, N-acetyl, methyl, ethyl, propyl, amyl, butyl, and lauryl, palmitoyl,
  • Hexa-, heptathionine-sulfoximine in very low compatible dosages (eg pmol to ⁇ mol / kg), furthermore (metal) chelators (eg ⁇ -hydroxyfatty acids, palmitic acid, phytic acid, lactoferrin), ⁇ -hydroxy acids (eg citric acid, Lactic acid, malic acid), humic acid, bile acids, bile extracts, bilirubin, biliverdin, EDTA and their derivatives, unsaturated fatty acids and their derivatives (eg ⁇ -linolenic acid, linoleic acid, oleic acid), folic acid and its derivatives, ubiquinone and ubiquinol and derivatives thereof, Vitamin C and its derivatives (eg, sodium ascorbate, ascorbyl palmitate, Mg ascorbyl phosphate, ascorbyl acetate), tocopherol and derivatives (eg, vitamin E acetate, tocotrieno
  • peroxide decomposers i. Compounds which are able to decompose peroxides, particularly preferably lipid peroxides.
  • organic substances such as e.g. Pyridine-2-thiol-3-carboxylic acid, 2-methoxy-pyrimidinol-carboxylic acids, 2-methoxy-pyridinecarboxylic acids, 2-dimethylaminopyrimidinolcarboxylic acids, 2-dimethylaminopyridinecarboxylic acids.
  • Typical thickeners in such formulations are crosslinked polyacrylic acids and their derivatives, polysaccharides and their derivatives, such as xanthan gum, agar-agar, alginates or tyloses, cellulose derivatives, e.g. Carboxymethylcellulose or hydroxycarboxymethylcellulose, fatty alcohols, monoglycerides and fatty acids, polyvinyl alcohol and polyvinylpyrrolidone.
  • Nonionic thickeners are preferably used.
  • Suitable cosmetically and / or dermatologically active agents are e.g. coloring active substances, skin and hair pigmenting agents, tinting agents, suntanning agents, bleaching agents, keratin-hardening substances, antimicrobial agents, light-filtering active ingredients, repellent active ingredients, hyperemic substances, keratolytic and keratoplasmic substances, antidandruff active ingredients, antiphlogistics, keratinizing substances, antioxidant or as antioxidants Radical scavengers active ingredients, skin moisturizing or moisturizing substances, moisturizing agents, anti-erythemic or anti-allergic active ingredients, branched fatty acids such as 18-Methyleicosanklare, and mixtures thereof.
  • coloring active substances e.g. coloring active substances, skin and hair pigmenting agents, tinting agents, suntanning agents, bleaching agents, keratin-hardening substances, antimicrobial agents, light-filtering active ingredients, repellent active ingredients, hyperemic substances, keratolytic and kera
  • Artificial skin tanning agents which are suitable for tanning the skin without natural or artificial irradiation with UV rays are e.g. Dihydroxyacetone, alloxan and walnut shark extract.
  • Suitable keratin-hardening substances are, as a rule, active ingredients as are also used in antiperspirants, such as, for example, antiperspirants. Potassium aluminum sulfate, aluminum hydroxychloride, aluminum lactate, etc.
  • Antimicrobial agents are used to destroy microorganisms or to inhibit their growth and thus serve both as a preservative and as a deodorizing substance, which reduces the formation or intensity of body odor.
  • These include, for example, customary preservatives known to the person skilled in the art, such as p-hydroxybenzoic acid ester, imidazolidinyl urea, formaldehyde, sorbic acid, benzoic acid, salicylic acid, etc.
  • Such substances having a deodorizing action are, for example, zinc ricinoleate, triclosan, undecylenic acid alkylolamides, citric acid triethyl lester, chlorhexidine etc.
  • Suitable preservatives which are listed below with their E number are to be used advantageously according to the invention.
  • preservatives or preservatives which are common in cosmetics according to the invention are dibromodicyanobutane (2-bromo-2-bromomethylglutarodinitrile), 3-iodo-2-propynyl butylcarbamate, 2-bromo-2-nitro-propane-1,3-diol, imidazolidinyl urea, 5-chloro - 2-methyl-4-isothiazolin-3-one, 2-chloroacetamide, benzalkonium chloride, benzyl alcohol suitable, Formaldehydabspalter.
  • phenylhydroxyalkyl ethers in particular the compounds known as phenoxyethanol, are suitable as preservatives because of their bactericidal and fungicidal effects on a number of microorganisms.
  • Advantageous substances are, for example, 2,4,4'-trichloro-2'-hydroxydiphenyl ether (Irgasan), 1, 6-di- (4-chlorphenylbiguanido) - hexane (chlorhexidine), 3,4,4'-trichlorocarbanilide, quaternary ammonium compounds , Clove oil, mint oil, thyme oil, triethyl citrate, farnesol (3,7,1-trimethyl-2,6,10-dodecatrien-1-ol) and in the patent publications DE-37 40 186, DE-39 38 140, DE -42 04 321, DE-42 29 707, DE-43 09 372, DE-44 11 664, DE-195 41 967, DE-195 43 695, DE-195 43 696, DE-195 47 160, DE-196 02 108, DE-196 02 110, DE 196 02 11 1, DE-196 31 003, DE-196 31 004 and DE-196 34
  • Irgasan 1,
  • Suitable light filter active substances are substances which absorb UV rays in the UV-B and / or UV-A range.
  • Suitable UV filters are e.g. 2,4,6-triaryl-1, 3,5-triazines in which the aryl groups can each bear at least one substituent, which is preferably selected from hydroxy, alkoxy, especially methoxy, alkoxycarbonyl, especially methoxycarbonyl and ethoxycarbonyl and mixtures thereof ,
  • substituent which is preferably selected from hydroxy, alkoxy, especially methoxy, alkoxycarbonyl, especially methoxycarbonyl and ethoxycarbonyl and mixtures thereof .
  • p-aminobenzoic acid esters cinnamic acid esters, benzophenones, camphor derivatives and UV-radiation-stopping pigments, such as titanium dioxide, talc and zinc oxide.
  • Suitable UV filter substances are any UV-A and UV-B filter substances.
  • UV-A and UV-B filter substances are any UV-A and UV-B filter substances.
  • the cosmetic and dermatological preparations according to the invention may advantageously also contain UV-blocking inorganic pigments based on metal oxides and / or other sparingly soluble or insoluble metal compounds selected from the group of the oxides of zinc (ZnO), titanium (TiO 2 ), iron ( eg Fe 2 O 3 ), zirconium (ZrO 2 ), silicon (SiO 2 ), manganese (eg MnO), aluminum (Al 2 O 3 ), cerium (eg Ce 2 O 3 ), mixed oxides of the corresponding metals and mixtures thereof Contain oxides.
  • the inorganic pigments can be present in coated form, ie they are treated on the surface.
  • This surface treatment can be, for example, that the pigments are provided in a manner known per se, as described in DE-A-33 14 742, with a thin hydrophobic layer.
  • Suitable repellent agents are compounds capable of preventing or repelling certain animals, particularly insects, from humans. These include, for example, 2-ethyl-1,3-hexanediol, N, N-diethyl-m-toluamide, etc.
  • Suitable hyperemic substances which stimulate the perfusion of the skin are, for example, essential oils, such as mountain pine extract, lavender extract, rosemary extract, juniper berry extract, Horse chestnut extract, birch leaf extract, hay flower extract, ethyl acetate, camphor, menthol, peppermint oil, rosemary extract, eucalyptus oil, etc.
  • Suitable keratolytic and keratoplastic substances are, for example, salicylic acid, calcium thioglycolate, thioglycolic acid and its salts, sulfur, etc.
  • Suitable antidandruff active substances are, for example, sulfur Sulfur polyethylene glycol sorbitan monooleate, sulfur ricinol polyethoxylate, zinc pyrithione, aluminum pyrithione, etc.
  • Suitable antiphlogistic agents which counteract skin irritation include allantoin, bisabolol, dragosantol, chamomile extract, panthenol, etc.
  • the cosmetic agents according to the invention may contain as cosmetic and / or pharmaceutical active ingredient (as well as optionally as excipient) at least one cosmetically or pharmaceutically acceptable polymer.
  • cosmetically or pharmaceutically acceptable polymer include, in general, cationic, amphoteric and neutral polymers.
  • Suitable polymers are e.g. cationic polymers called polyquaternium according to INCI, e.g. Copolymers of vinylpyrrolidone / N-vinylimidazolium salts (Luviquat FC, Luviquat HM, Luviquat MS, Luviquat & commat, Care), copolymers of N-vinylpyrrolidone / dimethylaminoethyl methacrylate, quaternized with diethyl sulfate (Luviquat PQ 11), copolymers of N-vinylcaprolactam / N-vinylpyrrolidone / N
  • Vinylimidazolium salts (Luviquat E Hold), cationic cellulose derivatives (polyquaternium-4 and -10), acrylamidocopolymers (Polyquaternium-7) and chitosan.
  • Suitable cationic (quaternized) polymers are also merquat (dimethyl diallyl ammonium chloride based polymer), gafquat (quaternary polymers formed by reaction of polyvinyl pyrrolidone with quaternary ammonium compounds), polymer JR (hydroxyethyl cellulose with cationic groups), and plant based cationic polymers, e.g. Guarpolymers, such as the Jaguar brands of Rhodia.
  • polystyrene resins are also neutral polymers, such as polyvinylpyrrolidones, copolymers of N-vinylpyrrolidone and vinyl acetate and / or vinyl propionate, polysiloxanes, polyvinylcaprolactam and other copolymers with N-vinylpyrrolidone, polyethylenimines and their salts, polyvinylamines and their salts, cellulose derivatives, Polyasparaginic acid salts and derivatives.
  • neutral polymers such as polyvinylpyrrolidones, copolymers of N-vinylpyrrolidone and vinyl acetate and / or vinyl propionate, polysiloxanes, polyvinylcaprolactam and other copolymers with N-vinylpyrrolidone, polyethylenimines and their salts, polyvinylamines and their salts, cellulose derivatives, Polyasparaginic acid salts and derivatives.
  • Suitable polymers are also nonionic, water-soluble or water-dispersible polymers or oligomers, such as polyvinylcaprolactam, for example Luviskol 0 Plus (BASF), or polyvinylpyrrolidone and their copolymers, in particular with vinyl esters, such as vinyl acetate, for example Luviskol 0 VA 37 (BASF), polyamides , For example, based on itaconic acid and aliphatic diamines, as described for example in DE-A-43 33 238.
  • polyvinylcaprolactam for example Luviskol 0 Plus (BASF)
  • BASF Luviskol 0 VA 37
  • BASF Luviskol 0 VA 37
  • polyamides For example, based on itaconic acid and aliphatic diamines, as described for example in DE-A-43 33 238.
  • Suitable polymers are also amphoteric or zwitterionic polymers, such as those available under the names Amphomer (National Starch) octylacrylamide / methyl methacrylate / tert-butylaminoethyl methacrylate hydroxypropyl methacrylate copolymers and zwitterionic polymers, as described for example in German patent applications DE39 29 973, DE 21 50 557, DE 28 17 369 and DE 3708 451 are disclosed. Acrylamidopropyl trimethylammonium chloride / acrylic acid or. Methacrylic acid copolymers and their alkali metal and ammonium salts are preferred zwitterionic polymers.
  • zwitterionic polymers are methacroylethylbetaine / methacrylate copolymers, which are commercially available under the name Amersette (AMERCHOL), and copolymers of hydroxyethyl methacrylate, methyl methacrylate, N, N-dimethylaminoethyl methacrylate and acrylic acid (Jordapon (D)).
  • Suitable polymers are also nonionic, siloxane-containing, water-soluble or -dispersible polymers, e.g. Polyether siloxanes, such as Tegopren 0 (Goldschmidt) or Besi & commat (Wacker).
  • Polyether siloxanes such as Tegopren 0 (Goldschmidt) or Besi & commat (Wacker).
  • the formulation base of cosmetic agents according to the invention preferably contains cosmetically and / or pharmaceutically acceptable excipients.
  • Pharmaceutically acceptable excipients which are known to be useful in the pharmaceutical, food technology and related fields, in particular those listed in relevant pharmacopoeias (e.g., DAB Ph. Eur. BP NF), as well as other excipients whose properties do not preclude physiological application.
  • Suitable auxiliaries may be: lubricants, wetting agents, emulsifying and suspending agents, preserving agents, antioxidants, anti-irritants, chelating agents, emulsion stabilizers, film formers, gelling agents, odor masking agents, resins, hydrocolloids, solvents, solubilizers, neutralizing agents, permeation accelerators, pigments, quaternary ammonium compounds, Rest grease and superfatting agents, ointment, cream or oil bases, silicone derivatives, stabilizers, sterilants, blowing agents, drying agents, opacifiers, thickeners, waxes, softeners, white oil.
  • a related embodiment is based on expert knowledge, as shown for example in Fiedler, HP Lexicon of excipients for pharmacy, cosmetics and related fields, 4th ed., Aulendorf: ECV Editio-Kantor-Verlag, 1996.
  • the active ingredients may be mixed or diluted with a suitable excipient (excipient).
  • Excipients may be solid, semi-solid or liquid materials which may serve as a vehicle, carrier or medium for the active ingredient. If desired, the admixing of further auxiliaries takes place in the manner known to the person skilled in the art.
  • the polymers and dispersions are suitable as auxiliaries in pharmacy, preferably as or in coating agent (s) or binder (s) for solid dosage forms. They can also be used in creams and as tablet coatings and tablet binders.
  • the agents according to the invention are a skin cleanser.
  • Preferred skin cleansing agents are soaps of liquid to gelatinous consistency, such as transparent soaps, luxury soaps, deep soaps, cream soaps, baby soaps, skin soaps, abrasive soaps and syndets, pasty soaps, soft soaps and washing pastes, peeling soaps, moisturizing wipes, liquid washing, showering and bathing preparations such as Washing lotions, shower baths and gels, bubble baths, oil baths and scrub preparations, shaving foams, lotions and creams.
  • transparent soaps such as transparent soaps, luxury soaps, deep soaps, cream soaps, baby soaps, skin soaps, abrasive soaps and syndets, pasty soaps, soft soaps and washing pastes, peeling soaps, moisturizing wipes, liquid washing, showering and bathing preparations such as Washing lotions, shower baths and gels, bubble baths, oil baths and scrub preparations, shaving foams, lotions and creams.
  • the agents according to the invention are cosmetic agents for the care and protection of the skin and hair, nail care preparations or preparations for decorative cosmetics.
  • Suitable skin cosmetic agents are e.g. Face lotions, face masks, deodorizers and other cosmetic lotions.
  • Means for use in decorative cosmetics include, for example, masking pens, theatrical paints, mascara and eye shadows, lipsticks, kohl pencils, eyeliners, rouges, powders, and eyebrow pencils.
  • compositions according to the invention can be used in nose strips for pore cleansing, in anti-acne agents, repellents, shaving agents, after- and pre-shave care products, after-sun care products, hair removal preparations, hair dyeing preparations, personal care products, foot care products and in baby care.
  • the skin care compositions according to the invention are in particular W / O or O / W skin creams, day and night creams, eye creams, face creams, anti-wrinkle creams, sunscreen creams, moisturizing creams, bleaching creams, self-tanning creams, vitamin creams, skin lotions, skin lotions and moisturizing lotions.
  • Resilinproteine can contribute, inter alia, to the moisturization and conditioning of the skin and to improve the skin feel.
  • the Resilinproteine can also be used as a thickener in the formulations Act. By adding the Resilinproteine invention can be achieved in certain formulations, a significant improvement in skin compatibility.
  • Skin cosmetic and dermatological compositions preferably contain at least one Resilinprotein in a proportion of about 0.001 to 30 wt .-%, preferably 0.01 to 20 wt .-%, most preferably 0.1 to 12 wt .-%, based on the total weight of the agent.
  • Particularly light stabilizers based on the Resilinproteine have the property to increase the residence time of the UV-absorbing ingredients in comparison to common adjuvants such as polyvinylpyrrolidone.
  • compositions according to the invention may be in a form suitable for skin care, such as e.g. as a cream, foam, gel, pen, mousse, milk, spray (pump spray or propellant spray) or lotion can be applied.
  • skin care such as e.g. as a cream, foam, gel, pen, mousse, milk, spray (pump spray or propellant spray) or lotion can be applied.
  • the skin-cosmetic preparations may contain, in addition to the Resilinproteinen and suitable carriers, other common in skin cosmetics agents and excipients, as described above. These preferably include emulsifiers, preservatives, perfume oils, cosmetic active ingredients such as phytantriol, vitamins A, E and C, retinol, bisabolol, panthenol, light stabilizers, bleaching agents, colorants, tinting agents, suntanning agents, collagen, enzymes, protein hydrolysates, stabilizers, pH - Regulators, dyes, salts, thickeners, gelling agents, bodying agents, silicones, humectants, moisturizers and other common additives.
  • emulsifiers emulsifiers, preservatives, perfume oils, cosmetic active ingredients such as phytantriol, vitamins A, E and C, retinol, bisabolol, panthenol, light stabilizers, bleaching agents, colorants, tinting agents, suntanning agents, collagen
  • Preferred oil and fat components of the skin cosmetic and dermatological agents are the aforementioned mineral and synthetic oils, e.g. Paraffins, silicone oils and aliphatic hydrocarbons having more than 8 carbon atoms, animal and vegetable oils, e.g. Sunflower oil, coconut oil, avocado oil, olive oil, lanolin, or waxes, fatty acids, fatty acid esters, e.g. Triglycerides of C6-C30 fatty acids, wax esters, e.g. Jojoba oil, fatty alcohols, vaseline, hydrogenated lanolin and acetylated lanolin, and mixtures thereof.
  • mineral and synthetic oils e.g. Paraffins, silicone oils and aliphatic hydrocarbons having more than 8 carbon atoms, animal and vegetable oils, e.g. Sunflower oil, coconut oil, avocado oil, olive oil, lanolin, or waxes, fatty acids, fatty acid esters, e.g. Triglycerides of C6-C30 fatty acids, wax
  • the skin-cosmetic and dermatological preparations may additionally contain conditioning substances based on silicone compounds.
  • Suitable silicone compounds are, for example, polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes or silicone resins.
  • the preparation of the cosmetic or dermatological preparations is carried out by customary methods known to the person skilled in the art.
  • the cosmetic and dermatological agents are preferably in the form of emulsions, in particular as water-in-oil (W / O) or oil-in-water (O / W) emulsions.
  • formulations for example, gels, oils, oil gels, multiple emulsions, for example in the form of W / O / W or O / W / O emulsions, anhydrous ointments or ointment bases, etc.
  • emulsifier-free formulations such as hydrodispersions, hydrogels or a Pickering emulsion are advantageous embodiments.
  • Emulsions are prepared by known methods.
  • the emulsions generally contain customary constituents, such as fatty alcohols, fatty acid esters and, in particular, fatty acid triglycerides, fatty acids, lanolin and derivatives thereof, natural or synthetic oils or waxes and emulsifiers in the presence of water.
  • customary constituents such as fatty alcohols, fatty acid esters and, in particular, fatty acid triglycerides, fatty acids, lanolin and derivatives thereof, natural or synthetic oils or waxes and emulsifiers in the presence of water.
  • a suitable emulsion as W / O emulsion generally contains an aqueous phase which is emulsified by means of a suitable emulsifier system in an oil or fat phase.
  • a polyelectrolyte complex can be used.
  • Preferred fat components which may be included in the fat phase of the emulsions are: hydrocarbon oils such as paraffin oil, purcellin oil, perhydrosqualene and solutions of microcrystalline waxes in these oils; animal or vegetable oils, such as sweet almond oil, avocado oil, calophylum, lanolin and derivatives thereof, castor oil, Se Samoel, olive oil, jojoba oil, karite oil, hoplostethus oil, mineral oils, their distillation start under atmospheric pressure at about 250 0 C and a distillation end point at 410 0 C, such as vaseline oil, esters of saturated or unsaturated fatty acids, such as alkyl, including i-propyl, butyl or cetyl myristate, hexadecyl stearate, ethyl or i-propyl palmitate, octanoic or Decanklaklad, and cetyl ricinoleate.
  • hydrocarbon oils such as paraffin oil, purcellin
  • the fat phase may also contain other oil-soluble silicone oils such as dimethylpolysiloxane, methylphenylpolysiloxane and the silicone glycol copolymer, fatty acids and fatty alcohols.
  • oils such as dimethylpolysiloxane, methylphenylpolysiloxane and the silicone glycol copolymer, fatty acids and fatty alcohols.
  • waxes can be used, such as carnauba wax, candililla wax, beeswax, microcrystalline wax, ozokerite wax and Ca, Mg and Al oleates, myristates, linoleates and stearates.
  • an emulsion of the invention may be present as O / W emulsion.
  • Such an emulsion usually contains an oil phase, emulsifiers that stabilize the oil phase in the water phase, and an aqueous phase that is usually thickened.
  • Suitable emulsifiers are preferably O / W emulsifiers, such as polyglycerol esters, sorbitan esters or partially esterified glycerides into consideration.
  • the agents according to the invention are a shower gel, a shampoo formulation or a bathing preparation.
  • Such formulations contain at least one resilin protein and usually anionic surfactants as base surfactants and amphoteric and / or nonionic surfactants as cosurfactants.
  • suitable active ingredients and / or auxiliaries are generally selected from lipids, perfume oils, dyes, organic acids, preservatives and antioxidants, as well as thickeners / gelling agents, skin conditioners and moisturizers.
  • formulations preferably contain from 2 to 50% by weight, preferably from 5 to 40% by weight, particularly preferably from 8 to 30% by weight, of surfactants, based on the total weight of the formulation.
  • Suitable anionic surfactants are, for example, alkyl sulfates, alkyl ether sulfates, alkyl sulfonates, alkylaryl sulfonates, alkyl succinates, alkyl sulfosuccinates, N-alkoyl sarcosylates, acyl taurates, acyl isothionates, alkyl phosphates, alkyl ether phosphates, alkyl ether carboxylates, alpha-olefin sulfonates, especially the alkali and alkaline earth metal salts, e.g. Sodium, potassium, magnesium, calcium, as well as ammonium and triethanolamine salts.
  • the alkyl ether sulfates, alkyl ether phosphates and alkyl ether carboxylates can have between 1 to 10 ethylene oxide or propylene oxide units, preferably 1 to 3 ethylene oxide units in the molecule.
  • Suitable amphoteric surfactants are e.g. Alkylbetaines, alkylamidopropylbetaines, alkylsulfobetaines, alkylglycinates, alkylcarboxyglycinates, alkylamphoacetates or -propionates, alkylamphodiacetates or -dipropionates.
  • cocodimethylsulfopropyl betaine cocodimethylsulfopropyl betaine, lauryl betaine, cocamidopropyl betaine or sodium cocamphopropionate can be used.
  • Suitable nonionic surfactants are, for example, the reaction products of aliphatic alcohols or alkylphenols having 6 to 20 C atoms in the alkyl chain, which may be linear or branched, with ethylene oxide and / or propylene oxide.
  • the amount of alkylene oxide is about 6 to 60 moles per mole of alcohol.
  • alkylamine oxides, mono- or dialkylalkanolamides, fatty acid esters of polyethylene glycols, ethoxylated fatty acid amides, alkylpolyglycosides or sorbitan ether esters are also suitable.
  • washing, showering and bathing preparations may contain conventional cationic surfactants, e.g. quaternary ammonium compounds, for example cetyltrimethylammonium chloride.
  • conventional cationic surfactants e.g. quaternary ammonium compounds, for example cetyltrimethylammonium chloride.
  • shower gel / shampoo formulations may contain thickeners, e.g. Common salt, PEG-55, propylene glycol oleate, PEG-120 methyl glucose dioleate and others, as well as preservatives, other active ingredients and auxiliaries and water.
  • thickeners e.g. Common salt, PEG-55, propylene glycol oleate, PEG-120 methyl glucose dioleate and others, as well as preservatives, other active ingredients and auxiliaries and water.
  • the agents according to the invention are a hair treatment agent.
  • Hair treatment agents according to the invention preferably contain at least one Resilinprotein in an amount in the range of about 0.01 to 30 wt .-%, preferably 0.5 to 20 wt .-%, based on the total weight of the composition.
  • the hair treatment compositions of the present invention are in the form of a mousse, hair mousse, hair gel, shampoo, hair spray, hair mousse, top fluid, perming, hair dyeing and bleaching or hot oil treatments.
  • the hair cosmetic preparations can be applied as (aerosol) spray, (aerosol) foam, gel, gel spray, cream, lotion or wax.
  • Hairsprays include both aerosol sprays and pump sprays without propellant gas.
  • Hair foams include both aerosol foams and pump foams without propellant gas.
  • Hair sprays and hair foams preferably comprise predominantly or exclusively water-soluble or water-dispersible components.
  • aqueous microdispersions with particle diameters of usually 1 to 350 nm, preferably 1 to 250 nm, are used.
  • the solids contents of these preparations are usually in a range of about 0.5 to 20 wt .-%.
  • these microdispersions do not require emulsifiers or surfactants for their stabilization.
  • the hair cosmetic formulations according to the invention comprise a) from 0.01 to 30% by weight of at least one resilin protein, b) from 20 to 99.95% by weight of water and / or alcohol, c) from 0 to 50% by weight at least a propellant, d) 0 to 5 wt .-% of at least one emulsifier, e) 0 to 3 wt .-% of at least one thickener, and up to 25 wt .-% further constituents.
  • alcohol By alcohol are meant all alcohols customary in cosmetics, e.g. Ethanol, isopropanol, n-propanol.
  • ingredients are understood to include the additives customary in cosmetics, for example propellants, defoamers, surface-active compounds, i. Surfactants, emulsifiers, foaming agents and solubilizers.
  • the surface-active compounds used can be anionic, cationic, amphoteric or neutral.
  • Other common ingredients may also be e.g. Preservatives, perfume oils, opacifiers, active ingredients, UV filters, care ingredients such as panthenol, collagen, vitamins, protein hydrolysates, alpha and beta hydroxycarboxylic acids, stabilizers, pH regulators, dyes, viscosity regulators, gel formers, salts, humectants, moisturizers, complexing agents and other common additives.
  • this includes all known in cosmetics styling and conditioner polymers that can be used in combination with the Resilinproteinen invention, if very special properties are to be set.
  • Suitable conventional hair cosmetic polymers include, for example, the abovementioned cationic, anionic, neutral, nonionic and amphoteric polymers, to which reference is hereby made.
  • the preparations may additionally contain conditioning substances based on silicone compounds.
  • Suitable silicone compounds are, for example, polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes, silicone resins or dimethicone copolyols (CTFA) and amino-functional silicone compounds such as amodimethicones (CTFA).
  • the polymers according to the invention are particularly suitable as setting agents in hairstyling preparations, in particular hair sprays (aerosol sprays and pump sprays without propellant gas) and hair foams (aerosol foams and pump foams without propellant gas).
  • spray formulations contain a) 0.01 to 30 wt .-% of at least one Resilinproteins, b) 20 to 99.9 wt .-% of water and / or alcohol, c) 0 to 70 wt .-% at least a blowing agent, d) 0 to 20 wt .-% further ingredients.
  • Blowing agents are the blowing agents commonly used for hairsprays or aerosol foams. Preference is given to mixtures of propane / butane, pentane, dimethyl ether, 1,1-difluoroethane (HFC-152a), carbon dioxide, nitrogen or compressed air.
  • a preferred formulation for aerosol hair foams according to the invention comprises a) from 0.01 to 30% by weight of at least one resilin protein, b) from 55 to 99.8% by weight of water and / or alcohol, c) from 5 to 20% by weight of a blowing agent , d) from 0.1 to 5% by weight of an emulsifier, e) from 0 to 10% by weight of further constituents.
  • emulsifiers all emulsifiers commonly used in hair foams can be used. Suitable emulsifiers may be nonionic, cationic or anionic or amphoteric.
  • nonionic emulsifiers are Laurethe, e.g. Laureth-4; Cetethe, e.g. Cetheth-1, polyethylene glycol cetyl ether, ceteareth, e.g. Cethetereth-25, polyglycol fatty acid glycerides, hydroxylated lecithin, lactyl esters of fatty acids, alkylpolyglycosides.
  • cationic emulsifiers are cetyldimethyl-2-hydroxyethylammonium dihydrogenphosphate, cetyltrimonium chloride, cetyltrimmonium bromide, cocotrimonium methylsulfate, quaternium-1 to x (INCI).
  • Anionic emulsifiers may, for example, be selected from the group of alkyl sulfates, alkyl ether sulfates, alkyl sulfonates, alkylaryl sulfonates, alkyl succinates, alkyl sulfosuccinates, N-alkoyl sarcosinates, acyl taurates, acyl isethionates, alkyl phosphates, alkyl ether phosphates, alkyl ether carboxylates, alpha olefin sulfonates, especially the alkali and alkaline earth metal salts, e.g. Sodium, potassium, magnesium, calcium, as well
  • alkyl ether sulfates, alkyl ether phosphates and alkyl ether carboxylates can have between 1 to 10 ethylene oxide or propylene oxide units, preferably 1 to 3 ethylene oxide units in the molecule.
  • a preparation suitable for styling gels according to the invention can be composed, for example, as follows: a) 0.01 to 30% by weight of at least one resilin protein, b) from 80 to 99.85% by weight of water and / or alcohol, c) from 0 to 3% by weight, preferably from 0.05 to 2% by weight, of a gelling agent, d) from 0 to 20% by weight other ingredients.
  • the use of gelling agents may be advantageous to adjust for specific rheological or other performance properties of the gels.
  • gel formers it is possible to use all gel formers customary in cosmetics.
  • polyacrylic acid for example carbomer (INCI)
  • cellulose derivatives for example hydroxypropylcellulose, hydroxyethylcellulose, cationically modified celluloses
  • polysaccharides for example xanthan gum, caprylic / capric triglyceride, sodium acrylate copolymers
  • polyquaternium-32 and) paraffin liquidum (INCI)
  • Sodium acrylate copolymers and) Paraffinum Liquidum (and) PPG-1 trideceth-6, acrylamidopropyltrimonium chloride / acrylamide copolymers, steareth-10-allyl ethers, acrylate copolymers
  • the Resilinproteine invention can be used in cosmetic preparations as conditioning agents.
  • a preparation containing the resilin proteins according to the invention can preferably be used in shampoo formulations as a setting and / or conditioning agent.
  • Preferred shampoo formulations comprise a) from 0.01 to 30% by weight of at least one resilin protein, b) from 25 to 94.95% by weight of water, c) from 5 to 50% by weight of surfactants, c) from 0 to 5% by weight. % of a further conditioning agent, d) 0 to 10 wt .-% further cosmetic ingredients.
  • Suitable anionic surfactants are, for example, alkyl sulfates, alkyl ether sulfates, alkyl sulfonates, alkylaryl sulfonates, alkyl succinates, alkyl sulfosuccinates, N-
  • the alkyl ether sulfates, alkyl ether phosphates and alkyl ether carboxylates can have between 1 to 10 ethylene oxide or propylene oxide units, preferably 1 to 3 ethylene oxide units in the molecule.
  • Suitable examples are sodium lauryl sulfate, ammonium lauryl sulfate, sodium lauryl sulfate, ammonium lauryl ether sulfate, sodium lauroyl sarcosinate, sodium oleyl succinate, ammonium lauryl sulfosuccinate, sodium dodecylbenzenesulfonate, triethanolamine dodecylbenzenesulfonate.
  • Suitable amphoteric surfactants are, for example, alkylbetaines, alkylamidopropylbetaines, alkylsulfobetaines, alkylglycinates, alkylcarboxyglycinates, alkylamphoacetates or -propionates, alkylamphodiacetates or -dipropionates.
  • cocodimethylsulfopropyl betaine cocodimethylsulfopropyl betaine, lauryl betaine, cocamidopropyl betaine or sodium cocamphopropionate can be used.
  • Suitable nonionic surfactants are, for example, the reaction products of aliphatic alcohols or alkylphenols having 6 to 20 C atoms in the alkyl chain, which may be linear or branched, with ethylene oxide and / or propylene oxide.
  • the amount of alkylene oxide is about 6 to 60 moles per mole of alcohol.
  • alkylamine oxides, mono- or dialkylalkanolamides, fatty acid esters of polyethylene glycols, alkylpolyglycosides or sorbitan ether esters are also suitable.
  • the shampoo formulations may contain conventional cationic surfactants, e.g. quaternary ammonium compounds, for example cetyltrimethylammonium chloride.
  • conventional cationic surfactants e.g. quaternary ammonium compounds, for example cetyltrimethylammonium chloride.
  • customary conditioning agents in combination with the resilin proteins can be used to achieve certain effects.
  • cationic polymers with the name Polyquaternium according to INCI, in particular copolymers of vinylpyrrolidone / N-vinylimidazolium salts (Luviquat FC, Luviquat & commat, HM, Luviquat MS, Luviquat Care), copolymers of N-vinylpyrrolidone / dimethylaminoethyl methacrylate, quaternized with diethyl sulfate ( Luviquat D PQ 1 1), copolymers of N-vinylcaprolactam / N-vinylpyrrolidone / N-vinylimidazolium salts (Luviquat D Hold), cationic cellulose derivatives (Polyquaternium-4 and -10), acrylamide copolymers (Polyquaternium-7).
  • protein hydrolysates can be used, as well as conditioning substances based on silicone compounds, for example polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes or silicone resins.
  • silicone compounds for example polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes or silicone resins.
  • suitable silicone compounds are dimethicone copolyols (CTFA) and amino-functional silicone compounds such as amodimethicones (CTFA).
  • CTFA dimethicone copolyols
  • amino-functional silicone compounds such as amodimethicones
  • cationic guar derivatives such as guar hydroxypropyltrimonium chloride (INCI) can be used.
  • Basic Resilines are characterized in that the ratio of the basic amino acid residues (K, R) to the acidic amino acid residues (D, E) contained in the repeating units which form the Resilinprotein at least 1, 5, preferably at least 2.
  • Particularly advantageous basic resilins are those in which the ratio of basic to acidic amino acid residues at min. at least 40% of the repeat units is 1: 1 and at least 40% of the repeat units is 1: 0.
  • GAPGGGNGGRPSSSY or functional equivalents of this repeating unit included. Particularly preferred is the preparation and use of the synthetic Resilinproteins Ui6 (SEQ ID NO 1) and the nucleotide sequence coding for it (SEQ ID NO 2).
  • Basic Resilinproteine are particularly suitable for use in cosmetics, for the formulation of substances, for the paper, leather and textile finishing, for coating surfaces and for use in human and animal nutrition.
  • a synthetic gene encoding the resilin protein Ui6 was prepared by multimerizing a synthetic oligonucleotide U: 5'-ggtgcgccgggcggtggcaacggtggccgtccgtctgacacctacggtgcgccgggtggcggacacggtggccgtccttctctttac-3 'as described in Huemmerich et al .; Biochemistry. 43 (42): 13604-12, (2004) to a 16mer multimerized and cloned into the expression vector pET21 a (Novagen). The expression took place in the strain E.
  • citric acid monohydrate 60 g of sodium sulfate (Na 2 SO 4) 4.5 g (NH 4) 2 Fe (SO 4) 2 * 6 H 2 O 3400 g of glycerol 99.5%
  • the purification of the protein was carried out according to the following protocol: Resuspension of the cell pellet in 5 ml per gram of wet mass 20 mM MOPS
  • the protein thus purified may be used as ammonium sulfate precipitate at -20 0 C STORED.
  • ammonium sulfate precipitate is in
  • the purity of the protein was checked by SDS-PAGE and by fluorescence spectroscopy (Fig. 1 + 2).
  • Example 3 Use Resilinprotein in a emulsion for day care - Type O / W
  • Preparation Heat phases A and B separately from each other to about 80 ° C. Stir phase B into phase A and homogenize. Stir phase C into combined phases A and B and homogenize again. Cool to about 40 ° C. with stirring, add phase D, adjust the pH to about 6.5 with phase E, homogenize and cool to room temperature while stirring.
  • the formulation is produced without inert gas.
  • the filling must be in oxygen-impermeable packaging, e.g. Aluminum tubes take place.
  • Example 4 Use Resilinprotein in a Protective Day Cream - Type O / W
  • Preparation Heat phases A and B separately from each other to about 80 ° C. Stir phase B into phase A and homogenize. Prepare phase C in combined phases A and B and homogenize. Cool to about 40 ° C. while stirring. Add phase D, adjust the pH to about 6.5 with phase E and homogenize. Cool to room temperature while stirring.
  • Example 6 Using Resilin Protein in a Daily Care Body Spray
  • Preparation Mix the components of phase A. Dissolve phase B, work in phase A and homogenize.
  • Preparation Mix the components of phase A. Stir phase B into phase A while homogenizing. Neutralize with Phase C and homogenize again.
  • Example 10 Use Resilinprotein- in a sunscreen lotion WS 1%:
  • D 1 0 phenoxyethanol, methylparaben, ethylparaben, butylparaben, propylparaben, isobutylparaben
  • D 1 0 phenoxyethanol, methylparaben, ethylparaben, butylparaben, propylparaben, isobutylparaben
  • Preparation Heat the components of phases A and B separately to about 80 ° C. Stir phase B into phase A and homogenize. Heat phase C to about 80 ° C. and stir into the combined phases A and B while homogenizing. Cool with stirring to about 40 ° C, add phase D and homogenize again.
  • Example 1 Use Resilinprotein in a sunscreen lotion - Type O / W WS 1%: % Ingredient (INCI)
  • Example 12 Use of Resilin Protein in a Sunscreen Lotion - Type O / W
  • Example 14 Use Resilinprotein in a W / O emulsion with bisabolol
  • Example 15 Foam Conditioner with Fixer WS 1%
  • Preparation Mix the components of phase A. Add the components of phase B one by one and dissolve. Fill with phase C.
  • Preparation Mix the components of phase A. Add the components of phase B one by one and dissolve. Fill with phase C.
  • Preparation Mix the components of phase A. Clear the components of phase B, then stir phase B into phase A. Adjust the pH to 6-7, fill with phase C.
  • Preparation Mix the components of phase A. Add the components of phase B one by one and dissolve. Dissolve phase C in the mixture of A and B, then adjust the pH to 6-7. Fill with phase D.
  • Preparation Mix the components of phase A. Add the components of phase B one by one and dissolve. Dissolve phase C in the mixture of A and B, then adjust the pH to 6-7. Fill with phase D.
  • phase A Solubilize phase A. Weigh phase B into phase A and solve it clearly. Adjust the pH to 6-7, fill with phase C.
  • phase A Solubilize phase A. Weigh phase B into phase A and solve it clearly. Adjust the pH to 6-7, fill with phase C.
  • Preparation Mix the components of phase A. Add the components of phase B one by one and dissolve. Fill with phase C.
  • Preparation Mix and dissolve the components of phase A. Adjust the pH to 6-7 with citric acid.
  • Preparation Mix and dissolve the components of phase A. Adjust the pH to 6-7 with citric acid.
  • Preparation Mix and dissolve the components of phase A. Adjust the pH to 6-7 with citric acid.
  • phase A Weigh in the components of phase A and dissolve. Adjust the pH to 6-7. Add phase B and heat to approx. 50 ° C. Cool to room temperature while stirring.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Insects & Arthropods (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Verwendung von Resilinproteinen in der Kosmetik, dadurch gekennzeichnet, dass die Resilinproteine zwischen einer und 100 Wiederholungseinheiten mit der Kon- sensussequenz SXXYGXP enthalten, wobei S ein Serin, X eine beliebige Aminosäure, Y ein Tyrosin, G ein Glycin und P ein Prolin ist.

Description

Verwendung von natürlichen, rekombinanten und synthetischen Resilinen in der Kosmetik
Die vorliegende Erfindung betrifft die Verwendung von natürlichen, rekombinanten und synthetischen Resilinproteinen in der Kosmetik, insbesondere in der Hautkosmetik.
Stand der Technik
WO 2004/104042 beschreibt die Herstellung eines natürlichen Proresilin Fragmentes sowie die Weiterverarbeitung durch Quervernetzung zu einem Bioelastomer und dessen Verwendung.
WO 2004/104043 beschreibt Proteinsequenzen, basierend auf repetitiven Sequenzen natürlicher Resilinproteine, sowie die Weiterverarbeitung durch Quervernetzung zu Bioelastomeren und deren Verwendung.
Beschreibung der Erfindung
Die vorliegende Erfindung betrifft neue kosmetische oder dermatologische Zusammensetzungen, die als Wirkstoff mindestens ein natürliches, rekombinantes oder synthetisches Resilin von Insekten oder ein Analogon eines solchen Proteins enthalten.
Die vorliegende Erfindung bezieht sich insbesondere auf Zusammensetzungen, die als Produkte für die Haarbehandlung, Produkte zur Pflege der Haut, Produkte zum Schminken oder Produkte zum Sonnenschutz auf der Basis eines Resilinproteins von Insekten vorliegen.
Die Verwendung von Proteinen ist wohlbekannt; in der Kosmetik werden sie häufig verwendet, insbesondere Seidenproteine der Raupe Bombyx mori, wobei diese Verwendung ausführlich in Kaplan et al.: Silks; Biomaterials. Novel Materials from Biologi- cal Sources1-53 Stockton press; New York (1991) beschrieben wurde. Die Seidenpro- teine besitzen jedoch keine guten elastischen Eigenschaften, wenn sie als Faden oder Filme vorliegen, und können daher nicht in zufrieden stellender Weise als Filmbildner dienen. Die Eigenschaften von Resilin werden in Gosline et al.; Philosophical Transactions of the Royal Society of London - Series B: Biological Sciences. 357(1418):121-32, (2002) beschrieben. Sie sind für ihre guten elastischen Eigenschaften und den hohen Anteil elastisch gespeicherter Energie (resilience) bekannt.
Es wurde nun festgestellt, dass Resilinproteine, zusätzlich zu ihren bekannten Eigenschaften, kosmetischen oder dermatologischen Zusammensetzungen unerwartete Eigenschaften verleihen und insbesondere die hydratisierende oder weich machende Wirkung verbessern können. Die Resiline verhalten sich im übrigen wie gute Filmbild- ner und besitzen vor allem eine geringe Oberflächendichte.
Die vorliegende Erfindung betrifft daher als neues technisches Produkt eine kosmetische oder dermatologische Zusammensetzung, die eine wirksame Menge mindestens eines natürlichen rekombinanten oder synthetischen Resilins oder ein Analogon eines solchen Proteins enthält.
Nach einer Ausführungsform der erfindungsgmäßen kosmetischen Zusammensetzungen handelt es sich bei den Resilinen vorzugsweise um natürliches Resilin, das aus Insekten gewonnen wird.
Nach einer speziellen Ausführungsform der erfindungsgmäßen kosmetischen Zusammensetzungen handelt es sich bei den Resilinen vorzugsweise um rekombinante Resiline von Insekten. Dazu wird eine natürliche, für Resilin oder Resilin-Fragmente codierende DNA-Sequenz aus Insekten isoliert, in einem Expressionsorganismus heterolog exprimiert und das rekombinante Resilinprotein daraus isoliert. Die Nucleotidsequenz der isolierten DNA kann zusätzlich mit molekularbiologischen Methoden verändert werden.
Nach einer bevorzugten Ausführungsform der erfindungsgmäßen kosmetischen Zu- sammensetzungen handelt es sich bei den Resilinen vorzugsweise um synthetische Resiline. Dabei werden Gensequenzen, die für Proteinsequenzen codieren, die auf Wiederholungseinheiten von natürlichen Resilinproteinen basieren, mit chemischen und molekularbiologischen Methoden synthetisiert. Die synthetischen Gene werden in einem Expressionsorganismus heterolog exprimiert und das synthetische Resilinpro- tein daraus isoliert. Die rekombinanten und synthetischen Resiline haben den Vorteil, daß sie eine Peptid- sequenz besitzen, deren physikalisch-chemischen Eigenschaften in Abhängigkeit der gewünschten kosmetischen oder dermatologischen Anwendungen angepasst werden kann.
Die Zusammensetzungen können erfindungsgemäß mindestens ein natürliches oder rekombinantes oder synthetisches Resilinprotein in einer wirksamen Menge enthalten.
Geeignet für die Herstellung kosmetischer oder dermatologischer Zusammensetzun- gen sind Resilinproteine, die eine Vielzahl von Wiederholungseinheiten, bevorzugt 1- 100, besonders bevorzugt 10-40, und vorteilhaft 15-33 Wiederholungseinheiten mit der Konsensussequenz SXXYGXP enthalten, wobei S ein Serin, X eine beliebige Aminosäure, Y ein Tyrosin, G ein Glycin und P ein Prolin ist. Bevorzugt wird X ausgewählt aus der Gruppe der geladenen und polaren Aminosäuren.
In einer bevorzugten Ausführungsform der Erfindung enthält die Wiederholungseinheit die Konsensussequenz:
Xi X2 X3 X4 S X5 Xβ Y G X7P Xe X9 X10 X11 wobei
Xi eine beliebige oder keine Aminosäure
X2 eine beliebige oder keine Aminosäure
X3 eine beliebige oder keine Aminosäure
X4 ein Prolin, Alanin, Threonin oder Serin S ein Serin
X5 eine gelade oder polare Aminosäure
Xβ eine gelade oder polare Aminosäure
Y ein Tyrosin
G ein Glycin X7 ein Prolin, Alanin, Threonin oder Serin
P ein Prolin
Xe ein Glycin, Alanin, Threonin oder Serin
Xg ein Glycin eine polare Aminosäure oder keine Aminosäure
X10 ein Glycin eine polare Aminosäure oder keine Aminosäure X11 eine beliebige oder keine Aminosäure ist. In einer Ausführungsform ist Xi falls vorhanden, ein G, Y, A oder N, bevorzugt ein G. In einer Ausführungsform ist X2 falls vorhanden eine basische Aminosäure, G, L, Q, bevorzugt G.
In einer Ausführungsform ist X3 falls vorhanden ein R, K, T oder P; X4 ist bevorzugt ein P;
X5 ist bevorzugt ein D, T oder S; Xβ ist bevorzugt ein S, Q oder T; X7 ist bevorzugt ein A; Xs ist bevorzugt ein G; Xg falls vorhanden ist bevorzugt ein G, Q oder S, am meisten bevorzugt ein G; X10 falls vorhanden ist bevorzugt ein G, S oder N, am meisten bevorzugt ein G; X11 falls vorhanden ist bevorzugt ein G, Q, P, S oder N.
In einer Ausführung ist mindestens eine der Aminosäuren Xe, Xg and X10 ein G, bevor-
Der Begriff Konsensussequenz -wie er hier verwendet wird- bezeichnet eine Aminosäure- (oder Nucleotid-) Sequenz, die häufig an einer bestimmten Position vorkommende Aminosäuren eindeutig hinsichtlich Rest und Position festlegtt, während andere Aminosäuren nicht näher bestimmt werden sondern durch den Platzhalter X anstelle des üblich verwendeten Ein-Buchstaben-Codes für Aminosäuren ersetzt werden. Der Ein-Buchstaben-Code für Aminosäuren, der hier verwendet wird, ist dem Fachmann bekannt.
Die Wiederholungseinheiten der Resilinproteine können gleichartig oder unterschiedlich sein.
Die Wiederholungseinheiten können durch Linker verbunden sein, die bevorzugt 1 bis 30 Aminosäuren, besonders bevorzugt 1 bis 20 Aminosäuren enthalten. Die Aminosäu- resequenz eines Linkers kann von anderen Proteinen, bevorzugt Strukturproteinen abgeleitet sein oder kein natürliches Vorbild besitzen oder ganz abwesend sein.
Der Abstand einer Aminosäure innerhalb einer Wiederholungseinheit zu der equivalen- ten Aminosäure innerhalb der benachbarten Wiederholungseinheit kann 8 bis 50 Ami- nosäuren, bevorzugt 8 bis 34, und besonders bevorzugt 10 bis 25 und am meisten bevorzugt 10 bis 16 Aminosäuren betragen. Es können eine beliebige Anzahl von Wiederholungseinheiten, bevorzugt 1 bis 100, besonders bevorzugt, 10 - 65 und am meisten bevorzugt 15 bis 35 aneinandergefügt sein.
In einer Ausführung enthält das Protein die Wiederholungseinheit GAPGGGNGGRPSDTY oder GAPGGGNGGRPSSSY.
In einer weiteren Ausführung enspricht die Sequenz des Proteins oder Teile davon der SEQ ID NO 1 oder Teilen dieser Sequenz. Aminosäure 1-15 von SEQ ID NO:1 stellt einen T7 Tag dar, der mit dem eigentlichen Resilinprotein fusioniert ist. Die erfin- dungsgemässen Resilinproteine können mit oder ohne solche Tags hergestellt werden. Es ist auch möglich, den T7 Tag durch andere ähnlich wirksame Tags zu ersetzen, die die Identifizierung und Isolierung der Resilinproteine erleichtern können.
In einer weiteren Ausführung enspricht die Sequenz des Proteins oder Teile davon der SEQ ID NO 3 oder Teilen dieser Sequenz.
In einer weiteren Ausführung enspricht die Sequenz des Proteins oder Teile davon der Peptidsequenz oder Teilen davon des Resilinproteins aus anderen Insekten wie z.B. Anopheles gambiae, Apis mellifera, Ctenocephalides felis, Haematobia irritans exigua. Die Peptidsequenzen dieser Proteine sind in WO04/104042 veröffentlicht worauf hier ausdrücklich Bezug genommen wird.
In einer weiteren Ausführung ist das Resilinprotein Teil eines Hybridproteins. Das Hyb- ridprotein besteht dabei aus einer oder mehreren Resilin- oder davon abgeleiteten Sequenzen beziehungsweise Fragmenten dieser Sequenzen, sowie einem oder mehreren weiteren Proteinsequenzen oder Fragmenten dieser Sequenzen. Diese weiteren Proteine können bevorzugt Strukturproteine sein wie z.B. Seidenprotein, Spinnenseidenprotein, Keratin, Elastin, Kollagen, Gluten, Abductin, Muschel Byssus Protein.
Die Herstellung von rekombinanten und synthetischen Resilinproteinen erfolgt durch Expression natürlicher oder synthetisch hergestellter Gensequenzen. Methoden zur Isolierung und Modifikation natürlicher Gensequenzen sind dem Fachmann bekannt.
Eine Möglichkeit zur Herstellung synthetischer Gensequenzen ist in Huemmerich et al.; Biochemistry. 43(42): 13604-12, (2004) beschrieben. Die Expressionssysteme für Proteine sind wohlbekannt und wurden beschrieben in Sambrook et al.: Molecular cloning: A Laboratory Manual; 3rd Ed. CoId Spring Harbour Laboratory Press; CoId Spring Harbour (2001).
Nichtlimitierende Beispiele für prokaryontische Expressionsorganismen sind Escheri- chia coli, Bacillus subtilis, Bacillus megaterium, Corynebacterium glutamicum u.a.. Nichtlimitierende Beispiele für eukaryontische Expressionsorganismen sind Hefen, wie Saccharomyces cerevisiae, Pichia pastoris u.a., filamentöse Pilze, wie Aspergillus ni- ger, Aspergillus oryzae, Aspergillus nidulans, Trichoderma reesei, Acremonium chry- sogenum u.a., Säugetierzellen, wie Heia-Zellen, COS-Zellen, CHO-Zellen u.a., Insek- tenzellen, wie Sf9-Zellen, MEL-Zellen u.a., Pflanzen oder Pflanzenzellen wie Solanum tuberosum, Nicotiana u.a..
In den erfindungsgemäßen Zusammensetzungen entspricht der Ausdruck "wirksame Menge" mindestens eines natürlichen, rekombinanten oder synthetischen Resilinpro- teine von Insekten oder einer analogen Verbindung einem Mengenanteil von etwa 0,001 bis 30 Gew.-%, jedoch vorzugsweise von 0,01 bis 15 Gew.-%, bezogen auf das Gesamtgewicht der Zusammensetzung, wobei der Mengenanteil in Abhängigkeit von der Art der kosmetischen oder dermatologischen Zusammensetzung variieren kann.
Neben den oben dargestellten Polypeptidsequenzen sind auch besonders funktionale Äquivalente, funktionale Derivate und Salze dieser Sequenz bevorzugt.
Unter „funktionalen Äquivalenten" versteht man erfindungsgemäß insbesondere auch Mutanten, welche in wenigstens einer Sequenzposition der oben genannten Aminosäu- resequenzen eine andere als die konkret genannte Aminosäure aufweisen aber trotzdem eine der oben genannten Eigenschaften besitzen. „Funktionale Äquivalente" umfassen somit die durch eine oder mehrere Aminosäure-Additionen, -Substitutionen, - Deletionen und/oder -Inversionen erhältlichen Mutanten, wobei die genannten Veränderungen in jeglicher Sequenzposition auftreten können, solange sie zu einer Mutante mit dem erfindungsgemäßen Eigenschaftsprofil führen. Funktionale Äquivalenz ist insbesondere auch dann gegeben, wenn die Reaktivitätsmuster zwischen Mutante und unverändertem Polypeptid qualitativ übereinstimmen.
„Funktionale Äquivalente" im obigen Sinne sind auch „Präkursoren" der beschriebenen Polypeptide sowie „funktionale Derivate" und „Salze" der Polypeptide. „Präkursoren" sind dabei natürliche oder synthetische Vorstufen der Polypeptide mit oder ohne der gewünschten biologischen Aktiviät.
Beispiele für geeignete Aminosäuresubstitutionen sind folgender Tabelle zu entnehmen:
Ursprünglicher Rest Beispiele der Substitution
AIa Ser
Arg Lys
Asn GIn; His
Asp GIu
Cys Ser
GIn Asn
GIu Asp
GIy Pro
His Asn ; GIn
Ne Leu; VaI
Leu Ne; VaI
Lys Arg ; GIn ; GIu
Met Leu ; Ne
Phe Met ; Leu ; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp ; Phe
VaI Ne; Leu
Unter dem Ausdruck „Salze" versteht man sowohl Salze von Carboxylgruppen als auch Säureadditionssalze von Aminogruppen der erfindungsgemäßen Proteinmoleküle. Salze von Carboxylgruppen können in an sich bekannter Weise hergestellt werden und umfassen anorganische Salze, wie zum Beispiel Natrium-, Calcium-, Ammonium-, Ei- sen- und Zinksalze, sowie Salze mit organischen Basen, wie zum Beispiel Aminen, wie Triethanolamin, Arginin, Lysin, Piperidin und dergleichen. Säureadditionssalze, wie zum Beispiel Salze mit Mineralsäuren, wie Salzsäure oder Schwefelsäure und Salze mit organischen Säuren, wie Essigsäure und Oxalsäure sind ebenfalls Gegenstand der Erfindung.
„Funktionale Derivate" erfindungsgemäßer Polypeptide können an funktionellen Aminosäure-Seitengruppen oder an deren N- oder C-terminalen Ende mit Hilfe bekannter Techniken ebenfalls hergestellt werden. Derartige Derivate umfassen beispielsweise aliphatische Ester von Carbonsäuregruppen, Amide von Carbonsäuregruppen, erhältlich durch Umsetzung mit Ammoniak oder mit einem primären oder sekundären Amin; N-Acylderivate freier Aminogruppen, hergestellt durch Umsetzung mit Acylgruppen; oder O-Acylderivate freier Hydroxygruppen, hergestellt durch Umsetzung mit Acylgruppen.
Weitere Gegenstände der Erfindung sind Moleküle, die aus Kupplungen aus einem Resilinprotein und einem Effektormolekül bestehen. Als Protein sind alle bereits oben- genannten Proteine geeignet.
Als Effektormoleküle werden im folgenden Moleküle verstanden, die eine bestimmte, vorhersehbare Wirkung aufweisen. Dies können entweder proteinartige Moleküle sein, wie Enzyme oder auch nicht-proteinogene Moleküle wie Farbstoffe, Lichtschutzmittel, Vitamine, Provitamine, Antioxidantien und Fettsäuren, Conditioner oder Metallionen- enthaltende Verbindungen.
Unter den proteinartigen Effektormolekülen sind Enzyme und Proteine mit spezifischen Bindungseigenschaften bevorzugt.
Unter den Enzymen sind folgende als Effektormoleküle bevorzugt: Oxidasen, Peroxi- dasen, Proteasen, Glucanasen, Mutanase, Tyrosinasen, Laccasen, metallbindende Enzyme, Lactoperoxidase, Lysozym, Amyloglycosidase, Glucoseoxidase, Superoxid- dismutase, Photolyase, T4 Endonuklease, Katalase, Thioredoxin, Thioredoxin- Reduktase.
Bei den proteinartigen aber nicht enzymatisch wirkenden Effektormolekülen sind folgende als Effektormoleküle bevorzugt: Hydrophobine, Kollagen, Carotinoid bindende Proteine, Schwermetalle bindende Proteine, Odorantien bindende Proteine, Cellulose bindende Proteine, Stärke bindende Proteine, Keratin bindende Proteine.
Gut geeignet als proteinartige Effektormoleküle sind auch Hydrolysate von Proteinen aus pflanzlichen und tierischen Quellen, beispielsweise Hydrolysate von Proteinen marinen Ursprungs.
Unter den nicht-proteinartigen Effektormolekülen sind Carotinoide bevorzugt. Unter Carotinoide sind erfindungsgemäß folgende Verbindungen sowie deren veresterte oder glykosylierte Derivate zu verstehen: ß-Carotin, Lycopin, Lutein, Astaxanthin, Zea- xanthin, Cryptoxanthin, Citranaxanthin, Canthaxanthin, Bixin, ß-Apo-4-carotinal, ß-Apo- 8-carotinal, ß-Apo-8-carotinsäureester, Neurosporen, Echinenon, Adonirubin, Viola- xanthin, Torulen, Torularhodin, einzeln oder als Mischung. Bevorzugt verwendete Ca- rotinoide sind ß-Carotin, Lycopin, Lutein, Astaxanthin, Zeaxanthin, Citranaxanthin und Canthaxanthin.
Weitere bevorzugte Effektormoleküle sind UV-Lichtschutzfilter. Darunter sind organi- sehe Substanzen zu verstehen, die in der Lage sind, ultraviolette Strahlen zu absorbieren und die aufgenommene Energie in Form längerwelliger Strahlung, z.B. Wärme, wieder abzugeben. Die organischen Substanzen können öllöslich oder wasserlöslich sein.
Als öllösliche UV-B-Filter können z.B. folgende Substanzen verwendet werden:
3-Benzylidencampher und dessen Derivate, z.B. 3-(4-Methylbenzyliden)campher;
4-Aminobenzoesäurederivate, vorzugsweise 4-(Dimethylamino)benzoesäure-2- ethylhexylester, 4-( Dimethylamino)benzoesäure-2-octylester und 4-(Dimethylamino)- benzoesäureamylester;
Ester der Zimtsäure, vorzugsweise 4-Methoxyzimtsäure-2-ethylhexylester, 4 Methoxy- zimtsäurepropylester, 4-Methoxyzimtsäureisoamylester, 4 Methoxyzimtsäureisopenty- lester, 2-Cyano-3-phenyl-zimtsäure-2-ethylhexylester (Octocrylene);
Ester der Salicylsäure, vorzugsweise Salicylsäure-2-ethylhexylester, Salicylsäure-4 isopropylbenzylester, Salicylsäurehomomenthylester;
Derivate des Benzophenons, vorzugsweise 2-Hydroxy-4-methoxybenzophenon, 2- Hydroxy-4-methoxy-4'-methylbenzophenon, 2,2'-Dihydroxy-4-methoxybenzophenon;
Ester der Benzalmalonsäure, vorzugsweise 4-Methoxybenzmalonsäuredi-2- ethylhexylester;
Triazinderivate, wie z.B. 2,4,6-Trianilino-(p-carbo-2'-ethyl-1 '-hexyloxy)-1 ,3,5-triazin (Oc- tyltriazone) und Dioctyl Butamido Triazon (Uvasorb® HEB):
Propan-1 ,3-dione, wie z.B. 1 -(4-tert. Butylphenyl)-3-(4'-methoxyphenyl)propan-1 ,3- dion.
Als wasserlösliche Substanzen kommen in Frage:
2-Phenylbenzimidazol-5-sulfonsäure und deren Alkali-, Erdalkali-, Ammonium-, Alky- lammonium-, Alkanolammonium- und Glucammoniumsalze; Sulfonsäurederivate von Benzophenonen, vorzugsweise 2-Hydroxy-4-methoxybenzo- phenon-5-sulfonsäure und ihre Salze;
Sulfonsäurederivate des 3-Benzylidencamphers, wie z.B. 4-(2-Oxo-3- bornylidenmethyl)benzolsulfonsäure und 2-Methyl-5-(2-oxo-3-bornyliden)sulfonsäure und deren Salze.
Besonders bevorzugt ist die Verwendung von Estern der Zimtsäure, vorzugsweise 4- Methoxyzimtsäure-2-ethylhexylester, 4-Methoxyzimtsäureisopentylester, 2-Cyano-3- phenyl-zimtsäure-2-ethylhexylester (Octocrylene).
Des weiteren ist die Verwendung von Derivaten des Benzophenons, insbesondere 2- Hydroxy-4-methoxybenzophenon, 2-Hydroxy-4-methoxy-4"-methylbenzophenon, 2,2'- Dihydroxy-4-methoxybenzophenon sowie der Einsatz von Propan-1 ,3-dionen, wie z.B. 1 -(4-tert. Butylphenyl)-3-(4-'methoxyphenyl)propan-1 ,3-dion bevorzugt.
Als typische UV-A-Filter kommen in Frage:
Derivate des Benzoylmethans, wie beispielsweise 1-(4'-tert.Butylphenyl)-3-(4'- methoxyphenyl)propan-1 ,3-dion, 4-tert. -Butyl-4'-methoxydibenzoylmethan oder 1- Phenyl-3-(4'-isopropylphenyl)-propan-1 ,3-dion;
Amino-hydroxy-substituierte Derivate von Benzophenonen wie z.B. N,N-Diethylamino- hydroxybenzoyl-n-hexylbenzoat.
Die UV-A und UV-B-Filter können selbstverständlich auch in Mischungen eingesetzt werden.
Geeignete UV-Filtersubstanzen sind in der folgenden Tabelle genannt.
Neben den beiden vorgenannten Gruppen primärer Lichtschutzstoffe können auch sekundäre Lichtschutzmittel vom Typ der Antioxidantien eingesetzt werden, die die photochemische Reaktionskette unterbrechen, welche ausgelöst wird, wenn UV- Strahlung in die Haut eindringt. Typische Beispiele hierfür sind Superoxid-Dismutase, Katalase, Tocopherole (Vitamin E), Coenzym Q10, Ubichinone, Chinone und Ascorbin- säure (Vitamin C).
Eine weitere Gruppe sind Anti-irritantien, die eine entzündungshemmende Wirkung auf durch UV-Licht geschädigte Haut besitzen. Solche Stoffe sind beispielsweise Bisabolol, Phytol und Phytantriol.
Erfindungsgemäß Effektormoleküle sind weiterhin UV-Strahlen abhaltende anorgani- sehe Pigmenten. Bevorzugt sind Pigmente auf Basis von Metalloxiden und/oder anderen in Wasser schwerlöslichen oder unlöslichen Metallverbindungen ausgewählt aus der Gruppe der Oxide des Zinks (ZnO), Titan (TiO2), Eisens (z.B. Fe2O3), Zirkoniums (ZrO2), Siliciums (SiO2), Mangans (z.B. MnO), Aluminiums (AI2O3), Cers (z.B. Ce2O3), Mischoxiden der entsprechenden Metalle und Abmischungen aus solchen Oxiden.
Die anorganischen Pigmente können dabei in gecoateter Form vorliegen, d.h. dass sie oberflächlich behandelt sind. Diese Oberflächenbehandlung kann beispielsweise darin bestehen, dass die Pigmente nach an sich bekannter Weise, wie in DE-A-33 14 742 beschrieben, mit einer dünnen hydrophoben Schicht versehen sind.
Weitere bevorzugte Effektormoleküle sind Vitamine, insbesondere Vitamin A und deren Ester. Unter Retinoide sind im Rahmen der vorliegenden Erfindung Vitamin A Alkohol (Retinol) und seine Derivate wie Vitamin A Aldehyd (Retinal), Vitamin A Säure (Retinsäure) und Vitamin A Ester (z.B. Retinylacetat, Retinylpropionat und Retinylpalmitat) gemeint. Der Begriff Retinsäure umfasst dabei sowohl all-trans Retinsäure als auch 13-cis Retinsäure. Die Begriffe Retinol und Retinal umfassen bevorzugt die all-trans Verbindungen. Als bevorzugtes Retinoid verwendet man für die erfindungsgemäßen Suspensionen all-trans-Retinol, im folgenden als Retinol bezeichnet.
Weitere bevorzugte Effektormoleküle sind Vitamine, Provitamine und Vitaminvorstufen aus den Gruppen A, C, E und F, insbesondere 3,4-Didehydroretinol, ß-Carotin (Provitamin des Vitamin A), Ascorbinsäure (Vitamin C), sowie die Palmitinsäureester, Gluco- side oder Phosphate der Ascorbinsäure, Tocopherole, insbesondere α-Tocopherol sowie seine Ester, z.B. das Acetat, das Nicotinat, das Phosphat und das Succinat; wei- terhin Vitamin F, worunter essentielle Fettsäuren, besonders Linolsäure, Linolensäure und Arachidonsäure, verstanden werden.
Zu den erfindungsgemäß bevorzugt einzusetzenden Vitaminen, Provitaminen oder Vitaminvorstufen der Vitamin B-Gruppe oder deren Derivaten sowie den Derivaten von 2-Furanon gehören unter anderem:
Vitamin B1 , Trivialname Thiamin, chemische Bezeichnung 3-[(4'-Amino-2'-methyl-5'- pyrimidinyl) methyl]-5-(2-hydroxyethyl)-4-methylthiazoliumchlorid.
Vitamin B2, Trivialname Riboflavin, chemische Bezeichung 7,8-Dimethyl-10-(1-D- ribityl)-benzo[g]pteridin-2,4(3H,10H)-dion. In freier Form kommt Riboflavin z. B. in Molke vor, andere Riboflavin-Derivate lassen sich aus Bakterien und Hefen isolieren. Ein erfindungsgemäß ebenfalls geeignetes Stereoisomeres des Riboflavin ist das aus Fischmehl oder Leber isolierbare Lyxoflavin, das statt des D-Ribityl einen D-Arabityl- Rest trägt.
Vitamin B3. Unter dieser Bezeichnung werden häufig die Verbindungen Nicotinsäure und Nicotinsäureamid (Niacinamid) geführt. Erfindungsgemäß bevorzugt ist das Nicotinsäureamid.
Vitamin B5 (Pantothensäure und Panthenol). Bevorzugt wird Panthenol eingesetzt. Erfindungsgemäß einsetzbare Derivate des Panthenols sind insbesondere die Ester und Ether des Panthenols sowie kationisch derivatisierte Panthenole. In einer weiteren bevorzugten Ausführungsform der Erfindung können zusätzlich zu Pantothensäure oder Panthenol auch Derivate des 2-Furanon eingesetzt werden. Besonders bevorzugte Derivate sind die auch im Handel erhältlichen Substanzen Dihydro-3 hydroxy-4,4- dimethyl-2(3H)-furanon mit dem Trivialnamen Pantolacton (Merck), 4 Hydroxymethyl-γ- butyrolacton (Merck), 3,3-Dimethyl-2-hydroxy-γ-butyrolacton (Aldrich) und 2,5- Dihydro- 5-methoxy-2-furanon (Merck), wobei ausdrücklich alle Stereoisomeren eingeschlossen sind.
Vorteilhafterweise verleihen diese Effektormolekül-Verbindungen den erfindungsge- mässen Resilinproteinen feuchtigkeitsspendende sowie hautberuhigende Eigenschaften.
Vitamin B6, wobei man hierunter keine einheitliche Substanz, sondern die unter den Trivialnamen Pyridoxin, Pyridoxamin und Pyridoxal bekannten Derivate des 5 Hydro- xymethyl-2-methylpyridin-3-ols versteht.
Vitamin B7 (Biotin), auch als Vitamin H oder "Hautvitamin" bezeichnet. Bei Biotin handelt es sich um (3aS,4S, 6aR)-2-Oxohexahydrothienol[3,4-d]imidazol-4-valeriansäure.
Panthenol, Pantolacton, Nicotinsäureamid sowie Biotin sind erfindungsgemäß ganz besonders bevorzugt.
Erfindungsgemäß können geeignete Derivate (Salze, Ester, Zucker, Nukleotide, Nukleoside, Peptide und Lipide) der genannten Verbindungen als Effektormoleküle verwendet werden. Als lipophile, öllösliche Antioxidantien aus dieser Gruppe sind To- copherol und dessen Derivate, Gallussäureester, Flavonoide und Carotinoide sowie Butylhydroxytoluol/anisol bevorzugt. Als wasserlösliche Antioxidantien sind Aminosäuren, z. B. Tyrosin und Cystein und deren Derivate sowie Gerbstoffe, insbesondere sol- che pflanzlichen Ursprungs bevorzugt.
Weiter bevorzugt sind sogenannte Peroxydzersetzter, d.h. Verbindungen die in der Lage sind Peroxyde, besonders bevorzugt Lipidperoxyde zu zersetzen. Darunter sind organische Substanzen zu verstehen, wie z.B. Pyridin-2-thiol-3-carbonsäure, 2- Methoxy-pyrimidinol-carbonsäuren, 2-Methoxy-pyridincarbonsäuren, 2-Dimethylamino- pyrimidinolcarbonsäuren, 2-Dimethylamino-pyridincarbonsäuren.
Triterpene, insbesondere Triterpensäuren wie Ursolsäure, Rosmarinsäure, Betulinsäu- re, Boswelliasäure und Bryonolsäure.
Ein weiteres bevorzugtes Effektormolekül ist Liponsäure und geeignete Derivate (Salze, Ester, Zucker, Nukleotide, Nukleoside, Peptide und Lipide).
Weitere bevorzugte Effektormoleküle sind Fettsäuren, insbesondere gesättigte Fett- säuren, die eine Alkylverzweigung tragen, besonders bevorzugt verzweigte Eicosan- säuren, wie 18-Methyl-Eicosansäure. Weitere bevorzugte Effektormoleküle sind Farbstoffe, beispielsweise Lebensmittelfarbstoffe, semipermanente Farbstoffe, Reaktiv- oder Oxidationsfarbstoffe. Bei den Oxidationsfarbstoffen ist es bevorzugt, eine Komponente als Effektormolekül mit den Resilinproteinen zu verknüpfen und anschliessend am Wirkort, d.h. nach Applikation auf Haut, oxidativ mit der zweiten Farbstoffkomponente zu kuppeln. Bevorzugt ist es bei Oxidationsfarbstoffen ferner, die Kupplung der Farbkomponenten vor der Verknüpfung mit den Resilinproteinen auszuführen.
Die Reaktivfarbstoffe können weiterhin bevorzugt als eine Komponente als Effektormo- lekül mit den Resilinproteinen verknüpft sein und anschließend auf die Haut appliziert werden. Weiterhin können solche Farbstoffe, die als Effektormolekül mit den Resilinproteinen verknüpft sind, durch Applikation auf Haut in der dekorativen Kosmetik eingesetzt werden.
Als Farbstoffe sind alle gängigen Haarfarbstoffe für die erfindungsgemässen Moleküle geeignet. Geeignete Farbstoffe sind dem Fachmann aus Handbüchern der Kosmetik beispielsweise Schrader, Grundlagen und Rezepturen der Kosmetika, Hüthig Verlag, Heidelberg, 1989, ISBN 3-7785-1491-1 bekannt.
Besonders vorteilhafte Farbstoffe sind die in der folgenden Liste genannten. Die Colour Index Nummern (CIN) sind dem Rowe Colour Index, 3. Auflage, Society of Dyers and Colourists, Bradford, England, 1971 entnommen.
Gut geeignet können auch Lebensmittelfarbstoffe als Farbstoffe sein.
Die Effektormoleküle sind mit dem Resilinprotein verbunden. Die Verbindung zwischen Effektormolekül und Protein und kann sowohl eine kovalente Bindung sein als auch auf ionischen oder van-der Waals Wechselwirkungen oder hydrophoben Wechselwirkungen oder Wasserstoffbrückenbindungen oder Adsorption beruhen.
Die kovalente Verknüpfung des Effektormoleküls kann über die Seitenketten der PoIy- peptidsequenz des Resilinproteins erfolgen, insbesondere über Aminofunktionen oder Hydroxyfunktionen oder Carboxylatfunktionen oder Thiolfunktionen. Bevorzugt ist eine Verknüpfung über die Aminofunktionen von einem oder mehreren Lysinresten, über die Carboxylatfunktionen von einem oder mehreren Glutamat- oder Aspartat-resten, über die Thiolfunktion von einem oder mehreren Cysteinresten oder über die N-terminale oder C-terminale Funktion des Resilinproteins. Außer den in der Resilinproteinsequenz vorkommenden Aminosäurefunktionen können auch Aminosäuren mit geeigneten Funktionen (z.B. Cysteine, Lysine, Aspartate, Glutamate) an die Sequenz angefügt oder in die Sequenz eingefügt werden, oder Aminosäuren des Resilinproteins durch solche Aminosäurefunktionen substituiert werden.
Die Verknüpfung der Effektormoleküle mit dem Resilinprotein kann direkt, d.h. als kovalente Verknüpfung zweier bereits vorhandener chemischer Funktionen erfolgen. Da- bei werden die oben beschriebenen chemischen Funktionen der Resilinproteine mit reaktiven Gruppen verknüpft, die in den Effektormolekülen enthalten sind. Beispiele für solche reaktiven Gruppen sind Sulfhydryl-reaktiven Gruppen, z.B. Maleimide, Pydridyl- disulfide, α -Haloacetyle, Vinylsulfone, Sulfatoalkylsulfone (bevorzugt Sulfatoethylsul- fone), Amin-reaktive Gruppen (z.B. Succinimidylester, Carbodiimde, Hydroxymethyl- Phosphin, Imidoester, PFP-Ester, Aldehyd, Isothiocyanat etc.), Carboxy-reaktive Gruppen (z.B. Amine etc.), Hydroxyl-reaktive Gruppen (z.B. Isocyanate etc.), unselektive Gruppen (z.B. Arylazide etc.) und photoaktivierbare Gruppen (z.B. Perfluorphenylazid etc.). Besitzen die zu koppelnden Funktionen von Resilinprotein und Effektor eine zu geringe Reaktivität für eine direkte Kopplung, so könnnen diese Funktionen mit dem Fachmann geläufigen Methoden aktiviert werden (z.B. Aktivierung von Carboxylfunktionen mit Carbodiimiden).
Die Verknüpfung kann aber auch über einen sogenannten Linker, d.h. einem mindes- tens bifunktionellen Molekül erfolgen, der mit einer oder mehreren Funktionen mit dem Effektormolekül eine Bindung eingeht und mit einer oder mehreren anderen Funktionen mit dem Resilinprotein verknüpft wird. Die Verwendung solcher massgeschneiderter Linker erlaubt die genaue Anpassung der Verknüpfung an das gewünschte Effektormolekül. Ausserdem ist es dadurch möglich, mehrere Effektormoleküle mit einem Resi- linprotein definiert zu verknüpfen.
Der verwendete Linker richtet sich nach der zu koppelnden Funktionalität. Geeignet sind z.B. Moleküle, die an ein Resilinproteine koppeln mittels
Sulfhydryl-reaktiven Gruppen, z.B. Maleimide, Pydridyldisulfide, α -Haloacetyle, Vinyl- sulfone, Sulfatoalkylsulfone (bevorzugt Sulfatoethylsulfone), Amin-reaktive Gruppen (z.B. Succinimidylester, Carbodiimde, Hydroxymethyl- Phosphin, Imidoester, PFP- Ester, Aldehyd, Isothiocyanat etc.), Carboxy-reaktive Gruppen (z.B. Amine etc.), Hy- droxyl-reaktive Gruppen (z.B. Isocyanate etc.), unselektive Gruppen (z.B. Arylazide etc.) und photoaktivierbare Gruppen (z.B. Perfluorphenylazid etc.) und zu Effektormolekülen mittels - Sulfhydryl-reaktiven Gruppen (z.B. Maleimide, Pydridyldisulfide, α -Haloacetyle, Vinylsulfone, Sulfatoalkylsulfone (bevorzugt Sulfatoethylsulfone) Amin-reaktive Gruppen (z.B. Succinimidylester, Carbodiimde, Hydroxymethyl- Phosphin, Imidoester, PFP-Ester, Aldehyd, Isothiocyanat etc.) Zucker bzw. oxidierte Zucker-reaktive Gruppen (z.B. Hydrazide etc.) - Carboxy-reaktive Gruppen (z.B. Amine etc.)
Hydroxyl-reaktive Gruppen (z.B. Isocyanate etc.) Thymin-reaktive Gruppen (z.B. Psoralen etc.) unselektive Gruppen (z.B. Arylazide etc.) photoaktivierbare Gruppen (z.B. Perfluorphenylazid etc.) - Metallkomplexierenden Gruppen (z.B. EDTA, Hexahis, Ferritin)
Antikörper und -fragmente (z.B. single-chain antibodies, F(ab)-Fragmente von Antikörpern, katalytische Antikörper).
Die chemischen Funktionen eines Linkers können durch Spacerelemente verbunden sein. Spacerelemete können beispielsweise aus, Alkylketten, Ethylenglykol und PoIy- ethylenglykolen zusammengesetzt sein.
Besonders bevorzugt sind Linker- und/oder Spacerelemente, die eine potentielle Spaltstelle für eine Protease, Lipase, Esterase, Phosphatase, Hydrolase besitzen, d.h. en- zymatisch spaltbar sind. Beispiele für enzymatisch spaltbare Linker, die bei den erfindungsgemässen Molekülen eingesetzt werden können, sind beispielsweise in WO 98/01406 genannt, auf deren gesamten Inhalt hiermit ausdrücklich Bezug genommen wird. Besonders bevorzugt sind Linker und Spacer die thermospaltbar, photospaltbar sind. Entsprechende chemische Strukturen sind dem Fachmann bekannt und werden zwischen die Molekülteile Effektormolekül und Resilinprotein integriert.
Falls das Effektormolekül aus einer Polypeptidsequenz besteht, kann die Verknüpfung von Effektor und Resilinprotein als ein sogenanntes Fusionsprotein erfolgen, d.h. es wird eine durchgängige Polypeptidsequenz verwendet, die sich aus Effektor- und Resi- linproteinteilsequenzen zusammensetzt.
Es können zwischen Effektor und Resilinprotein auch noch sogenannte Spacerelemen- te eingebaut werden, beispielsweise Polypeptidsequenzen, die eine potentielle Spaltstelle für eine Protease, Lipase, Esterase, Phosphatase, Hydrolase besitzen oder ON- go- und Polypeptidsequenzen, die eine leichte Aufreinigung des Fusionsproteins gestatten, beispielsweise sogenannte His-tags, d.h. Oligohistidinreste.
Die an Resilinproteine kovalent oder nicht-kovalent gekoppelten Effektormoleküle können in ihrer gebundenen Form aktiv sein. Alternativ können die an Resilinproteine gekoppelten Effektormoleküle aber auch von den Resilinproteinen freigesetzt werden.
Die Freisetzung kovalent gekoppelter Effektormoleküle von den Resiliproteinen kann durch Spaltung spezifisch eingebrachter spaltbarer Spacer oder Kopplungslinker, die z.B. thermospaltbar, photospaltbar oder enzymatisch spaltbar sein können, aber auch durch proteolytischen Abbau (z.B. durch Proteasen) erfolgen.
Für die erfindungsgemäße Verwendung in der Kosmetik werden die Resilinproteine mit üblichen weiteren in der Kosmetik Anwendung findenden Wirk- und Hilfsstoffen formuliert.
Bevorzugt werden die erfindungsgemäßen Resilinproteine für die Hautkosmetik angewendet.
Geeignete Hilfs- und Zusatzstoffe für die Herstellung von haarkosmetischen, nagelkosmetischen oder hautkosmetischen Zubereitungen sind dem Fachmann geläufig und können aus Handbüchern der Kosmetik, beispielsweise Schrader, Grundlagen und Rezepturen der Kosmetika, Hüthig Verlag, Heidelberg, 1989, ISBN 3-7785-1491-1 , entnommen werden.
Bei den erfindungsgemäßen kosmetischen Mitteln kann es sich um hautkosmetische, nagelkosmetische, haarkosmetische, dermatologische, hygienische oder pharmazeutische Mittel handeln. Vorzugsweise liegen die erfindungsgemäßen Mittel in Form eines Gels, Schaums, Sprays, einer Salbe, Creme, Emulsion, Suspension, Lotion, Milch oder Paste vor. Ge- wünschtenfalls können auch Liposomen oder Mikrosphären eingesetzt werden.
Die erfindungsgemäßen kosmetisch oder pharmazeutisch aktiven Mittel können zusätzlich kosmetisch und/oder dermatologisch aktive Wirkstoffe sowie Hilfsstoffe enthalten.
Vorzugsweise enthalten die erfindungsgemäßen kosmetischen Mittel wenigstens ein Resilinprotein, und wenigstens einen davon verschiedenen Bestandteil, der ausgewählt ist unter kosmetisch aktiven Wirkstoffen, Emulgatoren, Tensiden, Konservierungsmitteln, Parfümölen, Verdickern, Haarpolymeren, Haar-und Hautconditionern, Pfropfpolymeren, wasserlöslichen oder dispergierbaren silikonhaltigen Polymeren, Lichtschutzmitteln, Bleichmitteln, Gelbildnern, Pflegemitteln, Färbemitteln, Tönungsmit- teln, Bräunungsmitteln, Farbstoffen, Pigmenten, Konsistenzgebern, Feuchthaltemitteln, Rückfettern, Collagen, Eiweißhydrolysaten, Lipiden, Antioxidantien, Entschäumern, Antistatika, Emollienzien und Weichmachern. Die Resilinproteine können auch in ver- kapselter Form in den kosmetischen Zubereitungen enthalten sein.
Vorteilhafterweise werden die Antioxidantien gewählt aus der Gruppe, bestehend aus Aminosäuren (z.B. Glycin, Histidin, Tyrosin, Tryptophan) und deren Derivate, Imidazo- Ie (z.B. Urocaninsäure) und deren Derivate, Peptide wie D,L-Carnosin, D-Carnosin, L- Carnosin und deren Derivate (z.B. Anserin), Carotinoide, Carotine (z.B. ß-Carotin, Ly- copin) und deren Derivate, Chlorogensäure und deren Derivate, Liponsäure und deren Derivate (z.B. Dihydroliponsäure), Aurothioglucose, Propylthiouracil und andere Thiole (z.B. Thiorodoxin, Glutathion, Cystein, Cystin, Cystamin und deren Glycosyl-, N-Acetyl- , Methyl-, Ethyl-, Propyl-, Amyl-, Butyl-, und Lauryl-, Palmitoyl-, Oleyl-, γ-Linoleyl-, Cho- lesteryl- und Glycerylester) sowie deren Salze, Dilaurylthiodipropionat, Distearylthio- dipropionat, Thiodipropionsäure und deren Derivate (Ester, Ether, Peptide, Lipide, Nukleotide, Nukleoside und Salze) sowie Sulfoximinverbindungen (z.B. Buthioninsulfo- ximine, Homocysteinsulfoximine, Buthioninsulfone, Penta-, Hexa-, Heptathioninsulfo- ximin) in sehr geringen verträglichen Dosierungen (z.B. pmol bis μmol/kg), ferner (Me- tall)-Chelatoren (z.B. α-Hydroxyfettsäuren, Palmitinsäure, Phytinsäure, Lactoferrin), α- Hydroxysäuren (z.B. Citronensäure, Milchsäure, Apfelsäure), Huminsäure, Gallensäu- re, Gallenextrakte, Bilirubin, Biliverdin, EDTA und deren Derivate, ungesättigte Fettsäuren und deren Derivate (z.B. γ-Linolensäure, Linolsäure, Ölsäure), Folsäure und deren Derivate, Ubichinon und Ubichinol und deren Derivate, Vitamin C und deren Derivate (z.B. Natriumascorbat, Ascorbylpalmitat, Mg-Ascorbylphosphat, Ascorbylacetat), Tocopherol und Derivate (z.B. Vitamin-E-Acetat, Tocotrienol), Vitamin A und Derivate (Vitamin-A-Palmitat) sowie Koniferylbenzoat des Benzoeharzes, Rutinsäure und deren Derivate, α-Glycosylrutin, Ferulasäure, Furfurylidenglucitol, Carnosin, Butylhydroxyto- luol, Butylhydroxyanisol, Nordihydroguajakharzsäure, Nordihydroguajaretsäure, Tri- hydroxybutyrophenon, Harnsäure und deren Derivate, Mannose und deren Derivate, Zink und dessen Derivate (z.B. ZnO, ZnSO4), Selen und dessen Derivate (z.B. Selen- methionin), Stilbene und deren Derivate (z.B. Stilbenoxid, Trans-Stilbenoxid).
Vorteilhaft sind weiterhin sogenannte Peroxydzersetzter, d.h. Verbindungen die in der Lage sind Peroxyde, besonders bevorzugt Lipidperoxyde zu zersetzen. Darunter sind organische Substanzen zu verstehen, wie z.B. Pyridin-2-thiol-3-carbonsäure, 2- Methoxy-pyrimidinol-carbonsäuren, 2-Methoxy-pyridincarbonsäuren, 2-Dimethylamino- pyrimidinolcarbonsäuren, 2-Dimethylamino-pyridincarbonsäuren.
Übliche Verdickungsmittel in derartigen Formulierungen sind vernetzte Polyacrylsäu- ren und deren Derivate, Polysaccharide und deren Derivate, wie Xanthangum, Agar- Agar, Alginate oder Tylosen, Cellulosederivate, z.B. Carboxymethylcellulose oder Hydroxycarboxymethylcellulose, Fettalkohole, Monoglyceride und Fettsäuren, Polyvi- nylalkohol und Polyvinylpyrrolidon. Bevorzugt werden nichtionische Verdicker eingesetzt.
Geeignete kosmetisch und/oder dermatologisch aktive Wirkstoffe sind z.B. färbende Wirkstoffe, Haut-und Haarpigmentierungsmittel, Tönungsmittel, Bräunungsmittel, Bleichmittel, Keratin-härtende Stoffe, antimikrobielle Wirkstoffe, Lichtfilterwirkstoffe, Repellentwirkstoffe, hyperemisierend wirkende Stoffe, keratolytisch und kera- toplastisch wirkende Stoffe, Antischuppenwirkstoffe, Antiphlogistika, keratinisierend wirkende Stoffe, antioxidativ bzw. als Radikalfänger aktive Wirkstoffe, hautbefeuchtende oder -feuchthaltende Stoffe, rückfettende Wirkstoffe, antierythimatös oder antialler- gisch aktive Wirkstoffe, verzweigte Fettsäuren wie 18-Methyleicosansäure, und Mischungen davon.
Künstlich hautbräunende Wirkstoffe, die geeignet sind, die Haut ohne natürliche oder künstliche Bestrahlung mit UV-Strahlen zu bräunen, sind z.B. Dihydroxyaceton, AIIo- xan und Walnussschaienextrakt. Geeignete Keratin-härtende Stoffe sind in der Regel Wirkstoffe, wie sie auch in Antitranspirantien eingesetzt werden, wie z.B. Kaliumaluminiumsulfat, Aluminiumhydroxychlorid, Aluminiumlactat, etc.
Antimikrobielle Wirkstoffe werden eingesetzt, um Mikroorganismen zu zerstören bzw. ihr Wachstum zu hemmen und dienen somit sowohl als Konservierungsmittel als auch als desodorierend wirkender Stoff, welcher die Entstehung oder die Intensität von Körpergeruch vermindert. Dazu zählen z.B. übliche, dem Fachmann bekannte Konservierungsmittel, wie p-Hydroxybenzoesäureester, Imidazolidinyl-Harnstoff, Formaldehyd, Sorbinsäure, Benzoesäure, Salicylsäure, etc. Derartige desodorierend wirkende Stoffe sind z.B. Zinkricinoleat, Triclosan, Undecylensäurealkylolamide, Citronensäuretriethy- lester, Chlorhexidin etc. Als geeignete Konservierungsmittel, die mit ihrer E-Nummer nachfolgend aufgeführt sind, sind erfindungsgemäß vorteilhaft zu verwenden.
Ferner sind erfindungsgemäß in der Kosmetik gebräuchliche Konservierungsmittel oder Konservierungshilfsstoffe Dibromdicyanobutan (2-Brom-2- brommethylglutarodinitril), 3-lod-2- propinylbutylcarbamat, 2-Brom-2-nitro-propan-1 ,3-diol, Imidazolidinylharnstoff, 5-Chlor- 2-methyl-4-isothiazolin-3-on, 2-Chloracetamid, Benzalkoniumchlorid, Benzylalkohol geeignet, Formaldehydabspalter.
Ferner sind Phenylhydroxyalkylether, insbesondere die unter der Bezeichnung Pheno- xyethanol bekannte Verbindung aufgrund ihrer bakteriziden und fungiziden Wirkungen auf eine Anzahl von Mikroorganismen als Konservierungsmittel geeignet.
Auch andere keimhemmende Mittel sind ebenfalls geeignet, in die erfindungsgemäßen
Zubereitungen eingearbeitet zu werden. Vorteilhafte Substanzen sind zum Beispiel 2,4,4'-Trichlor-2'-hydroxydiphenylether (Irgasan), 1 ,6-Di-(4-chlorphenylbiguanido)- hexan (Chlorhexidin), 3,4,4'-Trichlorcarbanilid, quaternäre Ammoniumverbindungen, Nelkenöl, Minzöl, Thymianöl, Triethylcitrat, Farnesol (3,7,1 1-Trimethyl-2,6, 10- dodecatrien-1-ol) sowie die in den Patentoffenlegungsschriften DE-37 40 186, DE-39 38 140, DE-42 04 321 , DE-42 29 707, DE-43 09 372, DE-44 11 664, DE-195 41 967, DE-195 43 695, DE-195 43 696, DE-195 47 160, DE-196 02 108, DE-196 02 110, DE- 196 02 11 1 , DE-196 31 003, DE-196 31 004 und DE-196 34 019 und den Patentschriften DE-42 29 737, DE-42 37 081 , DE-43 24 219, DE-44 29 467, DE-44 23 410 und DE-195 16 705 beschriebenen Wirkstoffe bzw. Wirkstoffkombinationen. Auch Natrium- hydrogencarbonat ist vorteilhaft zu verwenden.
Geeignete Lichtfilterwirkstoffe sind Stoffe, die UV-Strahlen im UV-B- und/oder UV-A- Bereich absorbieren. Geeignete UV-Filter sind z.B. 2,4,6-Triaryl-1 ,3,5- triazine, bei denen die Arylgruppen jeweils wenigstens einen Substituenten tragen können, der vor- zugsweise ausgewählt ist unter Hydroxy, Alkoxy, speziell Methoxy, Alkoxycarbonyl, speziell Methoxycarbonyl und Ethoxycarbonyl und Mischungen davon. Geeignet sind weiterhin p-Aminobenzoesäureester, Zimtsäureester, Benzophenone, Campherderivate sowie UV-Strahlen abhaltende Pigmente, wie Titandioxid, Talkum und Zinkoxid.
Als UV-Filtersubstanzen kommen beliebige UV-A- und UV-B-Filtersubstanzen in Betracht. Beispielsweise sind zu nennen:
Die erfindungsgemäßen kosmetischen und dermatologischen Zubereitungen können vorteilhafterweise außerdem UV-Strahlen abhaltende anorganische Pigmente auf Basis von Metalloxiden und/oder anderen in Wasser schwerlöslichen oder unlöslichen Metallverbindungen, ausgewählt aus der Gruppe der Oxide des Zinks (ZnO), Titan (TiO2), Eisens (z.B. Fe2O3), Zirkoniums (ZrO2), Siliciums (SiO2), Mangans (z.B. MnO), Aluminiums (AI2O3), Cers (z.B. Ce2O3), Mischoxiden der entsprechenden Metalle sowie Abmischungen aus solchen Oxiden enthalten.
Die anorganischen Pigmente können dabei in gecoateter Form vorliegen, d.h. dass sie oberflächlich behandelt sind. Diese Oberflächenbehandlung kann beispielsweise darin bestehen, dass die Pigmente nach an sich bekannter Weise, wie in DE-A-33 14 742 beschrieben, mit einer dünnen hydrophoben Schicht versehen sind. Geeignete Repellentwirkstoffe sind Verbindungen, die in der Lage sind, bestimmte Tiere, insbesondere Insekten, vom Menschen abzuhalten oder zu vertreiben. Dazu gehört z.B. 2-Ethyl-1 , 3-hexandiol, N, N-Diethyl-m-toluamid etc. Geeignete hyperemisierend wirkende Stoffe, welche die Durchblutung der Haut anregen, sind z.B. ätherische Öle, wie Latschenkieferextrakt, Lavendelextrakt, Rosmarinextrakt, Wacholderbeerextrakt, Rosskastanienextrakt, Birkenblätterextrakt, Heublumenextrakt, Ethylacetat, Campher, Menthol, Pfefferminzöl, Rosmarinextrakt, Eukalyptusöl, etc. Geeignete keratolytisch und keratoplastisch wirkende Stoffe sind z.B. Salicylsäure, Kalziumthioglykolat, Thi- oglykolsäure und ihre Salze, Schwefel, etc. Geeignete Antischuppen-Wirkstoffe sind z.B. Schwefel, Schwefelpolyethylenglykolsorbitanmonooleat, Schwefelricinolpolyetho- xylat, Zinkpyrithion, Aluminiumpyrithion, etc. Geeignete Antiphlogistika, die Hautreizungen entgegenwirken, sind z.B. Allantoin, Bisabolol, Dragosantol, Kamillenextrakt, Panthenol, etc.
Die erfindungsgemäßen kosmetischen Mittel können als kosmetischen und/oder pharmazeutischen Wirkstoff (wie auch gegebenenfalls als Hilfsstoff) wenigstens ein kosmetisch oder pharmazeutisch akzeptables Polymer enthalten. Dazu zählen ganz allgemein kationische, amphotere und neutrale Polymere.
Geeignete Polymere sind z.B. kationische Polymere mit der Bezeichnung Polyquater- nium nach INCI, z.B. Copolymere aus Vinylpyrrolidon/N-Vinylimidazoliumsalzen (Luvi- quat FC, Luviquat HM, Luviquat MS, Luviquat&commat, Care), Copolymere aus N- Vinylpyrrolidon/Dimethylaminoethylmethacrylat, quaternisiert mit Diethylsulfat (Luvi- quat PQ 1 1 ), Copolymere aus N-Vinylcaprolactam/N-Vinylpyrrolidon/N-
Vinylimidazoliumsalzen (Luviquat E Hold), kationische Cellulosederivate (Polyquater- nium-4 und -10), Acrylamidocopolymere (Polyquaternium-7) und Chitosan.
Geeignete kationische (quaternisierte) Polymere sind auch Merquat (Polymer auf Basis von Dimethyldiallylammoniumchlorid), Gafquat (quaternäre Polymere, die durch Reaktion von Polyvinylpyrrolidon mit quaternären Ammoniumverbindungen entstehen), Polymer JR (Hydroxyethylcellulose mit kationischen Gruppen) und kationische Polymere auf pflanzlicher Basis, z.B. Guarpolymere, wie die Jaguar-Marken der Firma Rhodia.
Weitere geeignete Polymere sind auch neutrale Polymere, wie Polyvinylpyrrolidone, Copolymere aus N-Vinylpyrrolidon und Vinylacetat und/oder Vinylpropionat, Polysilo- xane, Polyvinylcaprolactam und andere Copolymere mit N-Vinylpyrrolidon, Polyethyle- nimine und deren Salze, Polyvinylamine und deren Salze, Cellulosederivate, Polyaspa- raginsäuresalze und Derivate. Dazu zählt beispielsweise Luviflex 0 Swing (teilverseif- tes Copolymerisat von Polyvinylacetat und Polyethylenglykol, Firma BASF). Geeignete Polymere sind auch nichtionische, wasserlösliche bzw. wasserdispergierba- re Polymere oder Oligomere, wie Polyvinylcaprolactam, z.B. Luviskol 0 Plus (BASF), oder Polyvinylpyrrolidon und deren Copolymere, insbesondere mit Vinylestern, wie Vinylacetat, z.B. Luviskol 0 VA 37 (BASF), Polyamide, z.B. auf Basis von Itaconsäure und aliphatischen Diaminen, wie sie z.B. in der DE-A-43 33 238 beschrieben sind.
Geeignete Polymere sind auch amphotere oder zwitterionische Polymere, wie die unter den Bezeichnungen Amphomer (National Starch) erhältlichen Octylacrylamid / Methyl- methacrylat / tert.-Butylaminoethylmethacrylat-Hydroxypropylmethacrylat-Copolymere sowie zwitterionische Polymere, wie sie beispielsweise in den deutschen Patentanmeldungen DE39 29 973, DE 21 50 557, DE28 17 369 und DE 3708 451 offenbart sind. Acrylamidopropyltrimethylammoniumchlorid/Acrylsäure-bzw. -Methacrylsäure- Copolymerisate und deren Alkali-und Ammoniumsalze sind bevorzugte zwitterionische Polymere. Weiterhin geeignete zwitterionische Polymere sind Methacroylethylbe- tain/Methacrylat-Copolymere, die unter der Bezeichnung Amersette (AMERCHOL) im Handel erhältlich sind, und Copolymere aus Hydroxyethylmethacrylat, Methylmethacry- lat, N, N-Dimethylaminoethylmethacrylat und Acrylsäure (Jordapon (D)).
Geeignete Polymere sind auch nichtionische, siloxanhaltige, wasserlösliche oder - dispergierbare Polymere, z.B. Polyethersiloxane, wie Tegopren 0 (Firma Goldschmidt) oder Besi&commat (Firma Wacker).
Die Formulierungsgrundlage erfindungsgemäßer kosmetischer Mittel enthält bevorzugt kosmetisch und/oder pharmazeutisch akzeptable Hilfsstoffe. Pharmazeutisch akzepta- bei sind die im Bereich der Pharmazie, der Lebensmitteltechnologie und angrenzenden Gebieten bekanntermassen verwendbaren Hilfsstoffe, insbesondere die in einschlägigen Arzneibüchern (z.B. DAB Ph. Eur. BP NF) gelisteten sowie andere Hilfsstoffe, deren Eigenschaften einer physiologischen Anwendung nicht entgegenstehen.
Geeignete Hilfsstoffe können sein: Gleitmittel, Netzmittel, emulgierende und suspendierende Mittel, konservierende Mittel, Antioxidantien, Antireizstoffe, Chelatbildner, Emulsionsstabilisatoren, Filmbildner, Gelbildner, Geruchsmaskierungsmittel, Harze, Hydrokolloide, Lösemittel, Lösungsvermittler, Neutralisierungsmittel, Permeations- beschleuniger, Pigmente, quaternäre Ammoniumverbindungen, Rückfettungs- und Überfettungsmittel, Salben-, Creme- oder Öl-Grundstoffe, Siliconderivate, Stabilisatoren, Sterilantien, Treibmittel, Trocknungsmittel, Trübungsmittel, Verdickungsmittel, Wachse, Weichmacher, Weissöl. Eine diesbezügliche Ausgestaltung beruht auf fachmännischem Wissen, wie sie beispielsweise in Fiedler, H. P. Lexikon der Hilfsstoffe für Pharmazie, Kosmetik und angrenzende Gebiete, 4. Aufl., Aulendorf: ECV-Editio- Kantor-Verlag, 1996, dargestellt sind. Zur Herstellung der erfindungsgemäßen dermatologischen Mittel können die Wirkstoffe mit einem geeigneten Hilfsstoff (Exzipient) vermischt oder verdünnt werden. Exzipien- ten können feste, halb feste oder flüssige Materialien sein, die als Vehikel, Träger oder Medium für den Wirkstoff dienen können. Die Zumischung weiterer Hilfsstoffe erfolgt gewünschtenfalls in der dem Fachmann bekannten Weise. Weiterhin sind die Polymere und Dispersionen geeignet als Hilfsmittel in der Pharmazie, bevorzugt als oder in Beschichtungsmittel(n) oder Bindemittel(n) für feste Arzneiformen. Sie können auch in Cremes und als Tablettenüberzugsmittel und Tablettenbindemittel verwendet werden.
Nach einer bevorzugten Ausführungsform handelt es sich bei den erfindungsgemäßen Mitteln um ein Hautreinigungsmittel.
Bevorzugte Hautreinigungsmittel sind Seifen von flüssiger bis gelförmiger Konsistenz, wie Transparentseifen, Luxusseifen, Deoseifen, Cremeseifen, Babyseifen, Hautschutz- seifen, Abrasiveseifen und Syndets, pasteuse Seifen, Schmierseifen und Waschpasten, Peelingseifen, Feuchtigkeitstücher, flüssige Wasch-, Dusch- und Badepräparate, wie Waschlotionen, Duschbäder und -gele, Schaumbäder, Ölbäder und Scrub- Präparate, Rasierschäume, -lotionen und -cremes.
Nach einer weiteren bevorzugten Ausführungsform handelt es sich bei den erfindungsgemäßen Mitteln um kosmetische Mittel zur Pflege und zum Schutz der Haut und Haar, Nagelpflegemittel oder Zubereitungen für die dekorative Kosmetik.
Geeignete hautkosmetische Mittel sind z.B. Gesichtswässer, Gesichtsmasken, Deodo- rantien und andere kosmetische Lotionen. Mittel für die Verwendung in der dekorativen Kosmetik umfassen beispielsweise Abdeckstifte, Theaterfarben, Mascara und Lidschatten, Lippenstifte, Kajalstifte, Eyeliner, Rouges, Puder und Augenbrauenstifte.
Ausserdem können die erfindungsgemäßen dermatologischen Mittel verwendet wer- den in Nose-Strips zur Porenreinigung, in Antiaknemitteln, Repellents, Rasiermitteln, After- und Pre Shave Pflegemittel, After Sun Pflegemittel, Haarentfernungsmitteln, Haarfärbenitteln, Intimpflegemitteln, Fusspflegemitteln sowie in der Babypflege.
Bei den erfindungsgemäßen Hautpflegemitteln handelt es sich insbesondere um W/0- oder O/W-Hautcremes, Tag- und Nachtcremes, Augencremes, Gesichtscremes, Anti- faltencremes, Sonnenschutzcremes, Feuchthaltecremes, Bleichcremes, Selbstbräunungscremes, Vitamincremes, Hautlotionen, Pflegelotionen und Feuchthaltelotionen.
Hautkosmetische und dermatologische Mittel auf Basis der zuvor beschriebenen Resi- linproteine zeigen vorteilhafte Wirkungen. Die Resilinproteine können unter anderem zur Feuchthaltung und Konditionierung der Haut und zur Verbesserung des Hautgefühls beitragen. Die Resilinproteine können auch als Verdicker in den Formulierungen wirken. Durch Zusatz der erfindungsgemäßen Resilinproteine kann in bestimmten Formulierungen eine erhebliche Verbesserung der Hautverträglichkeit erreicht werden.
Hautkosmetische und dermatologische Mittel enthalten vorzugsweise wenigstens ein Resilinprotein in einem Anteil von etwa 0,001 bis 30 Gew.-%, vorzugsweise 0,01 bis 20 Gew.-%, ganz besonders bevorzugt 0,1 bis 12 Gew.-%, bezogen auf das Gesamtgewicht des Mittels.
Besonders Lichtschutzmittel auf Basis der Resilinproteine besitzen die Eigenschaft, die Verweilzeit der UV-absorbierenden Inhaltsstoffe im Vergleich zu gängigen Hilfsmitteln wie Polyvinylpyrrolidon zu erhöhen.
Je nach Anwendungsgebiet können die erfindungsgemäßen Mittel in einer zur Hautpflege geeigneten Form, wie z.B. als Creme, Schaum, Gel, Stift, Mousse, Milch, Spray (Pumpspray oder treibmittelhaltiger Spray) oder Lotion appliziert werden.
Die hautkosmetischen Zubereitungen können neben den Resilinproteinen und geeigneten Trägern noch weitere in der Hautkosmetik übliche Wirkstoffe und Hilfsstoffe, wie zuvor beschrieben, enthalten. Dazu zählen vorzugsweise Emulgatoren, Konservie- rungsmittel, Parfümöle, kosmetische Wirkstoffe wie Phytantriol, Vitamin A, E und C, Retinol, Bisabolol, Panthenol, Lichtschutzmittel, Bleichmittel, Färbemittel, Tönungsmittel, Bräunungsmittel, Collagen, Enzyme, Eiweisshydrolysate, Stabilisatoren, pH-Wert- Regulatoren, Farbstoffe, Salze, Verdicker, Gelbildner, Konsistenzgeber, Silicone, Feuchthaltemittel, Rückfetter und weitere übliche Additive.
Bevorzugte Öl- und Fettkomponenten der hautkosmetischen und dermatologischen Mittel sind die zuvor genannten mineralischen und synthetischen Öle, wie z.B. Paraffine, Siliconöle und aliphatische Kohlenwasserstoffe mit mehr als 8 Kohlenstoffatomen, tierische und pflanzliche Öle, wie z.B. Sonnenblumenöl, Kokosöl, Avocadoöl, Olivenöl, Lanolin, oder Wachse, Fettsäuren, Fettsäureester, wie z.B. Triglyceride von C6-C30- Fettsäuren, Wachsester, wie z.B. Jojobaöl, Fettalkohole, Vaseline, hydriertes Lanolin und acetyliertes Lanolin sowie Mischungen davon.
Man kann die erfindungsgemäßen Resilinproteine auch mit herkömmlichen Polymeren abmischen, falls spezielle Eigenschaften eingestellt werden sollen.
Zur Einstellung bestimmter Eigenschaften wie z.B. Verbesserung des Anfassgefühls, des Spreitverhaltens, der Wasserresistenz und/oder der Bindung von Wirk- und Hilfs- stoffen, wie Pigmenten, können die hautkosmetischen und dermatologischen Zuberei- tungen zusätzlich auch konditionierende Substanzen auf Basis von Siliconverbindungen enthalten. Geeignete Siliconverbindungen sind beispielsweise Polyalkylsiloxane, Polyarylsiloxa- ne, Polyarylalkylsiloxane, Polyethersiloxane oder Siliconharze.
Die Herstellung der kosmetischen oder dermatologischen Zubereitungen erfolgt nach üblichen, dem Fachmann bekannten Verfahren.
Bevorzugt liegen die kosmetischen und dermatologischen Mittel in Form von Emulsionen insbesondere als Wasser-in-ÖI (W/O)- oder Öl-in-Wasser (O/W)-Emulsionen vor.
Es ist aber auch möglich, andere Formulierungsarten zu wählen, beispielsweise, Gele, Öle, Öleogele, multiple Emulsionen, beispielsweise in Form von W/O/W- oder O/W/O- Emulsionen, wasserfreie Salben bzw. Salbengrundlagen, usw. Auch emulgatorfreie Formulierungen wie Hydrodispersionen, Hydrogele oder eine Pickering-Emulsion sind vorteilhafte Ausführungsformen.
Die Herstellung von Emulsionen erfolgt nach bekannten Methoden. Die Emulsionen enthalten neben wenigstens einem Resilinprotein in der Regel übliche Bestandteile, wie Fettalkohole, Fettsäureester und insbesondere Fettsäuretriglyceride, Fettsäuren, Lanolin und Derivate davon, natürliche oder synthetische Öle oder Wachse und Emul- gatoren in Anwesenheit von Wasser. Die Auswahl der Emulsionstyp-spezifischen Zusätze und die Herstellung geeigneter Emulsionen ist beispielsweise beschrieben in Schrader, Grundlagen und Rezepturen der Kosmetika, Hüthig Buch Verlag, Heidelberg, 2. Auflage, 1989, dritter Teil, worauf hiermit ausdrücklich Bezug genommen wird.
Eine geeignete Emulsion als W/O-Emulsion, z.B. für eine Hautcreme etc., enthält im Allgemeinen eine wässrige Phase, die mittels eines geeigneten Emulgatorsystems in einer Öl- oder Fettphase emulgiert ist. Zur Bereitstellung der wässrigen Phase kann ein Polyelektrolytkomplex eingesetzt werden.
Bevorzugte Fettkomponenten, welche in der Fettphase der Emulsionen enthalten sein können, sind: Kohlenwasserstofföle, wie Paraffinöl, Purcellinöl, Perhydrosqualen und Lösungen mikrokristalliner Wachse in diesen Ölen; tierische oder pflanzliche Öle, wie Süssmandelöl, Avocadoöl, Calophylumöl, Lanolin und Derivate davon, Ricinusöl, Se- samöl, Olivenöl, Jojobaöl, Karite-Öl, Hoplostethus-Öl, mineralische Öle, deren Destilla- tionsbeginn unter Atmosphärendruck bei ca. 2500C und deren Destillationsendpunkt bei 4100C liegt, wie z.B. Vaselinöl, Ester gesättigter oder ungesättigter Fettsäuren, wie Alkylmyristate, z.B. i-Propyl-, Butyl- oder Cetylmyristat, Hexadecylstearat, Ethyl- oder i- Propylpalmitat, Octan- oder Decansäuretriglyceride und Cetylricinoleat.
Die Fettphase kann auch in anderen Ölen lösliche Siliconöle, wie Dimethylpolysiloxan, Methylphenylpolysiloxan und das Siliconglykol-Copolymer, Fettsäuren und Fettalkohole enthalten. Neben den Resilinproteinen können auch Wachse verwendet werden, wie z.B. Car- naubawachs, Candilillawachs, Bienenwachs, mikrokristallines Wachs, Ozokeritwachs und Ca-, Mg- und Al-Oleate, -Myristate, -Linoleate und -Stearate.
Weiterhin kann eine erfindungsgemäße Emulsion als O/W-Emulsion vorliegen. Eine derartige Emulsion enthält üblicherweise eine Ölphase, Emulgatoren, die die Ölphase in der Wasserphase stabilisieren, und eine wässrige Phase, die üblicherweise verdickt vorliegt. Als Emulgatoren kommen vorzugsweise O/W-Emulgatoren, wie Polyglycerin- ester, Sorbitanester oder teilveresterte Glyceride, in Betracht.
Nach einer weiteren bevorzugten Ausführungsform handelt es sich bei den erfindungsgemäßen Mitteln um ein Duschgel, eine Shampoo-Formulierung oder ein Badepräparat.
Solche Formulierungen enthalten wenigstens ein Resilinprotein sowie üblicherweise anionische Tenside als Basistenside und amphotere und/oder nichtionische Tenside als Cotenside. Weitere geeignete Wirkstoffe und/oder Hilfsstoffe sind im allgemeinen ausgewählt unter Lipiden, Parfümölen, Farbstoffen, organischen Säuren, Konservie- rungsstoffen und Antioxidantien sowie Verdickern/Gelbildnern, Hautkonditioniermitteln und Feuchthaltemitteln.
Diese Formulierungen enthalten vorzugsweise 2 bis 50 Gew.-%, bevorzugt 5 bis 40 Gew.-%, besonders bevorzugt 8 bis 30 Gew.-% Tenside, bezogen auf das Gesamt- gewicht der Formulierung.
In den Wasch-, Dusch- und Badepräparaten können alle in Körperreinigungsmitteln üblicherweise eingesetzten anionische, neutrale, amphotere oder kationische Tenside verwendet werden.
Geeignete anionische Tenside sind beispielsweise Alkylsulfate, Alkylethersulfate, Al- kylsulfonate, Alkylarylsulfonate, Alkylsuccinate, Alkylsulfosuccinate, N-Alkoylsarkosi- nate, Acyltaurate, Acylisothionate, Alkylphosphate, Alkyletherphosphate, Alkylethercar- boxylate, Alpha-Olefinsulfonate, insbesondere die Alkali- und Erdalkalimetallsalze, z.B. Natrium, Kalium, Magnesium, Calcium, sowie Ammonium- und Triethanolamin-Salze. Die Alkylethersulfate, Alkyletherphosphate und Alkylethercarboxylate können zwischen 1 bis 10 Ethylenoxid- oder Propylenoxideinheiten, bevorzugt 1 bis 3 Ethylenoxideinhei- ten im Molekül aufweisen.
Dazu zählen z.B. Natriumlaurylsulfat, Ammoniumtaurytsulfat, Natriumlaurylethersulfat, Ammoniumlaurylethersulfat, Natriumlaurylsarkosinat, Natriumoleylsuccinat, Ammoni- umlaurylsulfosuccinat, Natriumdodecylbenzolsulfonat, Triethanolamindodecylbenzol- sulfonat.
Geeignete amphotere Tenside sind z.B. Alkylbetaine, Alkylamidopropylbetaine, Alkyl- sulfobetaine, Alkylglycinate, Alkylcarboxyglycinate, Alkylamphoacetate oder - propionate, Alkylamphodiacetate oder -dipropionate.
Beispielsweise können Cocodimethylsulfopropylbetain, Laurylbetain, Cocamidopropyl- betain oder Natriumcocamphopropionat eingesetzt werden.
Als nichtionische Tenside sind beispielsweise geeignet die Umsetzungsprodukte von aliphatischen Alkoholen oder Alkylphenolen mit 6 bis 20 C-Atomen in der Alkylkette, die linear oder verzweigt sein kann, mit Ethylenoxid und/oder Propylenoxid. Die Menge Alkylenoxid beträgt ca. 6 bis 60 Mole auf ein Mol Alkohol. Ferner sind Alkylaminoxide, Mono-oder Dialkylalkanolamide, Fettsäureester von Polyethylenglykolen, ethoxylierte Fettsäureamide, Alkylpolyglycoside oder Sorbitanetherester geeignet.
Ausserdem können die Wasch-, Dusch- und Badepräparate übliche kationische Tenside enthalten, wie z.B. quaternäre Ammoniumverbindungen, beispielsweise Cetyltri- methylammoniumchlorid.
Weiterhin können die Duschgel-/Shampoo-Formulierungen Verdicker, wie z.B. Kochsalz, PEG-55, Propylenglykol-Oleat, PEG-120-Methylglucosedioleat und andere, sowie Konservierungsmittel, weitere Wirk- und Hilfsstoffe und Wasser enthalten.
Nach einer weiteren bevorzugten Ausführungsform handelt es sich bei den erfindungsgemäßen Mitteln um ein Haarbehandlungsmittel.
Erfindungsgemäße Haarbehandlungsmittel enthalten vorzugsweise wenigstens ein Resilinprotein in einer Menge im Bereich von etwa 0,01 bis 30 Gew.-%, bevorzugt 0,5 bis 20 Gew.-%, bezogen auf das Gesamtgewicht des Mittels.
Vorzugsweise liegen die erfindungsgemäßen Haarbehandlungsmittel in Form eines Schaumfestigers, Haarmousses, Haargels, Shampoos, Haarsprays, Haarschaums, Spitzenfluids, Egalisierungsmittels für Dauerwellen, Haarfärbe- und -bleichmittels oder "Hot-Oil-Treatments" vor. Je nach Anwendungsgebiet können die haarkosmetischen Zubereitungen als (Aerosol-) Spray, (Aerosol-) Schaum, Gel, Gelspray, Creme, Lotion oder Wachs appliziert werden. Haarsprays umfassen dabei sowohl Aerosolsprays als auch Pumpsprays ohne Treibgas. Haarschäume umfassen sowohl Aerosolschäume wie auch Pumpschäume ohne Treibgas. Haarsprays und Haarschäume umfassen vorzugsweise überwiegend oder ausschliesslich wasserlösliche oder wasserdispergierba- re Komponenten. Sind die in den erfindungsgemäßen Haarsprays und Haarschäumen eingesetzten Verbindungen wasserdispergierbar, können sie in Form von wässrigen Mikrodispersionen mit Teilchendurchmessern von üblicherweise 1 bis 350 nm, bevorzugt 1 bis 250 nm, zur Anwendung gebracht werden. Die Feststoffgehalte dieser Präparate liegen dabei üblicherweise in einem Bereich von etwa 0,5 bis 20 Gew.-%. Diese Mikrodispersionen benötigen in der Regel keine Emulgatoren oder Tenside zu ihrer Stabilisierung.
Die erfindungsgemäßen haarkosmetischen Formulierungen enthalten in einer bevorzugten Ausführungsform a) 0,01 bis 30 Gew.-% wenigstens eines Resilinproteins b) 20 bis 99,95 Gew.-% Wasser und/oder Alkohol, c) 0 bis 50 Gew.-% wenigstens eines Treibgases, d) 0 bis 5 Gew.-% wenigstens eines Emulgators, e) 0 bis 3 Gew.-% wenigstens eines Verdickers, sowie bis zu 25 Gew.-% weitere Bestandteile.
Unter Alkohol sind alle in der Kosmetik üblichen Alkohole zu verstehen, z.B. Ethanol, Isopropanol, n-Propanol.
Unter weiteren Bestandteilen sind die in der Kosmetik üblichen Zusätze zu verstehen, beispielsweise Treibmittel, Entschäumer, grenzflächenaktive Verbindungen, d.h. Tenside, Emulgatoren, Schaumbildner und Solubilisatoren. Die eingesetzten grenzflächen- aktiven Verbindungen können anionisch, kationisch, amphoter oder neutral sein. Weitere übliche Bestandteile können ferner sein z.B. Konservierungsmittel, Parfümöle, Trübungsmittel, Wirkstoffe, UV-Filter, Pflegestoffe wie Panthenol, Collagen, Vitamine, Eiweisshydrolysate, Alpha- und Beta-Hydroxycarbonsäuren, Stabilisatoren, pH-Wert- Regulatoren, Farbstoffe, Viskositätsregulierer, Gelbildner, Salze, Feuchthaltemittel, Rückfetter, Komplexbildner und weitere übliche Additive.
Weiterhin zählen hierzu alle in der Kosmetik bekannten Styling- und Conditioner- Polymere, die in Kombination mit den erfindungsgemäßen Resilinproteinen eingesetzt werden können, falls ganz spezielle Eigenschaften eingestellt werden sollen.
Als herkömmliche Haarkosmetik-Polymere eignen sich beispielsweise die zuvor genannten kationischen, anionischen, neutralen, nichtionischen und amphoteren Polymere, auf die hier Bezug genommen wird.
Zur Einstellung bestimmter Eigenschaften können die Zubereitungen zusätzlich auch konditionierende Substanzen auf Basis von Silikonverbindungen enthalten. Geeignete Silikonverbindungen sind beispielsweise Polyalkylsiloxane, Polyarylsiloxane, Polyary- lalkylsiloxane, Polyethersiloxane, Silikonharze oder Dimethicon Copolyole (CTFA) und aminofunktionelle Silikonverbindungen wie Amodimethicone (CTFA).
Die erfindungsgemäßen Polymerisate eignen sich insbesondere als Festigungsmittel in Haarstyling-Zubereitungen, insbesondere Haarsprays (Aerosolsprays und Pumpsprays ohne Treibgas) und Haarschäume (Aerosolschäume und Pumpschäume ohne Treibgas).
In einer bevorzugten Ausführungsform enthalten Spray-Zubereitungen a) 0,01 bis 30 Gew.-% wenigstens eines Resilinproteins , b) 20 bis 99,9 Gew.-% Wasser und/oder Alkohol, c) 0 bis 70 Gew.-% wenigstens eines Treibmittel, d) 0 bis 20 Gew.-% weitere Bestandteile.
Treibmittel sind die für Haarsprays oder Aerosolschäume üblich verwendeten Treibmit- tel. Bevorzugt sind Gemische aus Propan/Butan, Pentan, Dimethylether, 1 ,1- Difluorethan (HFC-152 a), Kohlendioxid, Stickstoff oder Druckluft.
Eine erfindungsgemäß bevorzugte Formulierung für Aerosolhaarschäume enthält a) 0,01 bis 30 Gew.-% wenigstens eines Resilinproteins , b) 55 bis 99,8 Gew.-% Wasser und/oder Alkohol, c) 5 bis 20 Gew.-% eines Treibmittel, d) 0,1 bis 5 Gew.-% eines E- mulgators, e) 0 bis 10 Gew.-% weitere Bestandteile.
Als Emulgatoren können alle in Haarschäumen üblicherweise eingesetzten Emulgato- ren verwendet werden. Geeignete Emulgatoren können nichtionisch, kationisch bzw. anionisch oder amphoter sein.
Beispiele für nichtionische Emulgatoren (INCI-Nomenklatur) sind Laurethe, z.B. Lau- reth-4 ; Cetethe, z.B. Cetheth-1 , Polyethylenglycolcetylether, Cetearethe, z.B. Cethea- reth-25, Polyglycolfettsäureglyceride, hydroxyliertes Lecithin, Lactylester von Fettsäu- ren, Alkylpolyglycoside.
Beispiele für kationische Emulgatoren sind Cetyldimethyl-2-hydroxyethylammonium- dihydrogenphosphat, Cetyltrimoniumchlorid, Cetyltrimmoniumbromid, Cocotrimonium- methylsulfat, Quaternium-1 bis x (INCI).
Anionische Emulgatoren können beispielsweise ausgewählt werden aus der Gruppe der Alkylsulfate, Alkylethersulfate, Alkylsulfonate, Alkylarylsulfonate, Alkylsuccinate, Alkylsulfosuccinate, N-Alkoylsarkosinate, Acyltaurate, Acylisethionate, Alkylphosphate, Alkyletherphosphate, Alkylethercarboxylate, Alpha-Olefinsulfonate, insbesondere die Alkali- und Erdalkalimetallsalze, z.B. Natrium, Kalium, Magnesium, Calcium, sowie
Ammonium- und Triethanolamin-Salze. Die Alkylethersulfate, Alkyletherphosphate und Alkylethercarboxylate können zwischen 1 bis 10 Ethylenoxid oder Propylenoxid- Einheiten, bevorzugt 1 bis 3 Ethylenoxid-Einheiten im Molekül aufweisen.
Eine erfindungsgemäß für Styling-Gele geeignete Zubereitung kann beispielsweise wie folgt zusammengesetzt sein: a) 0,01 bis 30 Gew.-% wenigstens eines Resilinproteins , b) 80 bis 99,85 Gew.-% Wasser und/oder Alkohol, c) 0 bis 3 Gew.-%, bevorzugt 0,05 bis 2 Gew.-%, eines Gelbildners, d) 0 bis 20 Gew.-% weitere Bestandteile. Der Einsatz von Gelbildnern kann von Vorteil sein, um spezielle rheologische oder andere anwendungstechnische Eigenschaften der Gele einzustellen. Als Gelbildner kön- nen alle in der Kosmetik üblichen Gelbildner eingesetzt werden. Hierzu zählen leicht vernetzte Polyacrylsäure, beispielsweise Carbomer (INCI), Cellulosederivate, z.B. Hydroxypropylcellulose, Hydroxyethylcellulose, kationisch modifizierte Cellulosen, Polysaccharide, z.B. Xanthangummi, Capryl/Caprin-Triglycerid, Natriumacrylat- Copolymere, Polyquaternium-32 (und) Paraffinum Liquidum (INCI), Natriumacrylat- Copolymere (und) Paraffinum Liquidum (und) PPG-1 Trideceth-6, Acrylamidopropyltri- moniumchlorid / Acrylamid-Copolymere, Steareth-10-Allylether, Acrylat-Copolymere, Polyquaternium-37 (und) Paraffinum Liquidum (und) PPG-1 Trideceth-6, Polyquaterni- um 37 (und) Propylenglycoldicapratdicaprylat (und) PPG-1 Trideceth-6, Polyquaterni- um-7, Polyquaternium-44.
Die erfindungsgemäßen Resilinproteine können in kosmetischen Zubereitungen als Konditioniermittel eingesetzt werden.
Eine die erfindungsgemäßen Resilinproteine enthaltende Zubereitung kann bevorzugt in Shampooformulierungen als Festigungs- und/oder Konditioniermittel eingesetzt werden. Bevorzugte Shampooformulierungen enthalten a) 0,01 bis 30 Gew.-% wenigstens eines Resilinproteins , b) 25 bis 94,95 Gew.-% Wasser, c) 5 bis 50 Gew.-% Tenside, c) 0 bis 5 Gew.-% eines weiteren Konditioniermittels, d) 0 bis 10 Gew.-% weitere kosmetische Bestandteile.
In den Shampooformulierungen können alle in Shampoos üblicherweise eingesetzte anionische, neutrale, amphotere oder kationische Tenside verwendet werden.
Geeignete anionische Tenside sind beispielsweise Alkylsulfate, Alkylethersulfate, Alkylsulfonate, Alkylarylsulfonate, Alkylsuccinate, Alkylsulfosuccinate, N-
Alkoylsarkosinate, Acyltaurate, Acylisothionate, Alkylphosphate, Alkyletherphosphate, Alkylethercarboxylate, Alpha-Olefinsulfonate, insbesondere die Alkali- und Erdalkalimetallsalze, z.B. Natrium, Kalium, Magnesium, Calcium, sowie Ammonium- und Trietha- nolamin-Salze. Die Alkylethersulfate, Alkyletherphosphate und Alkylethercarboxylate können zwischen 1 bis 10 Ethylenoxid- oder Propylenoxid-Einheiten, bevorzugt 1 bis 3 Ethylenoxid-Einheiten im Molekül aufweisen.
Geeignet sind zum Beispiel Natriumlaurylsulfat, Ammoniumlaurysulfat, Natriumlaury- lethersulfat, Ammoniumlaurylethersulfat, Natriumlauroylsarkosinat, Natriumoleylsucci- nat, Ammoniumlaurylsulfosuccinat, Natriumdodecylbenzolsulfonat, Triethanolamindo- decylbenzolsulfonat. Geeignete amphotere Tenside sind zum Beispiel Alkylbetaine, Alkylamidopropylbetai- ne, Alkylsulfobetaine, Alkylglycinate, Alkylcarboxyglycinate, Alkylamphoacetate oder - propionate, Alkylamphodiacetate oder -dipropionate.
Beispielsweise können Cocodimethylsulfopropylbetain, Laurylbetain, Cocamidopropyl- betain oder Natriumcocamphopropionat eingesetzt werden.
Als nichtionische Tenside sind beispielsweise geeignet die Umsetzungsprodukte von aliphatischen Alkoholen oder Alkylphenolen mit 6 bis 20 C-Atomen in der Alkylkette, die linear oder verzweigt sein kann, mit Ethylenoxid und/oder Propylenoxid. Die Menge Alkylenoxid beträgt ca. 6 bis 60 Mole auf ein Mol Alkohol. Ferner sind Alkylaminoxide, Mono- oder Dialkylalkanolamide, Fettsäureester von Polyethylenglykolen, Alkylpolygly- koside oder Sorbitanetherester geeignet.
Ausserdem können die Shampooformulierungen übliche kationische Tenside enthalten, wie z.B. quaternäre Ammoniumverbindungen, beispielsweise Cetyltrimethylammo- niumchlorid.
In den Shampooformulierungen können zur Erzielung bestimmter Effekte übliche Kon- ditioniermittel in Kombination mit den Resilinproteinen eingesetzt werden.
Hierzu zählen beispielsweise die zuvor genannten kationischen Polymere mit der Bezeichnung Polyquaternium nach INCI, insbesondere Copolymere aus Vinylpyrrolidon/ N-Vinylimidazoliumsalzen (Luviquat FC, Luviquat&commat, HM, Luviquat MS, Luviquat Care), Copolymere aus N-Vinylpyrrolidon/Dimethylaminoethylmethacrylat, quaternisiert mit Diethylsulfat (Luviquat D PQ 1 1), Copolymere aus N-Vinylcaprolactam/N- Vinylpyrrolidon/N-Vinylimidazoliumsalzen (Luviquat D Hold), kationische Cellulosederi- vate (Polyquaternium-4 und -10), Acrylamidcopolymere (Polyquaternium-7). Ferner können Eiweißhydrolysate verwendet werden, sowie konditionierende Substanzen auf Basis von Silikonverbindungen, beispielsweise Polyalkylsiloxane, Polyarylsiloxane, Polyarylalkylsiloxane, Polyethersiloxane oder Silikonharze. Weitere geeignete Silikonverbindungen sind Dimethicon Copolyole (CTFA) und aminofunktionelle Silikonverbindungen wie Amodimethicone (CTFA). Ferner können kationische Guarderivate wie Guarhydroxypropyltrimoniumchlorid (INCI) verwendet werden.
Ein weiterer Gegenstand der Erfindung ist die Herstellung und Verwendung von basischen Resilinen. Basische Resiline sind dadurch gekennzeichnet, dass das Verhältnis der in den Wiederholungseinheiten, die das Resilinprotein bilden, enthaltenen basischen Aminosäureresten (K, R) zu den sauren Aminosäureresten (D, E) mindestens 1 ,5, bevorzugt mindestens 2 beträgt. Besonders vorteilhafte basische Resiline sind solche, bei denen das Verhältnis von basischen zu sauren Aminosäureresten bei min- destens 40 % der Wiederholungseinheiten 1 : 1 und bei mindestens 40 % der Wiederholungseinheiten 1 : 0 beträgt.
Besonders bevorzugt ist die Herstellung und Verwendung von basischen Resilinprotei- nen, die die Wiederholungseinheit GAPGGGNGGRPSDTY oder
GAPGGGNGGRPSSSY bzw. funktionale Äquivalente dieser Wiederholungseinheit enthalten. Insbesondere bevorzugt ist die Herstellung und Verwendung des synthetischen Resilinproteins Ui6 (SEQ ID NO 1 ) sowie der dafür codierende Nucleotidse- quenz (SEQ ID NO 2).
Basische Resilinproteine sind besonders geeignet für die Verwendung in der Kosmetik, für die Formulierung von Substanzen, für die Papier-, Leder- und Textilveredelung, zum Beschichten von Oberflächen und für die Verwendung in der Human- und Tierernährung.
Experimenteller Teil
Beispiel 1
Herstellung des synthetischen Resilinproteins Ui6
Gensynthese und Expression Ein synthetisches Gen, das für das Resilinprotein Ui6 codiert, wurde durch Multimeri- sierung eines synthetischen Oligonucleotides U: 5'- ggtgcgccgggcggtggcaacggtggccgtccgtctgacacctacggtgcgccgggtggcgg- taacggtggccgtccttcttcctcttac-3' entspreched der in Huemmerich et al.; Biochemistry. 43(42): 13604-12, (2004) beschriebenen Methode zu einem 16mer multimerisiert und in den Expressionsvektor pET21 a (Novagen) kloniert. Die Expression erfolgte in dem Stamm E. coli BLR [DE3] (Novagen). Das exprimierte Protein U16 mit der Sequenz SEQ ID NO:1 enthält N-terminal einen T7 tag (Aminosäuren Nr. 1-15) und anschlies- send ab Aminosäure Nr. 16 das eigentliche Resilinprotein. Die Anzucht und Proteinsynthese erfolgte bei 37°C, pθ2>20% und pH=6,8 im Fed- Batch Verfahren.
Medium 8 Liter Wasser 230 g Hefe-Extrakt 150 g Bacto-Trypton 30 g Glycerin (99 %) 20 g Kaliumdihydrogenphosphat (KH2PO4) 50 g Ammoniumsulfat ((NH4)2SO4) 10,5 g Magnesiumsulfatheptahydrat (MgSO4 * 7 H2O)
1 ,0 g Calciumchloriddihydrat (CaCI2 * 2 H2O) 100 ml Spurensalzlösung mit Wasser auf 9,7 Liter auffüllen pH-Wert mit 25%iger NaOH auf 6,8 einstellen 3 ml Tego KS 91 1 (Antifoam; Goldschmidt Produkte) 1 g Ampicillin
Spurensalzlosung:
5 Liter Wasser
200,00 g Citronensäuremonohydrat
55,00 g ZnSO4 * 7 H2O
42,50 g (NH4)2Fe(SO4)2 * 6 H2O
15,00 g MnSO4 * H2O
4,00 g CuSO4 * 5 H2O
1 ,25 g CoSO4 * 7 H2O
Feeding Lösung 800 g Wasser
30 g Citronensäure Monohydrat 60 g Natriumsulfat (Na2SO4) 4,5 g (NH4)2Fe(SO4)2 * 6 H2O 3400 g Glycerin 99,5 %
Nach aufbrauchen des im Grundmedium enthaltenen Glycerins wurde ein konstanter Feed bei einer Rate von 100 ml/h gestartet.
Die Proteinsynthese wurde durch Zugabe von 1 mM Isopropyl-ß-D- thiogalactopyranosid induziert, nachdem die Bakterienkultur eine optische Dichte OD6oo=40 erreichte. Zu diesem Zeitpunkt wurde die Temperatur der Kultur auf 300C gesenkt. 10 h nach Induktion wurden die Zellen geerntet.
Die Aufreinigung des Proteins wurde nach folgendem Protokoll durchgeführt: - Resuspension des Zellpellets in 5 ml pro Gramm Feuchtmasse 20 mM MOPS
(3-(N-Morpholino)propanesulfonic acid) pH 7,0
Aufschluß der Zellen im Hochdruckhomogenisator
Zentrifugation 30 min, 5000xg
Lösen des Pellets durch Zugabe von 1 ,3 g Guanidiniumhydrochlorid (GdmHCI) pro Gramm Pellet (Endkonzentration 6 M GuaHCI)
Dialyse gegen 20 mM Zitronensäure pH 2,65
Zentrifugation 45 min, 10000xg
Einstellen des pH-Wertes des Überstandes auf 7,0 durch Zugabe von 25 %
NaOH. - Zentrifugation 45 min, 10000xg
Fällung des Proteins aus dem Überstand durch Zugabe von einem Volumen
4 M Ammoniumsulfat
Zentrifugation 45 min, 10000xg
Das so gereinigte Protein kann als Ammoniumsulfat-Präzipitat bei -200C gela- gert werden.
Für die Verwendung des Proteins wird das Ammoniumsulfat- Präzipitat in
GuaHCI aufgenommen, gegen Citronensäure dialysiert und neutralisiert.
Der Proteingehalt in Lösung wurde photometrisch bestimmt (E(28o,img/mi)=O,93)
Die Reinheit des Proteins wurde durch SDS-PAGE und mittels Fluores- zensspektroskopie überprüft (Abb 1 + 2)
Aus einer 10 I Fermentation wurden 700 mg sauberes Ui6-Protein mit einer Reinheit von >95% gewonnen. Im Folgenden sind erfindungesgemäße dermokosmetische Zubereitungen beschrieben, enthaltend die gemäß Beispiel 1 hergestellten Resilinproteine
Beispiel 3: Verwendung Resilinprotein in einer Emulsion zur Tagespflege - Typ O/W
WS 1 %:
% Inhaltsstoff (INCI)
A 1 ,7 Ceteareth-6, Stearyl Alcohol
0,7 Ceteareth-25
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
2,0 PEG-14 Dimethicone
3,6 Cetearyl Alcohol
6,0 Ethylhexyl Methoxycinnamate
2,0 Dibutyl Adipate
B 5,0 Glycerin
0,2 Disodium EDTA
1 ,0 Panthenol
1 ,0 Resilinprotein q.s. Konservierungsmittel
67,8 Aqua dem.
C 4,0 Caprylic/Capric Triglyceride, Sodium Acrylates Copolymer
D 0,2 Sodium Ascorbyl Phosphate
1 ,0 Tocopheryl Acetate
0,2 Bisabolol
1 ,0 Caprylic/Capric Triglyceride, Sodium Ascorbate, Tocopherol, Retinol
Eq. s. Sodium Hydroxide
WS 5%:
% Inhaltsstoff (INCI)
1 ,7 Ceteareth-6, Stearyl Alcohol
0,7 Ceteareth-25
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
2,0 PEG-14 Dimethicone
3,6 Cetearyl Alcohol
6,0 Ethylhexyl Methoxycinnamate
2,0 Dibutyl Adipate B 5,0 Glycerin
0,2 Disodium EDTA
1 ,0 Panthenol
5,0 Resilinprotein q.s. Konservierungsmittel
63,8 Aqua dem.
4,0 Caprylic/Capric Triglyceride, Sodium Acrylates Copolymer D 0,2 Sodium Ascorbyl Phosphate
1 ,0 Tocopheryl Acetate
0,2 Bisabolol
1 ,0 Caprylic/Capric Triglyceride, Sodium Ascorbate, Tocopherol, Retinol
E q.s. Sodium Hydroxide
Herstellung: Die Phasen A und B getrennt voneinander auf ca. 800C erwärmen. Phase B in Phase A einrühren und homogenisieren. Phase C in die kombinierten Phasen A und B einrühren und nochmals homogenisieren. Unter Rühren auf ca. 400C abkühlen, Phase D zugeben, den pH-Wert mit Phase E auf etwa 6.5 einstellen, homogenisieren und unter Rühren auf Raumtemperatur abkühlen.
Hinweis: Die Formulierung wird ohne Schutzgas hergestellt. Die Abfüllung muß in sauerstoffundurchlässige Verpackungen, z.B. Aluminiumtuben erfolgen.
Beispiel 4: Verwendung Resilinprotein in einer schützenden Tagescreme - Typ O/W
WS 1 %:
% Inhaltsstoff (INCI)
A 1 ,7 Ceteareth-6, Stearyl Alcohol
0,7 Ceteareth-25
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
2,0 PEG-14 Dimethicone
3,6 Cetearyl Alcohol
6,0 Ethylhexyl Methoxycinnamate
2,0 Dibutyl Adipate
B 5,0 Glycerin
0,2 Disodium EDTA
1 ,0 Panthenol
1 ,0 Resilinprotein q.s. Konservierungsmittel
68,6 Aqua dem.
C 4,0 Caprylic/Capric Triglyceride, Sodium Acrylates Copolymer
D 1 ,0 Sodium Ascorbyl Phosphate
1 ,0 Tocopheryl Acetate
0,2 Bisabolol
E q.s. Sodium Hydroxide
WS 5%:
% Inhaltsstoff (INCI)
A 1 ,7 Ceteareth-6, Stearyl Alcohol
0,7 Ceteareth-25
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
2,0 PEG-14 Dimethicone
3,6 Cetearyl Alcohol
6,0 Ethylhexyl Methoxycinnamate
2,0 Dibutyl Adipate B 5,0 Glycerin
0,2 Disodium EDTA
1 ,0 Panthenol
5,0 Resilinprotein q.s. Konservierungsmittel
64,6 Aqua dem.
C 4,0 Caprylic/Capric Triglyceride, Sodium Acrylates Copolymer
D 1 ,0 Sodium Ascorbyl Phosphate
1 ,0 Tocopheryl Acetate
0,2 Bisabolol
E q.s. Sodium Hydroxide
Herstellung: Die Phasen A und B getrennt voneinander auf ca. 800C erwärmen. Phase B in Phase A einrühren und homogenisieren. Phase C in die kombinierten Phasen A und B einarbei- ten und homogenisieren. Unter Rühren auf ca. 400C abkühlen. Phase D hinzugeben, den pH- Wert mit Phase E auf ca. 6.5 einstellen und homogenisieren. Unter Rühren auf Raumtemperatur abkühlen.
Beispiel 5: Verwendung Resilinprotein in einer Gesichtsreinigungslotion - Typ O/W WS 1 %:
% Inhaltsstoff (INCI)
A 10,0 Cetearyl Ethylhexanoate
10,0 Caprylic/Capric Triglyceride
1 ,5 Cyclopentasiloxane, Cyclohexasilosane 2,0 PEG-40 Hydrogenated Castor OiI
B 3,5 Caprylic/Capric Triglyceride, Sodium Acrylates Copolymer
C 1 ,0 Tocopheryl Acetate
0,2 Bisabolol q.s. Konservierungsmittel q.s. Parfümöl
D 3,0 Polyquaternium-44
0,5 Cocotrimonium Methosulfate
0,5 Ceteareth-25
2,0 Panthenol, Propylene Glycol 4,0 Propylene Glycol
0,1 Disodium EDTA
1 ,0 Resilinprotein
60,7 Aqua dem.
WS 5%:
% Inhaltsstoff (INCI)
A 10,0 Cetearyl Ethylhexanoate
10,0 Caprylic/Capric Triglyceride
1 ,5 Cyclopentasiloxane, Cyclohexasilosane 2,0 PEG-40 Hydrogenated Castor OiI
B 3,5 Caprylic/Capric Triglyceride, Sodium Acrylates Copolymer
C 1 ,0 Tocopheryl Acetate 0,2 Bisabolol q.s. Konservierungsmittel q.s. Parfümöl
D 3,0 Polyquaternium-44
0,5 Cocotrimonium Methosulfate
0,5 Ceteareth-25
2,0 Panthenol, Propylene Glycol
4,0 Propylene Glycol
0,1 Disodium EDTA
5,0 Resilinprotein
56,7 Aqua dem.
Herstellung: Phase A lösen. Phase B in Phase A einrühren, Phase C in die kombinierten Phasen A und B einarbeiten. Phase D lösen, in die kombinierten Phasen A, B und C einrühren und homogenisieren. 15min nachrühren.
Beispiel 6: Verwendung Resilinprotein in einem Daily Care Body Spray
WS 1 %:
% Inhaltsstoff (INCI)
A 3,0 Ethylhexyl Methoxycinnamate
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
1 ,0 Polyquaternium-44
3,0 Propylene Glycol
2,0 Panthenol, Propylene Glycol
1 ,0 Cyclopentasiloxane, Cyclohexasiloxane
10,0 Octyldodecanol
0,5 PVP
10,0 Caprylic/Capric Triglyceride
3,0 C12-15 Alkyl Benzoate
3,0 Glycerin
1 ,0 Tocopheryl Acetate
0,3 Bisabolol
1 ,0 Resilinprotein
59,2 Alcohol
WS 5%:
% Inhaltsstoff (INCI)
A 3,0 Ethylhexyl Methoxycinnamate
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
1 ,0 Polyquaternium-44
3,0 Propylene Glycol
2,0 Panthenol, Propylene Glycol
1 ,0 Cyclopentasiloxane, Cyclohexasiloxane
10,0 Octyldodecanol
0,5 PVP
10,0 Caprylic/Capric Triglyceride
3,0 C12-15 Alkyl Benzoate
3,0 Glycerin
1 ,0 Tocopheryl Acetate
0,3 Bisabolol
5,0 Resilinprotein
55,2 Alcohol
Herstellung: Die Komponenten der Phase A einwiegen und klar lösen.
Beispiel 7: Verwendung Resilinprotein in einem Hautpflegegel WS 1 %:
% Inhaltsstoff (INCI)
A 3,6 PEG-40 Hydrogenated Castor OiI 15,0 Alcohol
0,1 Bisabolol 0,5 Tocopheryl Acetate q.s. Parfümöl
B 3,0 Panthenol
0,6 Carbomer
1 ,0 Resilinprotein
75,4 Aqua dem,
C 0,8 Triethanolamine
WS i 5%:
% Inhaltsstoff (INCI)
A 3,6 PEG-40 Hydrogenated Castor OiI
15,0 Alcohol
0,1 Bisabolol
0,5 Tocopheryl Acetate q.s. Parfümöl
B 3,0 Panthenol
0,6 Carbomer
5,0 Resilinprotein
71 ,4 Aqua dem,
C 0,8 Triethanolamine
Herstellung: Die Phase A klar lösen. Phase B quellen lassen und mit Phase C neutralisieren. Phase A in die homogenisierte Phase B einrühren und homogenisieren.
Beispiel 8: Verwendung Resilinprotein in einer After Shave Lotion
WS 1 %:
% Inhaltsstoff (INCI)
A 10 ,0 Cetearyl Ethylhexanoate
5 ,0 Tocopheryl Acetate
1 ,0 Bisabolol
0 ,1 Parfümöl
0 ,3 Acrylates/C 10-30 Alkyl Acrylate Crosspolymer
B 15 ,0 Alcohol
1 ,0 Panthenol
3 ,0 Glycerin
1 ,0 Resilinprotein
0 ,1 Triethanolamine
63 ,5 Aqua dem.
WS 5%:
% Inhaltsstoff (INCI)
A 10 ,0 Cetearyl Ethylhexanoate
5 ,0 Tocopheryl Acetate
1 ,0 Bisabolol
0 ,1 Parfümöl
0 ,3 Acrylates/C 10-30 Alkyl Acrylate Crosspolymer
B 15 .0 Alcohol 1 ,0 Panthenol
3,0 Glycerin
5,0 Resilinprotein
0,1 Triethanolamine
59,5 Aqua dem.
Herstellung: Die Komponenten der Phase A mischen. Phase B lösen, in Phase A einarbeiten und homogenisieren.
Beispiel 9: Verwendung Resilinprotein in einer After Sun Lotion WS 1 %:
% Inhaltsstoff (INCI)
A 0,4 Acrylates/C 10-30 Alkyl Acrylate Crosspolymer
15,0 Cetearyl Ethylhexanoate
0,2 Bisabolol
1 ,0 Tocopheryl Acetate q.s. Parfümöl
B 1 ,0 Panthenol
15,0 Alcohol
3,0 Glycerin
1 ,0 Resilinprotein
63,2 Aqua dem,
C 0,2 Triethanolamine
WS 5%:
% Inhaltsstoff (INCI)
A 0,4 Acrylates/C 10-30 Alkyl Acrylate Crosspolymer
15,0 Cetearyl Ethylhexanoate
0,2 Bisabolol
1 ,0 Tocopheryl Acetate q.s. Parfümöl
B 1 ,0 Panthenol
15,0 Alcohol
3,0 Glycerin
5,0 Resilinprotein
59,2 Aqua dem,
C 0.2 Triethanolamine
Herstellung: Die Komponenten der Phase A mischen. Phase B unter Homogenisieren in Phase A einrühren. Mit Phase C neutralisieren und erneut homogenisieren.
Beispiel 10: Verwendung Resilinprotein- in einer Sonnenschutzlotion WS 1 %:
% Inhaltsstoff (INCI) A 4,5 Ethylhexyl Methoxycinnamate
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate 3,0 Octocrylene 2,5 Di-C12-13 Alkyl Malate
0,5 Tocopheryl Acetate
4,0 Polyglyceryl-3 Methyl Glucose Distearate
B 3,5 Cetearyl Isononanoate
1 ,0 VP/Eicosene Copolymer
5,0 Isohexadecane
2,5 Di-C12-13 Alkyl Malate
3,0 Titanium Dioxide, Trimethoxycaprylylsilane
C 5,0 Glycerin
1 ,0 Sodium Cetearyl Sulfate
0,5 Xanthan Gum
1 ,0 Resilinprotein
59,7 Aqua dem.
D 1 ,0 Phenoxyethanol, Methylparaben, Ethylparaben, Butylparaben, Propyl- paraben, Isobutylparaben
0,3 Bisabolol
WS 5%:
% Inhaltsstoff (INCI)
A 4,5 Ethylhexyl Methoxycinnamate
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
3,0 Octocrylene
2,5 Di-C12-13 Alkyl Malate
0,5 Tocopheryl Acetate
4,0 Polyglyceryl-3 Methyl Glucose Distearate
B 3,5 Cetearyl Isononanoate
1 ,0 VP/Eicosene Copolymer
5,0 Isohexadecane
2,5 Di-C12-13 Alkyl Malate
3,0 Titanium Dioxide, Trimethoxycaprylylsilane
C 5,0 Glycerin
1 ,0 Sodium Cetearyl Sulfate
0,5 Xanthan Gum
5,0 Resilinprotein
55,7 Aqua dem.
D 1 ,0 Phenoxyethanol, Methylparaben, Ethylparaben, Butylparaben, Propyl- paraben, Isobutylparaben
0.3 Bisabolol
Herstellung: Die Komponenten der Phasen A und B getrennt voneinander auf ca. 800C erwärmen. Phase B in Phase A einrühren und homogenisieren. Phase C auf ca. 800C erwärmen und unter Homogenisieren in die kombinierten Phasen A und B einrühren. Unter Rühren auf ca. 40°C abkühlen, Phase D zugeben und nochmals homogenisieren.
Beispiel 1 1 : Verwendung Resilinprotein in einer Sonnenschutzlotion - Typ O/W WS 1 %: % Inhaltsstoff (INCI)
A 2,0 Ceteareth-6, Stearyl Alcohol
2,0 Ceteareth-25
3,0 Tribehenin
2,0 Cetearyl Alcohol
2,0 Cetearyl Ethylhexanoate
5,0 Ethylhexyl Methoxycinnamate
1 ,0 Ethylhexyl Triazone
1 ,0 VP/Eicosene Copolymer
7,0 Isopropyl Myristate
B 5,0 Zinc Oxide, Triethoxycaprylylsilane
C 0,2 Xanthan Gum
0,5 Hydroxyethyl Acrylate/Sodium Acryloyldimethyl Taurate Copolymer,
Squalane, Polysorbate 60
0,2 Disodium EDTA
5,0 Propylene Glycol
0,5 Panthenol
1 ,0 Resilinprotein
60,9 Aqua dem.
D 0,5 Phenoxyethanol, Methylparaben, Butylparaben, Ethylparaben, Propylpa- raben, Isopropylparaben
1 ,0 Tocopheryl Acetate
0,2 Bisabolol
WS 5%:
% Inhaltsstoff (INCI)
A 2,0 Ceteareth-6, Stearyl Alcohol
2,0 Ceteareth-25
3,0 Tribehenin
2,0 Cetearyl Alcohol
2,0 Cetearyl Ethylhexanoate
5,0 Ethylhexyl Methoxycinnamate
1 ,0 Ethylhexyl Triazone
1 ,0 VP/Eicosene Copolymer
7,0 Isopropyl Myristate
B 5,0 Zinc Oxide, Triethoxycaprylylsilane
C 0,2 Xanthan Gum
0,5 Hydroxyethyl Acrylate/Sodium Acryloyldimethyl Taurate Copolymer,
Squalane, Polysorbate 60
0,2 Disodium EDTA
5,0 Propylene Glycol
0,5 Panthenol
5,0 Resilinprotein
56,9 Aqua dem.
D 0,5 Phenoxyethanol, Methylparaben, Butylparaben, Ethylparaben, Propylpa- raben, Isopropylparaben 1 ,0 Tocopheryl Acetate 0,2 Bisabolol
Herstellung: Phase A auf ca. 800C erwärmen, Phase B einrühren und 3min homogenisieren. Phase C ebenfalls auf 800C erwärmen und unter Homogenisieren in die kombinierten Phasen A und B einrühren. Abkühlen auf ca. 400C, Phase D einrühren und nochmals homogenisieren.
Beispiel 12: Verwendung Resilinprotein in einer Sonnenschutlotion - Typ O/W
WS 1 %:
% Inhaltsstoff (INCI)
A 3,5 Ceteareth-6, Stearyl Alcohol
1 ,5 Ceteareth-25
7,5 Ethylhexyl Methoxycinnamate
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
2,0 Cyclopentasiloxane, Cyclohexasiloxane
0,5 Bees Wax
3,0 Cetearyl Alcohol
10,0 Caprylic/Capric Triglyceride
B 5,0 Titanium Dioxide, Silica, Methicone, Alumina
C 3,0 Glycerin
0,2 Disodium EDTA
0,3 Xanthan Gum
1 ,0 Decyl Glucoside
2,0 Panthenol, Propylene Glycol
1 ,0 Resilinprotein
56,3 Aqua dem.
D 1 ,0 Tocopheryl Acetate
0,2 Bisabolol q.s. Parfümöl q.s. Konservierungsmittel
WS 5%:
% Inhaltsstoff (INCI)
A 3,5 Ceteareth-6, Stearyl Alcohol
1 ,5 Ceteareth-25
7,5 Ethylhexyl Methoxycinnamate
2,0 Diethylamino Hydroxybenzoyl Hexyl Benzoate
2,0 Cyclopentasiloxane, Cyclohexasiloxane
0,5 Bees Wax
3,0 Cetearyl Alcohol
10,0 Caprylic/Capric Triglyceride
B 5,0 Titanium Dioxide, Silica, Methicone, Alumina
C 3,0 Glycerin
0,2 Disodium EDTA
0,3 Xanthan Gum 1 ,0 Decyl Glucoside
2,0 Panthenol, Propylene Glycol
5,0 Resilinprotein
52,3 Aqua dem.
D 1 ,0 Tocopheryl Acetate
0,2 Bisabolol q.s. Parfümöl q.s. Konservierungsmittel
Herstellung: Phase A auf ca. 800C erwärmen, Phase B einrühren und 3min homogenisieren.
Phase C ebenfalls auf 800C erwärmen und unter Homogenisieren in die kombinierten Phasen A und B einrühren. Abkühlen auf ca. 400C, Phase D einrühren und nochmals homogenisieren.
Beispiel 13: Verwendung Resilinprotein in einem Fußbalsam
WS 1 %:
% Inhaltsstoff (INCI)
A 2,0 Ceteareth-6, Stearyl Alcohol
2,0 Ceteareth-25
5,0 Cetearyl Ethylhexanoate
4,0 Cetyl Alcohol
4,0 Glyceryl Stearate
5,0 Mineral OiI
0,2 Menthol
0,5 Camphor
B 69,3 Aqua dem.
1 ,0 Resilinprotein q.s. Konservierungsmittel
C 1 ,0 Bisabolol
1 ,0 Tocopheryl Acetate
D 5,0 Witch Hazel Extract
WS 5%:
% Inhaltsstoff (INCI)
A 2,0 Ceteareth-6, Stearyl Alcohol
2,0 Ceteareth-25
5,0 Cetearyl Ethylhexanoate
4,0 Cetyl Alcohol
4,0 Glyceryl Stearate
5,0 Mineral OiI
0,2 Menthol
0,5 Camphor
B 65,3 Aqua dem.
5,0 Resilinprotein q.s. Konservierungsmittel
C 1.0 Bisabolol 1 ,0 Tocopheryl Acetate D 5,0 Witch Hazel Extract
Herstellung: Die Komponenten der Phasen A und B getrennt voneinander auf ca. 800C erwär- men. Phase B in Phase A unter Homogenisieren einrühren. Unter Rühren abkühlen auf ca.
400C, die Phasen C und D hinzugeben und kurz nachhomogenisieren. Unter Rühren auf Raumtemperatur abkühlen.
Beispiel 14: Verwendung Resilinprotein in einer W/O Emulsion mit Bisabolol
WS 1 %:
% Inhaltsstoff (INCI)
A 6 ,0 PEG-7 Hydrogenated Castor OiI
8 ,0 Cetearyl Ethylhexanoate
5 ,0 Isopropyl Myristate
15 ,0 Mineral OiI
0 ,3 Magnesium Stearate
0 ,3 Aluminum Stearate
2 ,0 PEG-45/Dodecyl Glycol Copolymer
B 5 ,0 Glycerin
0 ,7 Magnesium Sulfate
1 ,0 Resilinprotein
55 ,6 Aqua dem.
C 0 ,5 Tocopheryl Acetate
0 ,6 Bisabolol
WS 5%:
% Inhaltsstoff (INCI)
A 6 ,0 PEG-7 Hydrogenated Castor OiI
8 ,0 Cetearyl Ethylhexanoate
5 ,0 Isopropyl Myristate
15 ,0 Mineral OiI
0 ,3 Magnesium Stearate
0 ,3 Aluminum Stearate
2 ,0 PEG-45/Dodecyl Glycol Copolymer
B 5 ,0 Glycerin
0 ,7 Magnesium Sulfate
51 ,6 Aqua dem.
5 ,0 Resilinprotein
C 0 ,5 Tocopheryl Acetate
Herstellung: Die Phasen A und B getrennt voneinander auf ca. 85°C erwärmen. Phase B in Phase A einrühren und homogenisieren. Unter Rühren auf ca. 400C abkühlen, Phase C hinzugeben und nochmals kurz homogenisieren. Unter Rühren auf Raumtemperatur abkühlen.
Beispiel 15: Schaumconditioner mit Festiger WS 1 %
% Inhaltsstoff (INCI)
10,0 PVP/VA Copolymer
0,2 Hydroxyethyl Cetyldimonium Phosphate
0,2 Ceteareth-25
0,5 Dimethicone Copolyol q.s. Parfümöl
10,0 Alcohol
1 ,0 Resilinprotein
68,1 Aqua dem.
10,0 Propane/Butane
WS 5% % % Inhaltsstoff (INCI)
10,0 PVP/VA Copolymer
0,2 Hydroxyethyl Cetyldimonium Phosphate
0,2 Ceteareth-25
0,5 Dimethicone Copolyol q.s. Parfümöl
10,0 Alcohol
5,0 Resilinprotein
64,1 Aqua dem.
10,0 Propane/Butane
Herstellung: Die Komponenten der Phase A zusammenwiegen, rühren bis alles gelöst ist und abfüllen.
Beispiel 16: Schaumconditioner
WS 1 %
% Inhaltsstoff (INCI)
A 1 ,0 Polyquaternium-4
0,5 Hydroxyethyl Cetyldimonium Phosphate
1 ,0 Resilinprotein q.s. Parfümöl q.s. Konservierungsmittel
91 ,5 Aqua dem.
6,0 Propane/Butane
WS 5% % Inhaltsstoff (INCI) A 1 ,0 Polyquaternium-4
0,5 Hydroxyethyl Cetyldimonium Phosphate
5,0 Resilinprotein q.s. Parfümöl q.s. Konservierungsmittel
87,5 Aqua dem.
6,0 Propane/Butane
Herstellung: Die Komponenten der Phase A zusammenwiegen, rühren bis alles klar gelöst ist und abfüllen.
Beispiel 17: Schaumconditioner
WS 1 % % Inhaltsstoff (INCI)
A 1 ,0 Polyquaternium-11
0,5 Hydroxyethyl Cetyldimonium Phosphate
1 ,0 Resilinprotein q.s. Parfümöl q.s. Konservierungsmittel
91 ,5 Aqua dem.
6,0 Propane/Butane
WS 5%
% Inhaltsstoff (INCI)
A 1 ,0 Polyquaternium-11
0,5 Hydroxyethyl Cetyldimonium Phosphate 5,0 Resilinprotein q.s. Parfümöl q.s. Konservierungsmittel
87,5 Aqua dem.
6,0 Propane/Butane
Herstellung: Die Komponenten der Phase A zusammenwiegen, rühren bis alles klar gelöst ist und abfüllen.
Beispiel 18: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A 0,5 Laureth-4 q.s. Parfümöl B 77,3 Aqua dem.
10,0 Polyquaternium-28
1 ,0 Resilinprotein
0,5 Dimethicone Copolyol
0,2 Ceteareth-25
0,2 Panthenol
0,1 PEG-25 PABA
0,2 Hydroxyethylcellulose
C 10,0 HFC 152 A
WS 5%
% Inhaltsstoff (INCI)
A 0,5 Laureth-4 q.s. Parfümöl
B 73,3 Aqua dem.
10,0 Polyquaternium-28
5,0 Resilinprotein
0,5 Dimethicone Copolyol
0,2 Ceteareth-25
0,2 Panthenol
0,1 PEG-25 PABA
0,2 Hydroxyethylcellulose
10,0 HFC 152 A
Herstellung: Die Komponenten der Phase A mischen. Die Komponenten der Phase B eine nach der anderen zugeben und lösen. Mit Phase C abfüllen.
Beispiel 19: Styling Schaum
WS 1 % % Inhaltsstoff (INCI)
A 2,0 Cocotrimonium Methosulfate q.s. Parfümöl
B 78,5 Aqua dem.
6,7 Acrylates Copolymer
0,6 AMP
1 ,0 Resilinprotein
0,5 Dimethicone Copolyol 0,2 Ceteareth-25
0,2 Panthenol
0,1 PEG-25 PABA 0,2 Hydroxyethylcellulose
C 10,0 HFC 152 A
WS 5%
% Inhaltsstoff (INCI)
A 2,0 Cocotrimonium Methosulfate q.s. Parfümöl
B 74,5 Aqua dem.
6,7 Acrylates Copolymer
0,6 AMP
5,0 Resilinprotein 0,5 Dimethicone Copolyol
0,2 Ceteareth-25
0,2 Panthenol
0,1 PEG-25 PABA
0,2 Hydroxyethylcellulose
C 10,0 HFC 152 A
Herstellung: Die Komponenten der Phase A mischen. Die Komponenten der Phase B eine nach der anderen zugeben und lösen. Mit Phase C abfüllen.
Beispiel 20: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A 2,0 Cocotrimonium Methosulfate q.s. Parfümöl
B 7,70 Polyquaternium-44 1 ,0 Resilinprotein q.s. Konservierungsmittel
79,3 Aqua dem.
C 10,0 Propane/Butane
WS 5%
% Inhaltsstoff (INCI)
A 2,0 Cocotrimonium Methosulfate q.s. Parfümöl B 7,70 Polyquaternium-44
5,0 Resilinprotein q.s. Konservierungsmittel
75,3 Aqua dem.
C 10,0 Propane/Butane
Herstellung: Die Komponenten der Phase A mischen. Die Komponenten der Phase B klar lösen, dann Phase B in Phase A einrühren. Den pH-Wert auf 6-7 einstellen, mit Phase C abfüllen.
Beispiel 21 : Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A 2,00 Cocotrimonium Methosulfate q.s. Parfümöl
B 72,32 Aqua dem. 2,00 VP/Acrylates/Lauryl Methacrylate Copolymer
0,53 AMP
1 ,00 Resilinprotein
0,20 Ceteareth-25
0,50 Panthenol 0,05 Benzophenone-4
0,20 Amodimethicone, Cetrimonium Chloride, Trideceth-12
15,00 Alcohol
C 0,20 Hydroxyethylcellulose
D 6,00 Propane/Butane
WS 5%
% Inhaltsstoff (INCI)
A 2,00 Cocotrimonium Methosulfate q.s. Parfümöl
B 68,32 Aqua dem. 2,00 VP/Acrylates/Lauryl Methacrylate Copolymer
0,53 AMP
5,00 Resilinprotein
0,20 Ceteareth-25
0,50 Panthenol 0,05 Benzophenone-4
0,20 Amodimethicone, Cetrimonium Chloride, Trideceth-12 15,00 Alcohol
C 0,20 Hydroxyethylcellulose
D 6,00 Propane/Butane
Herstellung: Die Komponenten der Phase A mischen. Die Komponenten der Phase B eine nach der anderen zugeben und lösen. Phase C in der Mischung aus A und B lösen, dann den pH- Wert auf 6-7 einstellen. Mit Phase D abfüllen
Beispiel 22: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A 2,00 Cetrimonium Chloride q.s. Parfümöl
B 67,85 Aqua dem. 7,00 Polyquaternium-46
1 ,00 Resilinprotein
0,20 Ceteareth-25
0,50 Panthenol
0,05 Benzophenone-4 0,20 Amodimethicone, Cetrimonium Chloride, Trideceth-12
15,00 Alcohol
C 0,20 Hydroxyethylcellulose
D 6,00 Propane/Butane
WS 5%
% Inhaltsstoff (INCI)
A 2,00 Cetrimonium Chloride q.s. Parfümöl
B 63,85 Aqua dem.
7,00 Polyquaternium-46 5,00 Resilinprotein
0,20 Ceteareth-25
0,50 Panthenol
0,05 Benzophenone-4
0,20 Amodimethicone, Cetrimonium Chloride, Trideceth-12 15,00 Alcohol C 0,20 Hydroxyethylcellulose
D 6,00 Propane/Butane
Herstellung: Die Komponenten der Phase A mischen. Die Komponenten der Phase B eine nach der anderen zugeben und lösen. Phase C in der Mischung aus A und B lösen, dann den pH- Wert auf 6-7 einstellen. Mit Phase D abfüllen.
Beispiel 23: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A q. S. PEG-40 Hydrogenated Castor OiI q- S. Parfümöl
85 ,5 Aqua dem.
B 7,0 Sodium Polystyrene Sulfonate
1 ,0 Resilinprotein 0,5 Cetrimonium Bromide q.s. Konservierungsmittel
C 6,0 Propane/Butane
Styling Schaum
WS 5%
% Inhaltsstoff (INCI)
A q.s. PEG-40 Hydrogenated Castor OiI q.s. Parfümöl 81 ,5 Aqua dem.
B 7,0 Sodium Polystyrene Sulfonate 5,0 Resilinprotein
0,5 Cetrimonium Bromide q.s. Konservierungsmittel
C 6,0 Propane/Butane
Herstellung: Phase A solubilisieren. Phase B in Phase A einwiegen und klar lösen. Den pH- Wert auf 6-7 einstellen, mit Phase C abfüllen. Beispiel 24: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI) A q.s. PEG-40 Hydrogenated Castor OiI q.s. Parfümöl
92,0 Aqua dem.
B 0,5 Polyquaternium-10
1 ,0 Resilinprotein
0,5 Cetrimonium Bromide q.s. Konservierungsmittel
C 6,0 Propane/Butane
WS 5%
% Inhaltsstoff (INCI)
A q.s. PEG-40 Hydrogenated Castor OiI q.s. Parfümöl
88,0 Aqua dem.
B 0,5 Polyquaternium-10 5,0 Resilinprotein
0,5 Cetrimonium Bromide q.s. Konservierungsmittel
C 6,0 Propane/Butane
Herstellung: Phase A solubilisieren. Phase B in Phase A einwiegen und klar lösen. Den pH- Wert auf 6-7 einstellen, mit Phase C abfüllen.
Beispiel 25: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A q. S. PEG-40 Hydrogenated Castor OiI q- S. Parfümöl
82 ,5 Aqua dem.
B 10,0 Polyquaternium-16
1 ,0 Resilinprotein 0,5 Hydroxyethyl Cetyldimonium Phosphate q.s. Konservierungsmittel
C 6,0 Propane/Butane WS 5%
% Inhaltsstoff (INCI)
A q.s. PEG-40 Hydrogenated Castor OiI q.s. Parfümöl
78,5 Aqua dem.
B 10,0 Polyquaternium-16
5,0 Resilinprotein 0,5 Hydroxyethyl Cetyldimonium Phosphate q.s. Konservierungsmittel
C 6,0 Propane/Butane
Herstellung: Phase A solubilisieren. Phase B in Phase A einwiegen und klar lösen. Den pH- Wert auf 6-7 einstellen, mit Phase C abfüllen.
Beispiel 26: Styling Schaum
WS 1 %
% Inhaltsstoff (INCI)
A 2,0 Cocotrimonium Methosulfate q.s. Parfümöl
B 84,0 Aqua dem.
2,0 Chitosan
1 ,0 Resilinprotein
0,5 Dimethicone Copolyol 0,2 Ceteareth-25
0,2 Panthenol
0,1 PEG-25 PABA
C 10,0 HFC 152 A
WS 5%
% Inhaltsstoff (INCI)
A 2,0 Cocotrimonium Methosulfate q.s. Parfümöl
B 80,0 Aqua dem. 2,0 Chitosan
5,0 Resilinprotein
0,5 Dimethicone Copolyol
0,2 Ceteareth-25
0,2 Panthenol
0,1 PEG-25 PABA
C 10,0 HFC 152 A
Herstellung: Die Komponenten der Phase A mischen. Die Komponenten der Phase B eine nach der anderen zugeben und lösen. Mit Phase C abfüllen.
Beispiel 27: Pflegeshampoo
WS 1 %
% Inhaltsstoff (INCI)
A 30,0 Sodium Laureth Sulfate
6,0 Sodium Cocoamphoacetate 6,0 Cocamidopropyl Betaine
3,0 Sodium Laureth Sulfate, Glycol Distearate, Cocamide MEA, Laureth-10
1 ,0 Resilinprotein
7,7 Polyquaternium-44
2,0 Amodimethicone q.s. Parfümöl q.s. Konservierungsmittel
1 ,0 Sodium Chloride
43,3 Aqua dem.
B q.s. Citric Acid
WS 5%
% Inhaltsstoff (INCI)
A 30,0 Sodium Laureth Sulfate
6,0 Sodium Cocoamphoacetate
6,0 Cocamidopropyl Betaine
3,0 Sodium Laureth Sulfate, Glycol Distearate, Cocamide MEA, Laureth-10
5,0 Resilinprotein 7,7 Polyquaternium-44
2,0 Amodimethicone q.s. Parfümöl q.s. Konservierungsmittel
1 ,0 Sodium Chloride 39,3 Aqua dem. B q.s. Citric Acid
Herstellung: Die Komponenten der Phase A mischen und lösen. Den pH-Wert mit Citronensäu- re auf 6-7 einstellen.
Beispiel 28: Duschgel
WS 1 %
% Inhaltsstoff (INCI)
A 40,0 Sodium Laureth Sulfate
5,0 Decyl Glucoside
5,0 Cocamidopropyl Betaine
1 ,0 Resilinprotein 1 ,0 Panthenol q.s. Parfümöl q.s. Konservierungsmittel
2,0 Sodium Chloride
46,0 Aqua dem.
B q.s. Citric Acid
WS 5%
% Inhaltsstoff (INCI)
A 40,0 Sodium Laureth Sulfate
5,0 Decyl Glucoside
5,0 Cocamidopropyl Betaine
5,0 Resilinprotein 1 ,0 Panthenol q.s. Parfümöl q.s. Konservierungsmittel
2,0 Sodium Chloride
42,0 Aqua dem.
B q.s. Citric Acid
Herstellung: Die Komponenten der Phase A mischen und lösen. Den pH-Wert mit Citronensäu- re auf 6-7 einstellen.
Beispiel 29: Shampoo
WS 1 %
% Inhaltsstoff (INCI)
A 40,0 Sodium Laureth Sulfate
5,0 Sodium C12-15 Pareth-15 Sulfonate 5,0 Decyl Glucoside q.s. Parfümöl
0,1 Phytantriol
44,6 Aqua dem.
1 ,0 Resilinprotein
0,3 Polyquaternium-10
1 ,0 Panthenol q.s. Konservierungsmittel
1 ,0 Laureth-3
2,0 Sodium Chloride
WS 5%
% Inhaltsstoff (INCI)
A 40,0 Sodium Laureth Sulfate
5,0 Sodium C12-15 Pareth-15 Sulfonate
5,0 Decyl Glucoside q.s. Parfümöl
0,1 Phytantriol
40,6 Aqua dem.
5,0 Resilinprotein
0,3 Polyquaternium-10
1 ,0 Panthenol q.s. Konservierungsmittel
1 ,0 Laureth-3
2,0 Sodium Chloride
Herstellung: Die Komponenten der Phase A mischen und lösen. Den pH-Wert mit Citronensäu- re auf 6-7 einstellen.
Beispiel 30: Shampoo
WS 1 %
% Inhaltsstoff (INCI)
A 15, 00 Cocamidopropyl Betaine
10, 00 Disodium Cocoamphodiacetate
5, 00 Polysorbate 20
5, 00 Decyl Glucoside q .S. Parfümöl q .S. Konservierungsmittel
1 , 00 Resilinprotein
0, 15 Guar Hydroxypropyltrimonium Chloride
2, 00 Laureth-3
58, 00 Aqua dem. q .S. Citric Acid B 3,00 PEG-150 Distearate
WS 5%
% Inhaltsstoff (INCI)
15, 00 Cocamidopropyl Betaine
10, 00 Disodium Cocoamphodiacetate
5, 00 Polysorbate 20
5, 00 Decyl Glucoside q .S. Parfümöl q .S. Konservierungsmittel
5, 00 Resilinprotein
0, 15 Guar Hydroxypropyltrimonium Chloride
2, 00 Laureth-3
54, 00 Aqua dem. q .S. Citric Acid
B 3,00 PEG-150 Distearate
Herstellung: Die Komponenten der Phase A einwiegen und lösen. Den pH-Wert auf 6-7 einstellen. Phase B zugeben und auf ca. 500C erwärmen. Unter Rühren auf Raumtemperatur abkühlen.
Beispiel 31 : Feuchtigkeitsspendende Körperpflegecreme
WS 1 %
% Inhaltsstoff (INCI)
A 2,0 Ceteareth-25
2,0 Ceteareth-6, Stearyl Alcohol
3,0 Cetearyl Ethylhexanoate
1 ,0 Dimethicone
4,0 Cetearyl Alcohol
3,0 Glyceryl Stearate SE
5,0 Mineral OiI
4,0 Simmondsia Chinensis (Jojoba) Seed OiI
3,0 Mineral OiI, Lanolin Alcohol
B 5,0 Propylene Glycol
1 ,0 Resilinprotein
1 ,0 Panthenol
0,5 Magnesium Aluminum Silicate q.s Konservierungsmittel
65,5 Aqua dem.
C q.s. Parfümöl D q.s. Citric Acid
WS 5%
% Inhaltsstoff (INCI)
2,0 Ceteareth-25
2,0 Ceteareth-6, Stearyl Alcohol
3,0 Cetearyl Ethylhexanoate
1 ,0 Dimethicone
4,0 Cetearyl Alcohol
3,0 Glyceryl Stearate SE
5,0 Mineral OiI
4,0 Simmondsia Chinensis (Jojoba) Seed OiI
3,0 Mineral OiI, Lanolin Alcohol
B 5,0 Propylene Glycol
5,0 Resilinprotein
1 ,0 Panthenol
0,5 Magnesium Aluminum Silicate q.s Konservierungsmittel
61 ,5 Aqua dem.
C q.s. Parfümöl
D q.s. Citric Acid
Herstellung: Die Phasen A und B getrennt auf ca. 800C erwärmen. Phase B kurz vorhomogenisieren, dann Phase B in Phase A einrühren und erneut homogenisieren.Abkühlen auf ca. 400C, Phase C zugeben und nochmals gut homogenisieren. Den pH-Wert mit Citronensäure auf 6-7 einstellen.
Beispiel 32: Feuchtigkeitsspendende Körperpflegecreme
WS 1 % % Inhaltsstoff (INCI)
A 6,0 PEG-7 Hydrogenated Castor OiI
10,0 Cetearyl Ethylhexanoate
5,0 Isopropyl Myristate 7,0 Mineral OiI
0,5 Shea Butter (Butyrospermum Parkii)
0,5 Aluminum Stearate
0,5 Magnesium Stearate
0,2 Bisabolol 0,7 Quaternium-18-Hectorite B 5,0 Dipropylene Glycol
0,7 Magnesium Sulfate
1 ,0 Resilinprotein q.s. Konservierungsmittel
62,9 Aqua dem.
C q.s. Parfümöl
WS 5%
% Inhaltsstoff (INCI)
6,0 PEG-7 Hydrogenated Castor OiI
10,0 Cetearyl Ethylhexanoate
5,0 Isopropyl Myristate
7,0 Mineral OiI
0,5 Shea Butter (Butyrospermum Parkii)
0,5 Aluminum Stearate
0,5 Magnesium Stearate
0,2 Bisabolol
0,7 Quaternium-18-Hectorite
B 5,0 Dipropylene Glycol
0,7 Magnesium Sulfate
5,0 Resilinprotein q.s. Konservierungsmittel
58,9 Aqua dem. q.s. Parfümöl
Herstellung: Die Phasen A und B getrennt auf ca. 800C erwärmen. Phase B in Phase A einrüh- ren und homogenisieren. Unter Rühren auf ca. 400C abkühlen, Phase C zugeben und nochmals homogenisieren. Unter Rühren auf Raumtemperatur abkühlen lassen.
Beispiel 33: Flüssiges Make-up - Typ O/W
WS 1 %
% Inhaltsstoff (INCI)
A 2,0 Ceteareth-6, Stearyl Alcohol
2,0 Ceteareth-25
6,0 Glyceryl Stearate
1 ,0 Cetyl Alcohol
8,0 Mineral OiI
7,0 Cetearyl Ethylhexanoate
0.2 Dimethicone B 3,0 Propylene Glycol
1 ,0 Panthenol q.s. Konservierungsmittel
1 ,0 Resilinprotein
61 ,9 Aqua dem.
C 0,1 Bisabolol q.s. Parfümöl
D 5,7 C. I. 77 891 , Titanium Dioxide
1 ,1 Iran Oxides
WS 5%
% Inhaltsstoff (INCI)
A 2,0 Ceteareth-6, Stearyl Alcohol
2,0 Ceteareth-25
6,0 Glyceryl Stearate
1 ,0 Cetyl Alcohol
8,0 Mineral OiI
7,0 Cetearyl Ethylhexanoate
0,2 Dimethicone
B 3,0 Propylene Glycol
1 ,0 Panthenol
5,0 Resilinprotein q.s. Konservierungsmittel
57,9 Aqua dem.
C 0,1 Bisabolol q.s. Parfümöl
D 5,7 C. I. 77 891 , Titanium Dioxide
1 ,1 Iran Oxides
Herstellung: Die Phasen A und B getrennt auf ca. 800C erwärmen. Phase B in Phase A einrühren und homogenisieren. Unter Rühren auf ca. 400C abkühlen, Phasen C und D zugeben und nochmals gründlich homogenisieren. Unter Rühren auf Raumtemperatur abkühlen lassen.
Beispiel 34
Im Folgenden sind erfindungesgemäße dermokosmetische Zubereitungen beschrieben, enthaltend das gemäß des Beispiels 1 hergestellte Resilinprotein. Die folgenden Angaben sind Ge- wichtsteile einer wässrigen Lösung. Klares Shampoo
Klares Conditioner Shampoo
Schaum O/W-Emulsionen
Conditioner Shampoo mit Perlglanz pH einstellen auf 6,0
Klares Conditioner Shampoo
pH einstellen auf 6,0
Klares Conditioner Shampoo mit Volumen Effekt
pH einstellen auf 6,0
Gelcreme
OW Sunscreenformulation
Hydrodispersion
Sticks
PIT-Emulsion 100
Gelcreme
OW Formulations Selbstbräu- ner
OW Make Up
Hydrodispersion Selbstbräuner
Hydrodispersion After sun
WO-Emulsions
Feststoff stabilisierte Emulsion (Pickering Emulsions)
Sticks Parfümöl 0,20 0,20 0,24 0,16 0,10 0,10
Aqua dem. ad ad ad ad ad ad 100 ad ad 100 100 100 100 100 100 100
Ölgel
Beispiel 35:
In den folgenden Rezepturen werden kosmetische Sonnenschutzzubereitungen, enthaltend eine Kombination aus mindestens einem anorganischen Pigment, bevorzugt Zinkoxid und/oder Titandioxid und organische UV-A- und UV-B-Filter beschrieben.
Die Herstellung der nachfolgend genanntenen Formulierungen erfolgt auf übliche, dem Fachmann bekannte Art und Weise.
Der Gehalt an Resilinprotein hergestellt gemäß Beispiel 1 bezieht sich auf 100% Wirkstoff. Die erfindungsgemäßen Wirkstoffe können sowohl in reiner Form als auch als wässrige Lösung eingesetzt werden. Im Falle der wässerigen Lösung muss der Gehalt an Wasser dem. in der jeweiligen Formulierung angepasst werden.
0,10 Allantoin Allantoin
2% Resilinprotein
2,0 Mexoryl SX Terephthalidene Dicamphor Sulfonic Acid
65,20 Wasser dem. Aqua dem.
D 2,00 SimulgeI NS Hydroxyethyl Acrylate/Sodium Acryloyldimethyl Taurate Copolymer, Squalane, Polysorbate 60 q.s. Konservierungsmittel
Diethylamino Hydroxybenzoyl hexyl Benzoate
2,00 Uvinul N 539 T Octocrylene
B 5,00 T-Lite SF-S Titanium Dioxide, Silica Hydrate, AIu- mina Hydrate, Methicone/Dimethicone Copolymer
C 3,00 1 ,2-Propylenglykol Care Propylene Glycol
0,30 Abiol Imidazolidinyl Urea
1 ,00 Magnesiumsulfat-7-hydrat Magnesium Sulfate
0,5% Resilinprotein
Ad 100 Wasser dem. Aqua dem. q.s. Konservierungsmittel
Beschreibung der Abbildungen:
Abb. 1 Analyse des gereinigten Ui6-Proteins mittels SDS-PAGE: (A) Coomassie Färbung (B) Detektion mit anti-T7-Antikörper nach Western blot. Der Antikörper bindet den am N-Terminus der repetitiven Sequenz des Ui6 lokalisierten T7-Peptidtag.
Spur 1 : Gereinigtes Ui6-Protein; Spur 2: Protein Standardmarker; MW: Molekulargewichte der entsprechenden Markerbanden.
Abb. 2 Analyse der Reinheit des gereinigten Ui6 mittels Fluoreszenzspektroskopie. Ui6 enthält nicht die Aminosäure Tryptophan, während Tyrosine vorhanden sind. Dagegen ist Tryptophan mit einer durchschnittlichen Häufigkeit von 1.5% in Proteinen von E. coli vorhanden. Durch Fluoreszenzspektroskopie kann die Anwesenheit von Tryptophanen in einer Proteinprobe und damit von Verunreinigungen in Ui6-Präparationen selektiv nachgewiesen werden. Während durch Licht der Wellenlänge 280 nm sowohl Tyrosine als auch Tryptophane angeregt werden, führt Licht mit 295 nm ausschließlich zur An- regung von Tryptophan. Die Ui6 Probe zeigt eine für Tyrosin typische Fluoreszenz, während kein Anzeichen für die Anwesenheit von Tryptophan detektierbar ist, was ein Hinweis auf die hohe Reinheit der Proteinprobe ist.

Claims

Patentansprüche
1. Verwendung von Resilinproteinen in der Kosmetik, dadurch gekennzeichnet, dass die Resilinproteine zwischen einer und 100 Wiederholungseinheiten mit der Konsensussequenz SXXYGXP enthalten, wobei S ein Serin, X eine beliebige Aminosäure, Y ein Tyrosin, G ein Glycin und P ein Prolin ist.
2. Verwendung nach Anspruch 1 , dadurch gekennzeichnet, dass die Wiederholungseinheiten folgende Konsensussequenz enthalten: wobei
X4 ein Prolin, Alanin, Threonin oder Serin S ein Serin
X5 eine gelade oder polare Aminosäure
Xβ eine gelade oder polare Aminosäure
Y ein Tyrosin
G ein Glycin X7 ein Prolin, Alanin, Threonin oder Serin
P ein Prolin
Xe ein Glycin, Alanin, Threonin oder Serin
Xg ein Glycin eine polare Aminosäure oder keine Aminosäure
X10 ein Glycin eine polare Aminosäure oder keine Aminosäure ist.
3. Verwendung nach Anspruch 1 , dadurch gekennzeichnet, dass es sich um ein Hybridprotein handelt, bestehend aus Resilinsequenzen und Sequenzen von nicht-Resilin-Strukturproteinen.
4. Verwendung nach Anspruch 1 - 3, dadurch gekennzeichnet, dass ein Resi- linprotein mit einem Effektormolekül verbunden ist.
5. Verwendung nach Anspruch 4, dadurch gekennzeichnet, dass das Effektor- molekül ein UV-Absorber ist.
6. Verwendung nach Anspruch 1 - 5, dadurch gekennzeichnet, dass das Resi- linprotein in der Hautkosmetik eingesetzt wird.
7. Kosmetische Zusammensetzungen, enthaltend mindestens ein Resilinprotein und mindestens einen Wirkstoff aus der Gruppe der UV-Absorber.
8. Basische Resilinproteine, dadurch gekennzeichnet, dass das Verhältnis der in den Wiederholungseinheiten, die das Resilinprotein bilden, enthaltenen basischen Aminosäureresten (K, R) zu den sauren Aminosäureresten (D, E) mindestens 1 ,5 beträgt.
9. Basische Resilinproteine nach Anspruch 8, dadurch gekennzeichnet, dass sie die Struktur SEQ ID NO: 1 aufweisen
10. Verfahren zur Herstellung von basischen Resilinproteinen nach Anspruch 8, dadurch gekennzeichne, dass eine Gensequenz, die für eine Wiederholungs- einheit eines basischen Resilinproteins codiert, hergestellt wird, diese Wiederholungseinheiten zu einem Gesamtgen aus der gewünschten Anzahl von Wiederholungseinheiten zusammengesetzt werden, das Gesamtgen in einem Wirtsorganismus exprimiert wird und das exprimierte basische Resilinprotein aus dem Wirtsorganismus bzw. dessen Kulturmedium isoliert wird.
EP07822317A 2006-11-08 2007-11-07 Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik Withdrawn EP2066691A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP07822317A EP2066691A1 (de) 2006-11-08 2007-11-07 Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP06123659 2006-11-08
PCT/EP2007/062005 WO2008055931A1 (de) 2006-11-08 2007-11-07 Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik
EP07822317A EP2066691A1 (de) 2006-11-08 2007-11-07 Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik

Publications (1)

Publication Number Publication Date
EP2066691A1 true EP2066691A1 (de) 2009-06-10

Family

ID=38988395

Family Applications (1)

Application Number Title Priority Date Filing Date
EP07822317A Withdrawn EP2066691A1 (de) 2006-11-08 2007-11-07 Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik

Country Status (5)

Country Link
US (1) US20100015070A1 (de)
EP (1) EP2066691A1 (de)
JP (1) JP2010509279A (de)
CA (1) CA2664033A1 (de)
WO (1) WO2008055931A1 (de)

Families Citing this family (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2690658C (en) * 2007-06-20 2016-08-09 Basf Se Synthetic repetitive proteins, their production and use thereof
DE102007039954A1 (de) * 2007-08-23 2009-02-26 Henkel Ag & Co. Kgaa Reduktive Entfärbung keratinhaltiger Fasern
JP2011504374A (ja) * 2007-11-26 2011-02-10 イッサム リサーチ ディベロップメント カンパニー オブ ザ ヘブリュー ユニバーシティー オブ エルサレム リミテッド 繊維状ポリペプチドおよび多糖を含む組成物
CN102176905A (zh) * 2008-08-08 2011-09-07 巴斯夫欧洲公司 具有受控释放的活性成分的含活性成分的纤维层状结构，其用途及其生产方法
JP2011530491A (ja) * 2008-08-08 2011-12-22 ビーエーエスエフ ソシエタス・ヨーロピア バイオポリマーに基づいた活性物質含有連続繊維層、その使用、およびその生産のための方法
US20100062966A1 (en) * 2008-09-09 2010-03-11 Novipella, Inc. Self-cleaning thin-film forming compositions
GB0822823D0 (en) * 2008-12-15 2009-01-21 Dow Corning Silicone oi-in-water emulsions
CA2752808A1 (en) * 2009-03-09 2010-09-16 Basf Se Use of a synergistic mixture of water-soluble polymers and hydrophobins for thickening aqueous phases
EP2295114A1 (de) 2009-09-10 2011-03-16 Dalli-Werke GmbH & Co. KG Kosmetische Zusammensetzung mit antimikrobieller Wirkung
US8470967B2 (en) 2010-09-24 2013-06-25 Duke University Phase transition biopolymers and methods of use
JP5965619B2 (ja) * 2011-11-18 2016-08-10 株式会社ミルボン スプレー
EP2668962B1 (de) * 2012-05-29 2016-10-26 Albert-Ludwigs-Universität Freiburg Proteinassembler
US10364451B2 (en) 2013-05-30 2019-07-30 Duke University Polymer conjugates having reduced antigenicity and methods of using the same
US10392611B2 (en) 2013-05-30 2019-08-27 Duke University Polymer conjugates having reduced antigenicity and methods of using the same
DE102013213170A1 (de) 2013-07-04 2015-01-08 Beiersdorf Ag Octocrylenfreies, geruchsstabiles Sonnenschutzmittel
US9672952B2 (en) 2013-08-14 2017-06-06 Industrial Technology Research Institute Polymer and conductive composition
ES2730429T3 (es) 2013-10-18 2019-11-11 Univ Do Minho Composición peptídica y usos de la misma
US10385115B2 (en) 2015-03-26 2019-08-20 Duke University Fibronectin type III domain-based fusion proteins
EA037478B1 (ru) 2015-08-04 2021-04-01 Дьюк Юниверсити Генетически кодируемые внутренне неупорядоченные полимеры-"невидимки" для доставки и способы их применения
US11752213B2 (en) 2015-12-21 2023-09-12 Duke University Surfaces having reduced non-specific binding and antigenicity
WO2017210476A1 (en) 2016-06-01 2017-12-07 Duke University Nonfouling biosensors
WO2018053201A1 (en) 2016-09-14 2018-03-22 Duke University Triblock polypeptide-based nanoparticles for the delivery of hydrophilic drugs
JP2020500150A (ja) 2016-09-23 2020-01-09 デューク ユニバーシティ 下限臨界溶液温度挙動を有する非反復かつ非構造的ポリペプチド
WO2018132732A1 (en) 2017-01-12 2018-07-19 Duke University Genetically encoded lipid-polypeptide hybrid biomaterials that exhibit temperature triggered hierarchical self-assembly
WO2018185768A1 (en) 2017-04-07 2018-10-11 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Hair care compositions
WO2018213320A1 (en) 2017-05-15 2018-11-22 Duke University Recombinant production of hybrid lipid-biopolymer materials that self-assemble and encapsulate agents
WO2019006374A1 (en) 2017-06-30 2019-01-03 Duke University ORDER AND DISORDER AS A DESIGN PRINCIPLE FOR STIMULI-SENSITIVE BIOPOLYMER NETWORKS
WO2019116342A1 (en) 2017-12-15 2019-06-20 Politecnico Di Milano Elastomeric peptide
WO2019147954A1 (en) 2018-01-26 2019-08-01 Duke University Albumin binding peptide-drug (aibiped) conjugates and methods of making and using same
EP3788343B1 (de) 2018-04-30 2024-03-27 Duke University Auf stimuli reagierende plattform zur abgabe von auf peg-like-polymer basierendem arzneimittel
EP3575313A1 (de) * 2018-05-30 2019-12-04 Université de Lausanne Nanobeschichtungen vom insektenhornhauttyp
US11649275B2 (en) 2018-08-02 2023-05-16 Duke University Dual agonist fusion proteins
US11712410B2 (en) 2018-09-05 2023-08-01 K18, Inc. Composition for improving hair health
US12594347B2 (en) 2018-09-07 2026-04-07 Duke University Nanoparticulate drug delivery systems
US20220362116A1 (en) * 2019-07-03 2022-11-17 Yvon GANGA Antimicrobial skin cream
US11512314B2 (en) 2019-07-12 2022-11-29 Duke University Amphiphilic polynucleotides
TW202216111A (zh) 2020-07-03 2022-05-01 米尼奧大學 香氛釋放機制、方法及其用途
DE102020210312A1 (de) * 2020-08-13 2022-02-17 Beiersdorf Aktiengesellschaft Kosmetische Ethanol-in-Öl-Emulsion
CN114904384B (zh) * 2021-06-04 2023-08-22 浙江施维康生物医学材料有限公司 一种含生物酶的空气净化剂及其制备方法
WO2023099130A1 (en) * 2021-12-01 2023-06-08 Unilever Ip Holdings B.V. Personal care composition
CN114149339B (zh) * 2021-12-28 2023-01-31 黄冈美丰化工科技有限公司 一种紫外线吸收剂、组合物、化妆品及配制化妆品的工艺
CN120548162A (zh) * 2022-10-21 2025-08-26 莱雅公司 脂肪相的量按重量计在20%与70%之间的包含亲脂性有机遮蔽剂、亲水性有机遮蔽剂的组合物
FR3141062A1 (fr) * 2022-10-21 2024-04-26 L'oreal Composition comprenant un filtre organique lipophile, un filtre organique hydrophile, avec une quantité en poids de phase grasse entre 20 et 70 % et un ratio massique filtres organiques hydrophiles / filtres organiques lipophiles supérieur à 0,3

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7297678B2 (en) * 2003-03-12 2007-11-20 Genencor International, Inc. Use of repeat sequence protein polymers in personal care compositions
US7456147B2 (en) * 2003-05-14 2008-11-25 Dow Corning, Corporation Controlled release of active agents utilizing repeat sequence protein polymers
EP1633382A4 (de) * 2003-05-14 2009-08-05 Dow Corning Wiederholungssequenz-protein-polymer-wirkstoff-konjugate, verfahren und verwendungen
AU2003902483A0 (en) * 2003-05-21 2003-06-05 Commonwealth Scientific And Industrial Research Organisation A bioelastomer ii

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2008055931A1 *

Also Published As

Publication number Publication date
CA2664033A1 (en) 2008-05-15
JP2010509279A (ja) 2010-03-25
US20100015070A1 (en) 2010-01-21
WO2008055931A1 (de) 2008-05-15

Similar Documents

Publication Publication Date Title
EP2066691A1 (de) Verwendung von natürlichen, rekombinanten und synthetischen resilinen in der kosmetik
EP1979055A2 (de) Verwendung von protein-microbeads in der kosmetik
EP1898871A2 (de) Verwendung von hydrophobin-polypeptiden sowie konjugaten aus hydrophobin-polypeptiden mit wirk- oder effektstoffen und ihre herstellung sowie deren einsatz in der kosmetik
EP1763334A2 (de) Keratin-bindende polypeptide
US7060260B2 (en) Water-soluble silk proteins in compositions for skin care, hair care or hair coloring
EP2282715B1 (de) Polyurethane als rheologiemodifizierende mittel für kosmetische zubereitungen
WO2007012574A1 (de) Dermokosmetische zubereitungen
EP1957034A2 (de) Chimäre keratinbindende effektorproteine
KR20070099038A (ko) 화장품 제제를 위한 증점제 형태의 수-중-수 에멀젼중합체의 용도
KR20080102379A (ko) 헤테로사이클릭 치환된 축합 중합체
EP1968642A2 (de) Keratinbindende effektormoleküle und verfahren zu deren herstellung durch kopplung keratinbindender polypeptide mit carboxylgruppen oder sulfonsäuregruppen tragenden effektormolekülen
JP2018506556A (ja) イタコン酸のポリマーおよび化粧料またはパーソナルケア製品における皮膜形成剤としてのその使用
EP1957111A2 (de) Keratinbindende effektormoleküle und verfahren zu deren herstellung
WO2006097432A2 (de) Keratin-biktdende desmoplakinpolypeptidsequenzen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20090312

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK RS

17Q First examination report despatched

Effective date: 20090728

RIN1 Information on inventor provided before grant (corrected)

Inventor name: RAUNFT, EVELYN

Inventor name: PTOCK, ARNE

Inventor name: HUEMMERICH, DANIEL

Inventor name: FEHR, MARCUS

Inventor name: LIEBMANN, BURGHARD

Inventor name: BOLLSCHWEILER, CLAUS

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120719