EP1891261A2 - Procede d'enduction de surfaces de substrats fibreux - Google Patents

Procede d'enduction de surfaces de substrats fibreux

Info

Publication number
EP1891261A2
EP1891261A2 EP06777256A EP06777256A EP1891261A2 EP 1891261 A2 EP1891261 A2 EP 1891261A2 EP 06777256 A EP06777256 A EP 06777256A EP 06777256 A EP06777256 A EP 06777256A EP 1891261 A2 EP1891261 A2 EP 1891261A2
Authority
EP
European Patent Office
Prior art keywords
hydrophobin
hydrophobins
fibrous
proteins
substrates
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06777256A
Other languages
German (de)
English (en)
Inventor
Thorsten Montag
Ulf Baus
Marvin Karos
Thomas Subkowski
Volker Schwendemann
Richard Baur
Christine Mendera
Claus Bollschweiler
Hans-Georg Lemaire
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE200510026143 external-priority patent/DE102005026143A1/de
Priority claimed from DE200510030786 external-priority patent/DE102005030786A1/de
Application filed by BASF SE filed Critical BASF SE
Publication of EP1891261A2 publication Critical patent/EP1891261A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • D—TEXTILES; PAPER
    • D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
    • D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
    • D06M15/00—Treating fibres, threads, yarns, fabrics, or fibrous goods made from such materials, with macromolecular compounds; Such treatment combined with mechanical treatment
    • D06M15/01—Treating fibres, threads, yarns, fabrics, or fibrous goods made from such materials, with macromolecular compounds; Such treatment combined with mechanical treatment with natural macromolecular compounds or derivatives thereof
    • D06M15/15—Proteins or derivatives thereof
    • D—TEXTILES; PAPER
    • D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
    • D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
    • D06M2101/00—Chemical constitution of the fibres, threads, yarns, fabrics or fibrous goods made from such materials, to be treated
    • D06M2101/16—Synthetic fibres, other than mineral fibres
    • D06M2101/30—Synthetic polymers consisting of macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
    • D06M2101/32—Polyesters
    • D—TEXTILES; PAPER
    • D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
    • D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
    • D06M2101/00—Chemical constitution of the fibres, threads, yarns, fabrics or fibrous goods made from such materials, to be treated
    • D06M2101/16—Synthetic fibres, other than mineral fibres
    • D06M2101/30—Synthetic polymers consisting of macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
    • D06M2101/34—Polyamides
    • D—TEXTILES; PAPER
    • D10—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B2331/00—Fibres made from polymers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polycondensation products
    • D10B2331/02—Fibres made from polymers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polycondensation products polyamides
    • D—TEXTILES; PAPER
    • D10—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B2331/00—Fibres made from polymers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polycondensation products
    • D10B2331/04—Fibres made from polymers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polycondensation products polyesters, e.g. polyethylene terephthalate [PET]
    • D—TEXTILES; PAPER
    • D10—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B2503/00—Domestic or personal
    • D10B2503/04—Floor or wall coverings; Carpets
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T442/00—Fabric [woven, knitted, or nonwoven textile or cloth, etc.]
    • Y10T442/20—Coated or impregnated woven, knit, or nonwoven fabric which is not [a] associated with another preformed layer or fiber layer or, [b] with respect to woven and knit, characterized, respectively, by a particular or differential weave or knit, wherein the coating or impregnation is neither a foamed material nor a free metal or alloy layer
    • Y10T442/2352—Coating or impregnation functions to soften the feel of or improve the "hand" of the fabric

Definitions

  • the present invention relates to a process for coating surfaces of fibrous substrates selected from textile substrates and leather, using at least one hydrophobin. Furthermore, the present invention relates to coated fibrous substrates selected from textile substrates and leather, and to processes for the production of garments using fibrous substrates according to the invention.
  • the method defined above is based on one or more surfaces that may be smooth or structured.
  • the surface to be coated belongs to a fibrous substrate selected from textile substrates and leather.
  • textile substrates are to be understood as meaning textile fibers, semi-finished and finished textile products and finished articles made thereof, which, in addition to textiles for the clothing industry, also include, for example, carpets and other home textiles as well as textile structures serving technical purposes. These include unshaped structures such as flakes, linear structures such as twine, threads, yarns, linen, cords, ropes, threads and body structures such as felts, fabrics, knitted fabrics, nonwovens and wadding.
  • Textile substrates may be of materials of natural origin, for example cotton, wool or flax, or blended fabrics, for example cotton / polyester, cotton / polyamide.
  • textile or textiles are preferably polyacrylonitrile, polyamide and in particular polyester or materials of natural origin with polyacrylonitrile, polyamide and especially polyester.
  • leather is preferably understood to mean tanned and finished animal hides and so-called split leather.
  • Coating in the context of the present invention is understood as meaning a monomolecular layer of at least one hydrophobin which covers at least 10%, preferably at least 25% and particularly preferably at least 50% of the surface of the substrate to be coated according to the invention.
  • the degree of covering of fibrous substrate can be determined by methods known per se, for example by microscopic methods.
  • At least one hydrophobin is used to coat surfaces of fibrous substrates. It is possible to use a hydrophobin or a mixture of several different hydrophobins.
  • Hydrophobins are proteins known per se, preferably small peptides that are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have eight cysteine units. Hydrophobins can be isolated from natural sources. However, it is also possible to synthesize non-naturally occurring hydrophobins by means of chemical and / or biotechnological production processes.
  • hydrophobins in the context of this invention is preferably intended to mean proteins of the general structural formula (I)
  • X is for any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, He, Met, Thr, Asn, Lys, VaI, Ala, Asp, GIu, GIy) can stand.
  • X may be the same or different.
  • the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine with the proviso that at least four of the amino acids denoted C are cysteine, and the indices n and m are independently of each other for natural numbers in the range of 0 to 500, preferably from 15 to 300.
  • hydrophobins are characterized by the property that, after coating a glass surface, they increase the contact angle of a water droplet (5 ⁇ l) by at least 20 °, preferably at least 25 ° and particularly preferably 30 °, compared with the Cycle angle of an equal drop of water with the uncoated glass surface, wherein each measured at room temperature.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least five, particularly preferably at least six, and in particular at least seven, of the positions C 1 to C 8 should consist of cysteines. Cysteines can be present in reduced amounts in proteins used according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those having at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.
  • X, C and the indices standing at X and C are as defined above, however, the indices n and m are numbers in the range of 0 to 300, and the proteins are further characterized by the above-mentioned contact angle change and further at least six of the amino acids named C are cysteine. Most preferably, all of the amino acids named C are cysteine.
  • X, C and the indices standing at X and C are as defined above, however, the indices n and m are numbers ranging from 0 to 200, and the proteins are further characterized by the above-mentioned contact angle change.
  • radicals X n and X m may be peptide sequences which may be naturally linked to a hydrophobin. But it can also be nem or both radicals X n and X m are peptide sequences which are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended by a non-naturally occurring in a hydrophobin peptide sequence.
  • X n and / or X m are naturally non-hydrophobic linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length.
  • Such a residue, which is not naturally linked to a hydrophobin will also be referred to below as a fusion partner part. This is to express that proteins used according to the invention may consist of at least one hydrophobin part and one fusion partner part which do not occur together in nature in this form.
  • the fusion partner portion can be selected from a variety of proteins. It is also possible to combine a plurality of fusion partner parts with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X 171 ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partner parts to one position (X n or X m ) of the protein used according to the invention.
  • fusion partner parts are proteins which occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • fusion partner parts are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin.
  • fragments or derivatives of the abovementioned sequences which comprise only a part, preferably 70 to 99%, particularly preferably 80 to 98%, of the said sequences, or in which individual amino acids or nucleotides are changed relative to the abovementioned sequence, where percentages in each case relate to the number of amino acids.
  • Proteins used according to the invention may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaric dialdehyde.
  • One property of the proteins used in the invention is the change in surface properties when the surfaces are coated with the proteins.
  • the change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after coating a surface with the protein and determining the difference between the two measurements.
  • the implementation of contact angle measurements is known in principle to the person skilled in the art.
  • the exact experimental conditions for an exemplary suitable method for measuring the contact angle are shown in the experimental section.
  • the assembled membranes of class I hydrophobins are highly insoluble (even towards 1 wt .-% aqueous solution of sodium n-dodecyl sulfate (SDS) at elevated temperature such as 80 0 C) and can only by concentrated trifluoroacetic acid (TFA) or formic acid be dissociated again.
  • the assembled forms of class II hydrophobins are less stable. They can already be dissolved by 60% by weight of ethanol or 1% by weight of SDS (in each case in water, at room temperature).
  • a comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 in class II hydrophobins is significantly shorter than in class I hydrophobins.
  • Class II hydrophobins also have more charged amino acids than class I.
  • hydrophobins for practicing the present invention are the dewA, rodA, hypA, hypB, sc3, basfi, basf2 hydrophobins which are structurally characterized in the Sequence Listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
  • proteins used according to the invention are particularly suitable for carrying out the present invention.
  • the fusion proteins having the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding for them, in particular the sequences according to SEQ ID NO: 19, 21, 23.
  • proteins which are starting from the sequences shown in SEQ ID NO. 22, 22 or 24 represented by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have the biological property of the starting proteins to at least 50% are particularly preferred Embodiments.
  • the biological property of the proteins used according to the invention is understood here to be the change in the contact angle already described by at least 20 °.
  • Proteins used according to the invention can be prepared chemically by known methods of peptide synthesis, for example by solid phase synthesis according to Merrifield.
  • Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
  • fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells), and the like.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium,
  • expression constructs as hydrophobins, containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a protein used according to the invention, as well as vectors comprising at least one of these expression constructs.
  • expression constructs employed comprise a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally further conventional regulatory elements, in each case operatively linked to the coding sequence.
  • “Operational linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. chen. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • a preferred nucleic acid construct advantageously also contains one or more of the abovementioned "enhancer” sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence, and additional advantageous sequences may also be inserted at the 3 'end of the DNA sequences additional regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.
  • Advantageous regulatory sequences for the process are, for example, in promoters such as cos, tac, trp, tet, trp, tet, lpp, lac, lpp-lac, laclq-T7, T5, T3, gal, trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • vectors apart from plasmids and phages, all other vectors known per se, ie z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
  • vectors can be replicated autonomously in the host organism or replicated chromosomally. These vectors represent a further embodiment of the invention.
  • Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-IH "3-B1, tgt11 or pBdCI, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL12 or pBB116, in yeasts 2alpha, pAG-1,
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or ⁇ '-terminal regulatory sequences for increasing the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase.
  • enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid may also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • common recombination and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1989), and in TJ Silhavy, ML Berman and L W. Enquist, Experiments with Gene Fusions, Col. Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are known per se and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the proteins used in the invention.
  • the recombinant expression constructs described above are introduced into a suitable host system and expressed.
  • known conventional cloning and transfection methods such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used in order to express the stated nucleic acids in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F.Ausubel et al., Ed., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Colard Spring Harbor Laboratory, Col. Spring Harbor Laboratory Press, Col. Spring Harbor, NY, 1989.
  • Homologously recombined microorganisms can also be produced.
  • a vector is prepared which contains at least a portion of a gene or a coding sequence to be used according to the invention, wherein optionally at least one amino acid deletion, addition or substitution has been introduced to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector).
  • the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed).
  • the altered portion of the gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is z. As described in Thomas, KR and Capecchi, MR (1987) Cell 51: 503. In principle, all prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for the nucleic acid or nucleic acid construct used according to the invention.
  • microorganisms such as bacteria, fungi or yeast are used as host organisms.
  • Gram-positive or gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are advantageously used ,
  • the organisms used in the production process for fusion proteins are grown or bred depending on the host organism in a conventional manner.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 0 C, preferably between 10 to 60 0 C attracted under oxygen fumigation.
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
  • Proteins or functional, biologically active fragments thereof used according to the invention can be produced by means of a recombinant process, in which a protein-producing microorganism is cultivated, if appropriate, the expression of the proteins is induced and these are isolated from the culture. According to the invention. used proteins can also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 0 C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are disrupted and the product is recovered from the lysate by known protein isolation methods.
  • the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic see solvents, be homogenized by homogenizers or by combining several of the listed methods.
  • Purification of protein used according to the invention can be achieved by chromatographic methods known per se, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and by other conventional methods, such as ultrafiltration, crystallization Suitable methods are described, for example, in Cooper, FG, Biochemische Harvey Methoden, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin described.
  • vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA by certain nucleotide sequences and thus code for altered polypeptides or fusion proteins which serve, for example, a simpler purification.
  • suitable modifications include so-called "tags" as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988 , Antibodies: A Laboratory Manual, CoId Spring Harbor (NY) Press).
  • tags are e.g.
  • HA calmodulin BD
  • GST GST
  • MBD Chitin-BD
  • Steptavidin-BD-Avi-Tag Flag-Tag
  • T7 T7 etc.
  • anchors can be used to attach the proteins to a solid support, such as.
  • a polymer matrix serve, which may be filled for example in a chromatography column, or may be used on a microtiter plate or on another carrier.
  • the corresponding purification protocols are available from the commercial affinity tag providers.
  • the proteins prepared as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner part as "pure" hydrophobins.
  • a potential cleavage site (specific recognition site for proteases) into the fusion protein between the hydrophobin part and the fusion partner part.
  • Suitable cleavage sites are, in particular, those peptide sequences which are otherwise found neither in the hydrophobin part nor in the fusion partner part, which can be easily determined with bioinformatic tools.
  • Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
  • hydrophobins for coating surfaces, it is also possible to use hydrophobins in bulk. However, the hydrophobins are preferably used in aqueous formulation.
  • hydrophobins for carrying out the invention is basically not limited. It is possible to use one hydrophobin or else several different ones. For example, fusion proteins such as yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) can be used.
  • hydrophobins as described above are used for coating surfaces of fibrous substrates selected from textile substrates and leather.
  • hydrophobins as described above can be used for coating surfaces of fibrous substrates selected from textile substrates and leather, without having to resort to strongly alkylating compounds such as epichlorohydrin or crosslinkers such as DMDHEU.
  • Another object of the present invention is a process for coating fibrous substrates selected from textile substrates and leather, using at least one hydrophobin.
  • Hydrophobins, fibrous substrates, textile substrates and leather as well as coating are defined as described above.
  • the process according to the invention is carried out by contacting the fibrous substrate to be coated with at least one aqueous formulation, preferably an aqueous liquor, which contains at least one hydrophobin.
  • the fibrous substrate to be coated is contacted with at least one aqueous formulation, preferably an aqueous liquor containing at least one hydrophobin, by the exhaustion process.
  • the fibrous substrate to be coated is contacted with at least one aqueous formulation, preferably an aqueous liquor containing at least one hydrophobin, by a padding process.
  • fibrous substrate and in particular textile substrate with hydrophobin are contacted, for example in a vessel or preferably with the aid of a padder.
  • contacted fibrous substrate and in particular textile substrate with hydrophobin at temperatures ranging from 0 0 C to 90 0 C, preferably in the range of room temperature to 85 ° C.
  • fibrous substrate and in particular textile substrate contacts, for example in a boiler or, preferably, by means of a mangle, with hydrophobin, and thereafter dried, for example at temperatures in the range of 20 to 12O 0 C.
  • fibrous substrate, and in particular textile substrate for example, be contacted in a boiler or, preferably, by means of a mangle, with hydrophobin, and dried thereafter, for example at temperatures in the range of 20 to 12O 0 C, for example over a period from 5 seconds to 15 minutes, preferably to 5 minutes.
  • temperatures in the range of 20 ° C to 12O 0 C preferably up to 105 0 C are suitable. The drying time is longer, the lower one chooses the temperature, and vice versa.
  • fibrous substrate and in particular leather with hydrophobin
  • fibrous substrate is contacted by covering fibrous substrate once or several times with an aqueous formulation, for example sprayed, containing at least one hydrophobin.
  • exposure time of aqueous formulation to fibrous substrate can be chosen for example 1 to 24 hours, preferably 12 to 17 hours.
  • water-miscible organic solvents include water-miscible monohydric or polyhydric alcohols, such as methanol, ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or glycerol.
  • water-miscible monohydric or polyhydric alcohols such as methanol, ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or glycerol.
  • ether alcohols examples include monoalkyl ethers of (poly) ethylene or (poly) ly) propylene glycols such as ethylene glycol monobutyl ether.
  • the nature and amount of the water-soluble, organic solvents are not critical per se and can be, for example, in the range from 1 to 50% by weight, based on the aqueous formulation used according to the invention.
  • aqueous formulations used for carrying out the process according to the invention may contain from 0.1 to 5 wt .-% of inorganic salt, for example NaCl, based on aqueous formulation used according to the invention.
  • the use of strongly alkylating compounds such as epichlorohydrin is dispensed with when carrying out the process according to the invention.
  • crosslinkers such as, for example, N, N-dimethylol-4,5-dihydroxyethyleneurea (DMDHEU) is dispensed with in carrying out the process according to the invention.
  • DMDHEU N, N-dimethylol-4,5-dihydroxyethyleneurea
  • the aqueous solutions of the hydrophobins obtained in the synthesis, isolation and / or purification of the hydrophobins can preferably be used. Depending on their purity, they may also contain residues of auxiliaries from the synthesis.
  • the hydrophobins can also initially be isolated as a substance, for example by freeze-drying, and formulated in a second step.
  • the required concentration of hydrophobin of aqueous formulation used in the process of the invention may be determined according to the type of surface to be coated and / or the application. However, relatively low concentrations of hydrophobin are sufficient to achieve the intended effect.
  • the process according to the invention is carried out with at least one aqueous formulation which contains in the range from 1 mg / l to 10 g / l of at least one hydrophobin.
  • aqueous formulation and in particular liquor used in the process according to the invention has a pH in the range from 3 to 9, preferably 4 to 8.
  • the fibrous substrate to be coated is pre-treated prior to contacting with hydrophobin and only thereafter contacted with hydrophobin.
  • pretreat for example by rinsing with water for a few minutes, preferably with demineralized water, more preferably over a period of 5 minutes to 5 hours.
  • the surface of fibrous substrate to be coated is treated according to the invention by contacting it with another aqueous formulation containing at least one active substance.
  • Active substance can be selected from organic chemicals, for example from anionic, cationic or non-ionic detergents, and from enzymes such as proteases or lipases.
  • the present invention is treated by bleaching according to the invention to be coated fibrous substrate.
  • This embodiment is preferred when the fibrous substrate to be coated is cotton or cotton-synthetic fiber blends.
  • An aqueous formulation used according to the invention may optionally further comprise further components, for example additives and / or auxiliaries.
  • additives and / or auxiliaries include acids or bases, for example carboxylic acids or ammonia, buffer systems, polymers, inorganic particles such as SiO 2 or silicates, colorants such as, for example, dyes, fragrances or biocides.
  • additives are listed in DE-A 101 60 993, in particular Sections [0074] to [0131].
  • the inventive method a coated surface of fibrous substrate and preferably coated textile substrate or leather is available, which has a dirt-repellent, at least one hydrophobin comprehensive coating.
  • the coating is usually at least one monomolecular layer of hydrophobin on the coated surface.
  • Dirt is in a known manner to all types of unwanted contamination of hard surfaces with solid and / or liquid substances.
  • Examples of dirt include fats, oils, egg whites, leftovers, dust or soil.
  • Contaminations can also be calcium deposits, such as dried-on traces of water that form due to the hardness of the water.
  • Further Examples include residues of personal care cleaners and conditioners, or insoluble lime soaps which may form from such cleansing and conditioning agents associated with water hardness, and which may deposit on surfaces of fibrous substrates such as textile substrates or leather.
  • the antisoiling effect can be determined by methods which are known in principle, for example by comparing the removability of dirt by rinsing with water from an untreated surface and a surface treated with hydrophobins.
  • Aqueous formulations used according to the invention can be prepared, for example, by mixing one or more hydrophobins with water and / or one or more of the abovementioned solvents. If desired, it is possible to add further components, for example additives and / or auxiliaries, wherein the order of addition of hydrophobin and water, optionally solvent and optionally one or more further components is not critical.
  • Formulations of the invention are generally free of strongly alkylating compounds such as epichlorohydrin or crosslinkers such as DMDHEU and long decomposition storage.
  • fibrous substrates selected from textile substrates and leather, coated according to the inventive method described above. They not only have excellent dirt-repellent properties, but also good washing and rubbing fastness and a pleasant feel. They are suitable, for example, for producing home textiles such as, for example, bed linen, curtains and curtains, bath and sanitary textiles and tablecloths, and also for producing textiles for outdoor use such as awnings, tents, boat covers, truck tarpaulins, convertible roofs and in particular for the manufacture of clothing such as shoes, jackets, coats, pants, pullovers, stockings, belts, home textiles such as bed linen, curtains and curtains, bath and sanitary textiles and tablecloths.
  • Leathers coated according to the invention are particularly suitable for
  • Part A is intended to explain the invention in more detail:
  • oligonucleotides Hal570 and Hal571 (HaI 572 / HaI 573) a polymerase chain reaction was carried out.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • the oligonucleotides KaM 416 and KaM 417 Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAG CTAGTG G ATCCATTG AAGG CCG CATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • the cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA used was an artificially synthesized DNA sequence - hydrophobin BASF1 (see Appendix).
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • KaM418 CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
  • Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • Schyzophyllum commune cDNA was used as template DNA (see appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) were made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension was treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then degraded for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) the nucleic acids are incubated. Before cell disruption, filtration was carried out with a glass cartridge (P1). For homogenization of the cells and for shearing the remaining genomic DNA, two homogenizer runs were carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
  • the homogenate was centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet in 100 ml sodium phosphate buffer, pH 7, 5 resuspended. Centrifugation and resuspension were repeated three times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stirring was continued for one hour and a final centrifugation performed (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant was applied to a 50 ml Nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column was washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin was subsequently treated with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole eluted. To remove the imidazole, the solution was dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • FIG 1 shows the purification of the hydrophobin HP1 thus prepared:
  • Lanes 3 - 5 OD 280 maxima of the elution fractions
  • the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of hydrophobin.
  • Substrate glass (window glass, Süd Weg Glas, Mannheim):
  • the samples thus obtained were dried in air (room temperature) and determined at room temperature, the contact angle (in degrees) of a drop of 5 ul of water.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • hydrophobin HP1 for coating surfaces of fibrous
  • hydrophobin HP1 fusion protein
  • White polyester fabric basis weight 226 g / m 2 , was first rinsed for 45 minutes with demineralized water and then immersed in a 0.02 wt .-% aqueous solution of HP1 in water and treated at 80 0 C for 17 hours. Thereafter, the polyester fabric thus treated was rinsed with deionized water for one minute and dried at room temperature. Inventive treated substrate PES-HP1 was obtained. It had a very pleasant grip.
  • the test detergent 1 was obtained.

Landscapes

  • Engineering & Computer Science (AREA)
  • Textile Engineering (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Synthetic Leather, Interior Materials Or Flexible Sheet Materials (AREA)
  • Peptides Or Proteins (AREA)
  • Laminated Bodies (AREA)
  • Treatment And Processing Of Natural Fur Or Leather (AREA)
  • Treatments For Attaching Organic Compounds To Fibrous Goods (AREA)

Abstract

L'invention concerne un procédé d'enduction de substrats fibreux, sélectionnés parmi des substrats textiles et le cuir, à l'aide d'au moins une hydrophobine.
EP06777256A 2005-06-06 2006-05-31 Procede d'enduction de surfaces de substrats fibreux Withdrawn EP1891261A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE200510026143 DE102005026143A1 (de) 2005-06-06 2005-06-06 Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE200510030786 DE102005030786A1 (de) 2005-06-29 2005-06-29 Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
PCT/EP2006/062785 WO2006131478A2 (fr) 2005-06-06 2006-05-31 Procede d'enduction de surfaces de substrats fibreux

Publications (1)

Publication Number Publication Date
EP1891261A2 true EP1891261A2 (fr) 2008-02-27

Family

ID=36997255

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06777256A Withdrawn EP1891261A2 (fr) 2005-06-06 2006-05-31 Procede d'enduction de surfaces de substrats fibreux

Country Status (10)

Country Link
US (1) US20090117796A1 (fr)
EP (1) EP1891261A2 (fr)
JP (1) JP2008545895A (fr)
KR (1) KR20080014034A (fr)
AU (1) AU2006256765A1 (fr)
BR (1) BRPI0611240A2 (fr)
CA (1) CA2610785A1 (fr)
MX (1) MX2007014908A (fr)
TW (1) TW200702518A (fr)
WO (1) WO2006131478A2 (fr)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006082253A2 (fr) * 2005-02-07 2006-08-10 Basf Aktiengesellschaft Procede pour enduire des surfaces avec des hydrophobines
WO2006082251A2 (fr) * 2005-02-07 2006-08-10 Basf Aktiengesellschaft Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
BRPI0607594A2 (pt) * 2005-03-31 2010-04-06 Basf Ag compósito multi-camadas ou substrato revestido, processo para a preparação dos mesmos, e, uso de hidrofobinas
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
US8173716B2 (en) * 2007-03-06 2012-05-08 Basf Se Open-cell foam modified with hydrophobines
EP2134901B1 (fr) * 2007-03-12 2016-01-06 B.R.A.I.N. Biotechnology Research and Information Network AG Procédé de gestion de matériaux en cellulose avec hydrophobines
RU2491096C9 (ru) * 2007-09-13 2014-02-10 Басф Се Применение гидрофобин-полипептидов в качестве усилителя пенетрации
EP2042155A1 (fr) * 2007-09-28 2009-04-01 Basf Se Procédé de suppression de substances indissolubles dans l'eau de surfaces de substrat
JP2012500241A (ja) * 2008-08-18 2012-01-05 ビーエーエスエフ ソシエタス・ヨーロピア ケラチンの非永久的染色のためのハイドロフォビンの使用
WO2010072665A1 (fr) 2008-12-23 2010-07-01 Basf Se Modification de nanofibres ou de mésofibres ou de produits textiles plats produits par électrofilage à l'aide de protéines amphiphiles
EP2395969A2 (fr) * 2009-02-10 2011-12-21 Basf Se Utilisation d'hydrophobine en tant qu'agent mouillant
JP2012519767A (ja) * 2009-03-09 2012-08-30 ビーエーエスエフ ソシエタス・ヨーロピア 水相増粘用の水溶性ポリマーとハイドロフォビンの相乗性混合物の利用
KR101254294B1 (ko) 2011-06-14 2013-04-12 대구보건대학교산학협력단 병원균에 작용하는 바이오신소재와 이를 이용한 보건위생용품

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000040968A1 (fr) * 1999-01-05 2000-07-13 Unilever Plc Fixation de fragments d'anticorps a des supports solides
GB0002661D0 (en) * 2000-02-04 2000-03-29 Biomade B V Method of stabilizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
DE10342794A1 (de) * 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
US7241734B2 (en) * 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006131478A3 *

Also Published As

Publication number Publication date
JP2008545895A (ja) 2008-12-18
US20090117796A1 (en) 2009-05-07
WO2006131478A3 (fr) 2007-03-22
BRPI0611240A2 (pt) 2016-11-16
KR20080014034A (ko) 2008-02-13
CA2610785A1 (fr) 2006-12-14
TW200702518A (en) 2007-01-16
WO2006131478A2 (fr) 2006-12-14
MX2007014908A (es) 2008-03-27
AU2006256765A1 (en) 2006-12-14

Similar Documents

Publication Publication Date Title
EP1891261A2 (fr) Procede d'enduction de surfaces de substrats fibreux
EP1913123B1 (fr) Utilisation de proteines tensioactives non enzymatiques pour le linge
EP1866401B1 (fr) Utilisation d'hydrophobines pour le traitement antisalissant de surfaces dures
EP1848733B1 (fr) Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
EP1848734A2 (fr) Procede pour enduire des surfaces avec des hydrophobines
WO2006131564A2 (fr) Nouvelles proteines de fusion de type hydrophobines appauvries en cysteine, leur production, et leur utilisation
EP1866106B1 (fr) Utilisation d'hydrophobines pour traiter la surface de materiaux de construction mineraux durcis, de pierre naturelle, de pierre artificielle et de ceramiques
EP1904534B1 (fr) Emulsions monomeres aqueuses contenant de l'hydrophobine
EP1941009A2 (fr) Utilisation de proteines en tant que composante antimousse dans des carburants
EP1893675B9 (fr) Hydrophobine utilisee en tant que substance de revetement pour des particules polymeres thermoplastiques expansibles ou expansees
WO2006128877A1 (fr) Procede de reduction de la vitesse d'evaporation de liquides
DE102005030786A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005026143A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005005737A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005051515A1 (de) Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
DE102005036341A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen
DE102005014844A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080107

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BASF SE

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20100831

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110111