EP1831374A1 - Mehrfachpromotoren und deren verwendung zur genexpression - Google Patents

Mehrfachpromotoren und deren verwendung zur genexpression

Info

Publication number
EP1831374A1
EP1831374A1 EP05850322A EP05850322A EP1831374A1 EP 1831374 A1 EP1831374 A1 EP 1831374A1 EP 05850322 A EP05850322 A EP 05850322A EP 05850322 A EP05850322 A EP 05850322A EP 1831374 A1 EP1831374 A1 EP 1831374A1
Authority
EP
European Patent Office
Prior art keywords
seq
protein
activity
nucleic acids
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05850322A
Other languages
English (en)
French (fr)
Inventor
Stefan Haefner
Hartwig Schröder
Oskar Zelder
Corinna Klopprogge
Andrea Herold
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=36052084&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP1831374(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by BASF SE filed Critical BASF SE
Priority to PL07123772T priority Critical patent/PL1908841T3/pl
Priority to DK07123772.1T priority patent/DK1908841T3/da
Priority to EP07123772A priority patent/EP1908841B1/de
Publication of EP1831374A1 publication Critical patent/EP1831374A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium

Definitions

  • the present invention relates to multiple promoters and expression units containing them; their use for the regulation of transcription and expression of genes; Expression cassettes comprising such multiple promoters or expression units; Vectors containing such expression cassettes; genetically modified microorganisms containing such vectors and / or expression units; and methods for producing biosynthetic products by culturing the genetically modified microorganisms.
  • biosynthetic products are made through natural metabolic processes in cells and are used in many industries, including the food, feed, cosmetics, feed, food and pharmaceutical industries.
  • These substances collectively referred to as fine chemicals / proteins, include, but are not limited to, organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatics, vitamins and cofactors, as well as proteins and enzymes .
  • Their production is most conveniently made on a large scale by growing bacterial strains or other microorganisms that have been developed to produce and secrete large quantities of the desired substance.
  • Particularly suitable organisms for this purpose are coryneform bacteria, gram-positive non-pathogenic bacteria.
  • amino acids can be produced by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of the great importance is constantly working to improve the manufacturing process. Process improvements may include fermentation measures, such as stirring and supply of oxygen, or the composition of the nutrient media, such as the sugar concentration during fermentation, or the processing of the product, for example by ion exchange chromatography but also spray-drying, or the intrinsic performance characteristics of the microorganism concern yourself. For several years, methods of recombinant DNA technology have also been used for strain improvement of fine chemical / protein-producing strains of Corynebacterium by amplifying individual genes and examining the effect on the production of fine chemicals / proteins.
  • RNA polymerase holoenzymes also called -35 and -10 regions
  • ribosomal 16S RNA also ribosomal binding site (RBS) or Shine-Dalgamo. Called sequence.
  • Nucleic acid sequences with promoter activity can affect the production of mRNA in different ways. Promoters whose activity is independent of the physiological growth phase of the organism are called constitutive. In turn, other promoters respond to external chemical and physical stimuli such as oxygen, metabolites, heat, pH, etc. Still others show a strong dependence of their activity at different stages of growth. For example, in the literature promoters are described which show a particularly pronounced activity during the exponential growth phase of microorganisms, or else exactly in the stationary phase of microbial growth. Both characteristics of promoters can have a favorable impact on productivity for production of fine chemicals and proteins, depending on the metabolic pathway.
  • regulated promoters may increase or decrease the rate at which a gene is transcribed, depending on the internal and / or external conditions of the cell.
  • the presence of a particular factor, known as an inducer can stimulate the rate of transcription from the promoter.
  • Inducers may directly or indirectly affect transcription from the promoter.
  • suppressors is capable of reducing or inhibiting transcription from the promoter. Like the inductors, the suppressors can act directly or indirectly.
  • promoters known that are regulated by temperature Thus, for example, the level of transcription of such promoters may be increased or decreased by increasing the growth temperature above the normal growth temperature of the cell.
  • promoters from C. glutamicum have been described to date.
  • the promoter of the malate synthase gene from C. glutamicum was described in DE-A-44 40 118. This promoter was preceded by a structural gene coding for a protein. After transformation of such a construct into a coryneform bacterium, the expression of the downstream of the promoter structural gene is regulated. The expression of the structural gene is induced as soon as a corresponding inducer is added to the medium.
  • the object of the invention was to provide further regulatory nucleic acid sequences, in particular promoter constructs and / or expression units with advantageous properties, for example increased or altered transcription activity and / or translational activity compared to the starting promoter.
  • n is an integer from 0 to 10;
  • a x and A y are the same or different and represent a chemical bond or a linker nucleic acid sequence;
  • Pi, P x and Py encode the same or different promoter sequences which comprise at least one RNA polymerase-binding region, such as the core region; and at least P y comprises a 3'-terminal sequence portion mediating ribosome binding.
  • a ribosome binding-mediating sequence section may independently of one another also have P 1 and single or all P x .
  • P 1 , P x and P y are derived from the same or different eukaryotic or, in particular, prokaryotic organisms. Also artificial promoters are useful.
  • P 1 , P x and P y are each derived from a contiguous sequence of 35 to 500 nucleotide residues, preferably 35 to 300 nucleotide residues, more preferably 35 to 210 nucleotide residues, and most particularly preferably 35 to 100 nucleotide residues, which in the genome of the organism 5'-upstream of the coding sequence for a protein, for example, for a participating in a biosynthesis pathway of the organism protein.
  • P 1 , P x and P y of the expression unit are derived from a coryneform bacterium.
  • P 1 , P x and P y of the expression unit are independently selected from promoter sequences for the coding sequence of a high abundance protein in a eukaryotic or prokaryotic organism, especially in an origenic bacterium, such as in one of the genus Corynebacterium or Brevibacterium such as a species or a strain as set out in Table 3.
  • promoter sequences may be selected from promoter sequences for the coding sequence of a protein listed in Table 1 and involved in the amino acid biosynthesis of an organism.
  • at least one of the promoters of the expression unit according to the invention should have high abundance as defined herein.
  • P 1 , P x and P y of the expression unit are independently selected from the nucleotide sequences shown in FIG. 1, or, as explained in more detail later, derived from SEQ ID NO: 1 (pGRO), SEQ ID NO: 2 (pEFTs), SEQ ID NO: 3 (pEFTu) and SEQ ID NO: 4 (pSOD).
  • P 1 , P x and P y of the expression unit are independently selected from strong, constitutive or regulatable promoters.
  • the present invention relates to an expression cassette comprising, in the 5'-3 'direction, a sequence module of the following general formula II:
  • G is at least one coding nucleic acid sequence which is operatively linked to the 5 'upstream regulatory sequence.
  • G is selected from a) nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, b) nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, c) nucleic acids encoding a protein from the biosynthetic pathway d) nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, e) nucleic acids encoding a protein from the biosynthetic pathway of diols, f) nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, g) nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, g) nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, g) nu
  • G is selected from nucleic acids for proteins from the biosynthesis pathway of amino acids selected from aspartate kinase, aspartate-semialdehyde dehydrogenase, diamino-imidate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde 3-phosphate
  • Dehydrogenase 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease, transketolase, Transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystathionine beta-lyase, serine hydroxymethyltransferase, O-acetylmoserine sulfhydrylase, methylene tetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine Acetyltransferase, homoserine dehydrogenase, homoserine kinase, threon
  • the present invention relates to a vector comprising at least one of the above-mentioned expression cassettes.
  • the present invention relates to a genetically modified microorganism transformed with at least one of the aforementioned vectors, or containing at least one of the above expression cassettes, preferably in integrated form.
  • the genetically modified organism is derived from coryneform bacteria.
  • the genetically modified organism is derived from bacteria of the genus Corynebacterium or Brevibacterium.
  • the present invention relates to a process for the preparation of a biosynthetic product, wherein one of the above-mentioned genetically modified microorganisms is cultivated and the desired product is isolated from the culture.
  • the biosynthetic product is selected from organic acids, proteins, nucleotides and nucleosides, both proteinogenic and non-proteinogenic amino acids, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, enzymes and proteins.
  • Very particularly preferred biosynthesis products are lysine, methionine, threonine and trehalose.
  • the present invention relates to the use of an expression unit according to the invention for regulating a product biosynthesis.
  • Figure 1 shows specific sequences for four promoters which were used to prepare the multiple promoters described in the embodiments. Shown are the promoter sequences for pEFTu ( Figure 1A); for promoter pGRO (FIG. 1B) 1 for promoter pEFTs (FIG. 1C) and for promoter pSOD (FIG. 1D). For each promoter, two sequences are indicated, the longer (upper sequence) indicates in each case the complete promoter sequence including Ribosomeitatisstelle (RBS), in bold and in italics printed. In the case of a 3'-terminal arrangement of the respective promoter in the multiple promoter construct according to the invention, the longer nucleotide sequence (including RBS) is preferably used in each case.
  • RBS Ribosomeitatisstelle
  • Promoter sequences 5'-upstream to the 3'-terminal promoter unit do not comprise RBS and were used in the respectively second position, truncated nucleic acid sequence (without RBS). 3'-terminal partial sequences of the shorter promoter sequences given in capital letters and bold letters may additionally be missing. Potential "- 10 regions" are underlined.
  • a “biosynthetic product” in the sense of the invention is understood to mean those which are produced in cells by way of natural metabolic processes (biosynthetic pathways) and are used in a variety of applications, in particular in the food, feed, cosmetics, feed, food and pharmaceutical industries.
  • These substances collectively referred to as fine chemicals / proteins, include, but are not limited to, organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatics, vitamins and cofactors, as well as proteins and enzymes ,
  • a “promoter”, a “nucleic acid with promoter activity” or a “promoter sequence” is understood according to the invention to mean a nucleic acid which, in functional linkage with a nucleic acid to be transcribed, regulates the transcription of this nucleic acid.
  • promoter Unless expressly referred to "single promoters", the term “promoter” according to the invention also includes the sequential, depending on the context Arrangement of more than one nucleic acid sequence (ie “multiple promoters”), each of which would be capable of regulating their transcription when operatively linked to a nucleic acid to be transcribed.
  • single promoter refers to a single nucleic acid sequence capable of regulating the transcription of a nucleic acid to be transcribed which, when operatively linked to a nucleic acid sequence to be transcribed, can transcribe it.
  • multiple promoters at least two identical or different nucleic acid sequences, each of which, when operatively linked to a nucleic acid to be transcribed, would be capable of regulating its transcription (individual promoters), are sequentially linked such that a transcription start of optionally one of the nucleic acid sequences.
  • a linker which has, for example, one or more restriction sites.
  • two individual promoters can also be linked directly to one another a ribosome binding site (RBS), in particular in the region of the 3'-terminal end of the promoter.
  • RBS ribosome binding site
  • Promoter sequences for the coding sequence of a "high A-bound" protein are understood to mean in particular "strong promoters". If one wishes to use multiple promoters to amplify genes, preferably those strong promoters are combined. Strong promoters regulate the transcription of genes such that the frequency of readings by the RNA polymerase is greater than in the majority of genes of the organism. In most cases, the presence of a strong promoter results in the presence of a large amount of transcript in the cell.
  • transcript When the transcript is larger in percentage relative to the other cellular transcripts, it is called an "abundant transcript.” In bacteria, the amount of transcript and the corresponding protein encoded in it usually correlate, ie, "abundant transcripts" usually also result. The following is an example of a method that allows the identification of "strong promoters" on the Abun- danz of proteins. Details on the methodological procedure as well as other references can be found eg in Proteomics in Practice - A Laboratory Manual of Proteome Analysis (authors: R. Westermeier, T. Naven, publisher: Wiley-VCH Verlag GmbH, 2002). The bacterial cells are disrupted and the proteins of the cell extract are separated by means of 2D gel electrophoresis.
  • the proteins stained by common methods such as Coomassie, silver or fluorescent dye staining. In this case, over-coloring of the proteins should be avoided in order to enable later quantification of the individual protein spots.
  • the gel is scanned and the image obtained is evaluated using a suitable software (eg Melanie, Amersham Biosciences).
  • a suitable software eg Melanie, Amersham Biosciences.
  • all detectable spots are identified and the spot volume determined. The sum of all spot volumes corresponds in the first approximation to the total protein.
  • the spots with particularly large spot volumes can then be selected. For example, spots with volumes occupying more than 0.1% of the total pot volume can be said to be abundant. Subsequently, spots with particularly abundant proteins are knocked out of the gel.
  • the protein present in the gel fragment is then digested proteolytically (for example with trypsin) and the molar mass of the resulting peptides is determined, for example with the aid of MALDI-ToF MS (matrix assisted laser desorption ionization time of flight mass spectrometry).
  • MALDI-ToF MS matrix assisted laser desorption ionization time of flight mass spectrometry
  • the promoters regulating this gene are usually located directly upstream of the start codon. Therefore, even the "strong” promoters are often located in a range of about 200 nucleotides upstream of the start codon of "abundant" proteins.
  • Articles within the meaning of the invention include in particular those sequences which have no transcriptional activity in situ, are transcriptionally active in another sequence context, in particular in the context of an expression unit or expression cassette according to the invention.
  • promoter activity is understood to mean the amount of RNA, that is to say the transcription rate, formed by the promoter in a specific time.
  • promoter activity is understood as meaning the amount of RNA per promoter formed in a specific time by the promoter.
  • RNA formed is thus changed in a certain time compared with the wild type.
  • a "functional” or “operative” linkage is understood to mean, for example, the sequential arrangement of one of the nucleic acids according to the invention with promoter activity and a nucleic acid sequence to be transcribed and, if appropriate, further regulatory elements, such as nucleic acid sequences, which facilitate the transcription of Ensuring nucleic acids, as well as, for example, a terminator such that each of the regulatory elements can fulfill its function in the transcription of the nucleic acid sequence.
  • Genetic control sequences such as enhancer sequences, may also exert their function on the target sequence from more distant locations or even from other DNA molecules.
  • the nucleic acid sequence to be transcribed is positioned behind (i.e., at the 3 'end) of the promoter sequence of the invention so that both sequences are covalently linked together.
  • the distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is preferably less than 200 base pairs, more preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.
  • ribosomal binding site or “ribosome binding site” (RBS) (or Shine-Dalgamo sequence) is understood to mean A / G-rich polynucleotide sequences located up to 30 bases upstream of the initiation codon of translation.
  • transcription refers to the process by which a complementary RNA molecule is produced starting from a DNA template, involving proteins such as RNA polymerase, so-called sigma factors and transcriptional regulator proteins synthesized RNA then serves as a template in the process of translation, which then leads to the biosynthetically active protein.
  • a “core region” of a promoter is understood according to the invention to mean a contiguous nucleic acid sequence of about 20 to 80, or 30 to 60 nucleotides, which comprises at least one potential so-called "-10-region". Examples of potential -10 regions are described for individual preferred promoter sequences herein; compare in particular FIG. 1. "-10 regions" are also referred to as TATA boxes or Pribnow-Schaller sequences. te at least one of these potential -10 regions, such. B. 1, 2, 3, 4 or 5, included.
  • the core region is 5'-upstream of the RBS and may be 1 to 200 or 10 to 150 or 20 to 100 nucleotide residues away from it.
  • an "expression unit” is understood as meaning a nucleic acid with expression activity which comprises a multiple promoter, as defined herein, and after functional linkage with a nucleic acid or gene to be expressed which regulates expression, ie transcription and translation, of this nucleic acid or gene
  • a nucleic acid with expression activity which comprises a multiple promoter, as defined herein, and after functional linkage with a nucleic acid or gene to be expressed which regulates expression, ie transcription and translation, of this nucleic acid or gene
  • regulatory elements e.g. Enhancers
  • an "expression cassette” is understood as meaning an expression unit which is functionally linked to the nucleic acid or gene to be expressed
  • an expression cassette thus comprises not only nucleic acid sequences which regulate transcription and translation, but also the nucleic acid sequences. which are to be expressed as protein as a consequence of transcription and translation.
  • expression activity is understood as meaning the amount of protein formed in a certain time by the expression cassette or its expression unit, ie the expression rate.
  • specific expression activity is understood as meaning the amount of protein per expression unit formed by the expression cassette or its expression unit in a specific time.
  • an "altered expression activity” or expression rate with respect to a gene compared to the wild type the amount of protein formed is thus changed in a specific time compared to the wild type.
  • “Altered” is understood in this connection to be preferably increased or decreased. This can be done, for example, by increasing or reducing the specific activity of the endogenous expression unit, for example by mutation, or by stimulation or inhibition.
  • the altered expression activity or rate of expression for example, by regulation of the expression of genes in the microorganism can be achieved by expression units according to the invention, wherein the genes are heterologous with respect to the expression units.
  • the "rate of formation" which produces a biosynthetically active protein is a product of the rate of transcription and translation Both rates can be influenced according to the invention and thus influence the rate of formation of products / fine chemicals in a microorganism.
  • wild type is understood according to the invention as the corresponding starting microorganism and does not necessarily correspond to a naturally occurring organism.
  • microorganism may be understood to mean the starting microorganism (wild type) or a genetically modified microorganism according to the invention, or both.
  • the term "wild-type” is used to change or cause the promoter activity or transcription rate, to alter or cause the expression activity or expression rate, and to increase the
  • this "reference organism” is Corynebacterium glutamicum ATCC 13032 or a microorganism derived by targeted or non-directional mutation of ATCC 13032.
  • starting microorganisms are used which are already able to produce the desired product (fine chemical / protein).
  • a "derived" sequence eg a derived promoter sequence, according to the invention, unless otherwise stated, is meant a sequence which has an identity of at least 80% or at least 90%, in particular 91%, 92%, 93% with the starting sequence. , 94%, 95%, 96%, 97%, 98% and 99%.
  • Identity between two nucleic acids is understood to mean the identity of the nucleotides over the entire nucleic acid length, in particular the identity which is determined by comparison with the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp Computing Appl. Biosci 1989 Apr; 5 (2): 151-1) is calculated by setting the following parameters: Multiple alignment parameters:
  • Pairwise alignment parameter FAST algorithm on K-tuple size 1 Gap penalty 3 Window size 5 Number of best diagonals 5
  • hybridizing is meant the ability of a poly or oligonucleotide to bind under stringent conditions to a nearly complementary sequence, while under these conditions nonspecific binding between non-complementary partners is avoided.
  • sequences should preferably be 90-100% complementary.
  • the property of complementary sequences to be able to specifically bind to one another for example, in the Northern or Southern Blot technique or in the primer binding in PCR or RT-PCR advantage.
  • hybridization takes place under stringent conditions
  • stringent conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, CoId Spring Harbor Laboratory Press , 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biolgy, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.
  • Stringent hybridization conditions are understood in particular to mean:
  • nucleic acid sequences having promoter activity are understood as meaning fragments having substantially the same or altered, lower or higher specific promoter activity as those Starting sequence.
  • substantially the same is meant a specific promoter activity that has at least 50%, such as at least 60%, 70%, 80%, 90%, or at least 95% of the specific promoter activity of the starting sequence.
  • the present invention relates, inter alia, to the provision of a multiple-promoter-containing expression unit comprising, in the 5'-3 'direction, a sequence module of the following general formula (I):
  • n is an integer value of 0 to 10, such as.
  • B is 1, 2, 3, 4, 5 or 6;
  • a x and Ay are identical or different and represent a chemical, in particular covalent, bond or a chemically, in particular covalently bound, linker nucleic acid sequence;
  • P 1 , P x and Py encode the same or different promoter sequences comprising at least one RNA polymerase-binding region, such as a core region; and at least, such as only, P y comprises a 3'-terminal sequence portion mediating ribosome binding.
  • the promoter sequences P 1 , P x and P y may be derived from genes from organisms encoding proteins involved in a biosynthetic pathway of the organism.
  • the promoter sequences are in the genome of the organism 20 to 500 nucleotide residues, or 20 to 300 nucleotide residues, for example 20 to 210 nucleotide residues and in particular 20 to 100 or 35 to 100 nucleotide residues 5'-upstream of the coding sequence of the respective protein.
  • promoter sequences P 1 , P x and P y are the genes listed in Table 1 below.
  • Nonlimiting examples of specific promoter sequences are derived from the nucleic acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, and Figure 1, but are not limited thereto.
  • SEQ ID NO: 1 corresponds to the sequence located upstream of the coding region of the GroES chaperonin (pGRO), SEQ ID NO: 2 of the sequence located upstream of the coding region of the protein elongation factor TS (pEFTs), SEQ ID NO.3 of the sequence upstream of the protein elongation factor TU coding region (pEFTu) and SEQ ID NO: 4 of the sequence upstream of the superoxide dismutase coding region (pSOD), each from Corynebacterium glutamicum , SEQ. ID. NO. 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 correspond to the wild-type promoter sequences.
  • a "derived" sequence according to the invention is understood as meaning a sequence which has an identity of at least 80% or at least 90% with the starting sequence, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% % and in particular 99%
  • This degree of identity applies in particular to the above-defined "core region" of the respective promoter. Outside the respective core region, the degree of identity may be lower, and in the range of 0 to 80%, such as 0 to 80%. 10 to 80%, 20 to 70%, 30 to 60% or 40 to 50%.
  • Useful core regions are e.g. for pGRO in the range of positions 50 to 80 of SEQ ID NO: 1; for pEFTs ranging from position 130 to 170 of SEQ ID NO: 2; For pEFTu in the range of positions 30 to 110 of SEQ ID NO: 3; for pSOD in the range of positions 50 to 100 of SEQ ID NO: 4.
  • the expression units according to the invention contain in particular two or more nucleic acid sequences with promoter activity, a) preferably derived from identical or different sequences, selected from SEQ. ID. NO. 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; or other promoter sequences for genes of comparable or higher abundance; b) optionally one or more of these sequences representing a sequence derived by substitution, insertion, inversion or deletion or addition of nucleotides, in particular in the core region, having an identity of at least 80% at the nucleic acid level, preferably under the sequence SEQ ID NO: 1, C) or where optionally one or more of these nucleic acid sequences hybridizes with a sequence under stringent conditions which corresponds to one of the nucleic acid sequences according to SEQ ID NO: 1, 2, 3 or 4 or other promoter sequences for genes with comparable or higher abundance 2, 3 or 4 and or to other promoter sequences for genes of comparable or higher abundance is complementary, d) or optionally one or more of these nucle
  • promoters which are useful as a constituent of a multiple promoter according to the invention can be prepared, for example, from various organisms whose genomic sequence is known by identity comparisons of the nucleic acid sequences from databases with the sequences SEQ ID NO: 1, 2, 3 or 4 described above or easily find in accordance with Figure 1 or other promoter sequences for genes with comparable or higher abundance.
  • suitable natural promoters can be prepared starting from the above-described nucleic acid sequences, in particular starting from sequence SEQ ID NO: 1, 2, 3 or 4 and / or promoter sequences for genes with comparable or higher abundance from different organisms whose genomic sequence is not known. easily find by using hybridization techniques in a manner known per se.
  • the invention therefore also includes the combination of such promoters, which are not listed here by name. This also applies to the combination of already known single promoters, as e.g. in (Patek et al (2003), J of Biotechnology 104, 311-323, Vasicova et al (1999) J. Bacteriol 181, 6188-6191).
  • a further subject of the invention therefore relates to nucleic acids with promoter activity for incorporation into a multiple-promoter-containing expression unit according to the invention, wherein the nucleic acids with promoter activity comprise a nucleic acid sequence which corresponds to the nucleic acid sequence SEQ ID NO: 1, 2, 3 or 4 or promoter sequences for Genes with comparable or higher abundance hybridized under stringent conditions.
  • This nucleic acid sequence comprises at least 10, preferably more than 12, 15, 30, 50 or more than 150 nucleotides.
  • Artificial promoter sequences for incorporation into a multiple engine-containing expression unit according to the invention can be obtained starting from the sequence SEQ ID NO: 1, 2, 3 or 4 or according to FIG.
  • Suitable ribosome binding mediating 3'-terminal sequence sections of a promoter sequence P y are, for example, the RBS of pGRO: GGAGGGA; the RBS of pEFTs: AGGAGGA; the RBS of pEFTu: AGGAGGA; as well as the RBS of pSOD: GGAGGGA (see also accompanying Figure 1).
  • the theoretically optimal RBS ie the sequence 100% complementary to the anti-Shine-Dalgarno sequence on the 16S rRNA of C. glutamicum is: 5 'GAAAGGAGG 3'.
  • Further suitable RBS sequence segments can be prepared, for example, by artificial variation and mutation, for example by substitution, insertion, inversion, addition or deletion of nucleotides, or can easily be found in databases via homology comparisons with promoter sequences.
  • Nonlimiting examples of multiple promoter-containing expression units of the invention are selected from: e) sequences encoding PeftuPsod from position 18 to 390 in SEQ ID NO: 45;
  • PgroPsodPefts from position 11 to 538 in SEQ ID NO: 59;
  • PeftuPsod Pefts from position 11 to 559 in SEQ ID NO: 60; or f) sequences derived according to e) by substitution, insertion, inversion, addition or deletion of nucleotides, which has an identity of at least 80% or at least 90% at nucleic acid level in comparison with this starting sequence; or g) nucleic acid sequences which hybridize with a sequence to be e) complementary under stringent conditions; or h) "functionally equivalent fragments" of the abovementioned sequences e), f) and g).
  • a "functionally equivalent fragment", in particular according to embodiments d) and h), expression units, fragments are understood to have substantially the same or a higher specific expression activity as the starting sequence.
  • substantially the same is meant a specific expression activity which has at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, most preferably 95% of the specific expression activity of the starting sequence.
  • fragments are understood as meaning partial sequences of the sequences described by embodiments a) to h). Preferably, these fragments have more than 10, more preferably more than 12, 15, 30, 50 or more preferably more than 150 contiguous nucleotides of the starting sequence.
  • the expression units of the invention may preferably comprise one or more of the following genetic elements: a -10 region; a transcription start, an enhancer region; and an operator region.
  • these genetic elements are specific for the species Corynebacterium, especially for Corynebacterium glutamicum.
  • Bacterial promoters usually consist of three RNA polymerase recognition sites, namely the -10 region, the -35 region and the UP element.
  • TGNGNTA C / T AATGG or GNTANAATNG are described hereinbefore (Patek et al (2003), J. of Biotechnology 104, 311-323, Vasicova et al.
  • the invention further relates to the multiple promoter-containing expression units of the invention, operably linked to a translatable nucleic acid sequence.
  • These constructs capable of expressing genes are also referred to as expression cassettes in the context of the invention.
  • a "functional linkage” is understood as meaning, for example, the sequential arrangement of one of the expression units according to the invention and a nucleic acid sequence to be expressed transgenically and, if appropriate, further regulatory elements, such as a terminator, such that each of the regulatory elements has a function
  • Genetic control sequences such as enhancer sequences, can also exert their function on more distant sites or even on other DNA molecules on the target sequence Arrangements are preferred in which the nucleic acid sequence to be transgenically expressed is positioned behind (ie at the 3 'end) of the expression unit sequence according to the invention, so that both sequences are covalently linked to one another the expression unit sequence and the nucleic acid sequence to be expressed transgene less than 200 base pairs, more preferably less than 100 base pairs, most preferably less than 50 base pairs.
  • the expression cassettes according to the invention containing multiple promoters offer the possibility of achieving a different expression activity than the original expression activity and thus of fine-tuning the expression of the desired gene.
  • the regulation of the expression of genes in the microorganism by expression units of the invention is achieved by
  • nucleic acid constructs containing an expression unit according to the invention optionally with altered specific expression activity, and functionally linked to one or more nucleic acids to be expressed, ie introduces an expression cassette in the microorganism.
  • the physical position of the expression unit relative to the gene to be expressed is selected so that the expression unit regulates the transcription and preferably also the translation of the gene to be expressed and thus allows the formation of one or more proteins.
  • the "enabling education” involves constitutively increasing the formation, weakening or blocking the formation under specific conditions and / or increasing the formation under specific conditions.
  • the “conditions” include: (1) adding a component to the culture medium, (2) removing a component from the culture medium, (3) replacing a component in the culture medium with a second component, (4) increasing the temperature of the culture medium, (5) Lowering the temperature of the culture medium, and (6) regulating the atmospheric conditions, such as the oxygen or nitrogen concentration, in which the culture medium is maintained.
  • nucleic acids with promoter activity and expression units and expression cassettes can furthermore be produced in a manner known per se by chemical synthesis from the nucleotide units, for example by fragment condensation, of individual overlapping, complementary nucleic acid units of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner by the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, p. 896-897).
  • the attachment of synthetic OM gonucleotides and filling in of gaps using the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Col. Spring Harbor Laboratory Press.
  • nucleic acid molecules of the present invention are preferably in the form of an isolated nucleic acid molecule.
  • An "isolated" nucleic acid molecule is separated from other nucleic acid molecules present in the natural source of the nucleic acid and, moreover, may be substantially free of other cellular material or culture medium when produced by recombinant techniques, or free from chemical precursors or other chemicals if it is synthesized chemically.
  • the invention further comprises the nucleic acid molecules complementary to the specifically described nucleotide sequences or a portion thereof.
  • the nucleotide sequences of the invention also allow the generation of probes and primers useful for the identification and / or cloning of homologous sequences in other cell types and microorganisms.
  • probes or primers usually comprise a nucleotide sequence region which, under stringent conditions, is at least about 12, preferably at least about 25, e.g. about 40, 50 or 75 consecutive nucleotides of a sense strand of a nucleic acid sequence of the invention or a corresponding antisense strand hybridizes.
  • nucleic acid sequences which comprise so-called silent mutations or are altered according to the codon usage of a specific source or host organism, in comparison with a specifically mentioned sequence, as well as naturally occurring variants, such as e.g. Splice variants or allelic variants, of which
  • the invention further relates to expression vectors containing an expression cassette according to the invention described above.
  • Vectors are well known to those skilled in the art and may be inferred, for example, from "Cloning Vectors" (Pouwels PH et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • Vectors other than plasmids are also to be understood as meaning all other vectors known to the person skilled in the art, such as, for example, phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be autonomously replicated in the host organism or replicated chromosomally.
  • Particularly suitable plasmids are those which are replicated in coryneform bacteria.
  • Numerous known plasmid vectors such as PZKE (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExi (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al. Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1.
  • Other plasmid vectors such as.
  • PCLiK5MCS see Example 1
  • those based on pCG4 US-A 4,489,160
  • pNG2 Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)
  • pAG1 US-A 5,158,891
  • those plasmid vectors by means of which one can apply the method of gene amplification by integration into the chromosome, as described for example by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for duplication or amplification of the hom-thrB operon.
  • the complete gene is cloned into a plasmid vector which can replicate in a host (typically E. coli) but not in C. glutamicum.
  • vectors which are used are pSUP301 (Simon et al., Bio / Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schäfer et al., Gene 145, 69-73 (1994)), Bernard et al., Journal of Molecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al., 1991, Journal of Bacteriology 173: 4510-4516) or pBGS ⁇ (Spratt et al., 1986, Gene 41: 337-342) , The plasmid vector containing the gene to be amplified is then transformed into the desired strain of C. glutamicum by transformation.
  • the change or causation of the transcription rate and / or the translation rate of genes in microorganisms in comparison to the wild type can be carried out by transcribing genes in the microorganism by means of the invention Regulates expression units, wherein the genes are heterologous with respect to the expression units.
  • nucleic acids according to the invention with promoter activity in the genome of the microorganism, so that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity, optionally with altered specific promoter actor activity occurs, or
  • the insertion can be such that the gene or genes integrated into coding or non-coding regions will be.
  • the insertion takes place in non-coding regions.
  • the insertion of nucleic acid constructs can be carried out chromosomally or extrachromosomally.
  • the insertion of the nucleic acid constructs is chromosomal.
  • a "chromosomal" integration is the insertion of a DNA fragment into the chromosome of a host cell.
  • endogenous is meant genetic information, such as genes, already included in the wild-type genome (as defined above).
  • exogenous is meant genetic information such as genes that are not included in the wild-type genome. If exogenous genetic information, such as the multiple promoter-containing expression units of the present invention, is introduced into the genome of a wild-type strain, thereby producing a genetically altered strain this genetic information is endogenous in comparison to the first generated genetic strain with its offspring, but exogenous compared to the original wild-type strain which did not contain this genetic information.
  • genes with regard to regulation of transcription by the nucleic acids according to the invention with promoter activity are preferably nucleic acids. understood that a region to be transcribed, so for example, a region which regulates the translation, a coding region, and optionally further regulatory elements, such as a terminator included.
  • genes with regard to the regulation of the expression by the expression units according to the invention are preferably understood as meaning nucleic acids which contain a coding region and optionally further regulatory elements, such as, for example, a terminator.
  • coding region is meant a nucleic acid sequence encoding a protein.
  • heterologous in reference to nucleic acids with promoter activity and genes is meant that the genes used in the wild type are not transcribed under regulation of the nucleic acids according to the invention having promoter activity, but that a new, non-wild-type functional linkage is formed and the functional combination from nucleic acid according to the invention with promoter activity and specific gene does not occur in the wild type.
  • heterologous in terms of expression units and genes is meant that the genes used are not expressed in the wild-type under the regulation of expression units of the invention, but a new, not occurring in the wild type functional linkage and the functional combination of inventive expression unit and specific gene does not occur in wild type.
  • the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of fine chemicals, which genes may optionally contain further regulatory elements.
  • the genes are selected from:
  • Nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, encoding nucleic acids tein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthesis pathway of vitamins, Nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, nucleic acids encoding a protein from the central metabolism, where
  • the proteins are selected from the biosynthetic pathway of amino acids, namely:
  • Dehydrogenase diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease, transketolase, transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystahionine beta-lyase, serine hydroxymethyltransferase, Acetyl homoserine sulfhydrylase, methylene
  • Tetrahydrofolate reductase Tetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine
  • Preferred proteins and nucleic acids encoding these proteins are protein sequences or nucleic acid sequences of microbial origin, preferably from bacteria of the genus Corynebacterium or Brevibacterium, preferably from coryneform bacteria, more preferably from Corynebacterium glutamicum.
  • the target gene G to be regulated according to the invention is preferably selected.
  • proteins from the biosynthetic pathway of amino acids have in each case the amino acid sequence given in Table 1 for this protein, the respective protein each having on at least one of the amino acid positions given in Table 2, column 2 for this amino acid sequence a different proteinogenic amino acid than the respective amino acid given in Table 2, column 3 in the same line.
  • the proteins have the amino acid indicated in Table 2, column 4 in the same line on at least one of the amino acid position indicated in Table 2, column 2 for the amino acid sequence.
  • the proteins given in Table 2 are mutated proteins of the biosynthetic pathway of amino acids which have particularly advantageous properties and are therefore particularly suitable for expression of the corresponding nucleic acids by a promoter construct according to the invention and for the production of amino acids.
  • the T311 I mutation results in switching off feedback inhibition from ask.
  • nucleic acids encoding a mutant protein of Table 2 described above can be prepared by conventional methods.
  • the starting point for the preparation of the nucleic acid sequences encoding a mutated protein is, for example, the genome of a Corynebacterium glutamicum
  • the selection of integrated expression cassettes is preferably carried out by the SacB method.
  • SacB method is known to the person skilled in the art and is described, for example, in Schfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A .; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosomes of Corynebacterium glutamicum, Gene.
  • the invention therefore also relates to a genetically modified microorganism which contains an expression cassette according to the invention or a vector comprising the expression cassette according to the invention.
  • the present invention particularly preferably relates to genetically modified microorganisms, in particular coryneform bacteria, which contain a vector, in particular pen delvector or plasmid vector, which carries at least one expression cassette according to the invention.
  • Preferred microorganisms or genetically modified microorganisms are bacteria, algae, fungi or yeasts.
  • Particularly preferred microorganisms are especially coryneform bacteria.
  • Preferred coryneform bacteria are bacteria of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium efficiens or of the genus Brevibacterium, in particular of the species Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum.
  • Particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are selected from the group Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens DSM 44547, Corynebacterium efficiens DSM 44548.
  • the abbreviation KFCC means the Korean Federation of Culture Collection, with the abbreviation ATCC the American type strain culture collection, with the abbreviation DSM (or DSMZ) the German Collection of Microorganisms (German Collection of Microorganisms and Cell Cultures). Further particularly preferred bacteria of the genera Corynebacterium and Brevifobacterium are listed in Table 3:
  • DSMZ German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany
  • microorganisms of the bacteria of the genus Corynebacterium in particular those which are already able to produce L-lysine, L-methionine and / or L-threonine.
  • corynebacteria in which, for example, the gene coding for an aspartate kinase (ask gene) is deregulated or the feedback inhibition is abolished or reduced.
  • such bacteria in the ask gene have a mutation that leads to a reduction or abolition of the feedback inhibition, such as the mutation T311 I.
  • the expression units according to the invention make it possible to regulate the metabolic pathways to specific biosynthetic products in the above-described genetically modified microorganisms according to the invention.
  • metabolic pathways that lead to a specific biosynthetic see product by causing or increasing the transcription rate or expression rate of genes of this biosynthetic pathway in which the increased amount of protein to increased total activity of these proteins of the desired biosynthetic pathway and thus to an increased metabolic flux the desired biosynthetic product.
  • metabolic pathways leading away from a specific biosynthetic product can be attenuated by reducing the transcription rate of genes of this pathway by reducing the amount of protein involved in reduced total activity of these proteins of the undesired biosynthetic pathway and thus in addition to increased metabolic flux the desired biosynthetic product.
  • the genetically modified microorganisms according to the invention are, for example, able to produce biosynthetic products from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol.
  • the invention therefore relates to a process for the production of biosynthetic products by culturing genetically modified microorganisms according to the invention.
  • the transcription rate or expression rate of various genes must be increased or reduced.
  • At least one altered, that is to say increased or reduced, transcription rate or expression rate of a gene can be attributed to a nucleic acid according to the invention having a promoter activity or an expression unit according to the invention.
  • additional modified i. additionally increased or additionally reduced transcription rates or expression rates of further genes in the genetically modified microorganism can, but need not go back to the nucleic acids according to the invention with promoter activity or the expression units of the invention.
  • the invention therefore further relates to a process for the preparation of biosynthetic see products by culturing genetically modified microorganisms according to the invention.
  • the multi-promoter-containing expression units, expression cassettes and vectors according to the invention can be used particularly advantageously, for example, in improved processes for the fermentative production of biosynthetic products as described below.
  • the multiple promoter-containing expression units or expression cassettes according to the invention have the particular advantage that they allow a modulation of the expression of the functionally linked structural gene.
  • the expression units according to the invention or expression cassettes comprising them can be used for altering, ie increasing or reducing, or causing the expression rate of genes in microorganisms in comparison to the wild type. This provides the possibility of maximizing the expression of the gene in question in the event of an increase in the expression rate.
  • the expression can also take place in a starch which is below the maximum value obtainable by another expression unit, but at the same time supplies the expression product in an amount which is more compatible with the expressing microorganism.
  • the expression units according to the invention thus make it possible, by selection among expression units each having different expression levels, to fine-tune the expression to a value which is optimized, in particular in the case of long-term expression.
  • expression units or expression units according to the invention can be used to regulate and enhance the formation of different biosynthetic products, such as, for example, fine chemicals, proteins, in particular amino acids, in microorganisms, in particular in Corynebacterium species.
  • the invention therefore relates to the use of a multiple-engine-containing expression unit according to the invention for regulating a product biosynthesis.
  • the gene of a protein involved in the regulation of a product biosynthesis is placed under the control of such an expression unit.
  • Product biosynthesis is affected depending on the transcription rate of the selected multiple promoter-containing expression unit.
  • the gene of a protein involved in the regulation of a product biosynthesis can be expressed as part of an expression cassette according to the invention in a microorganism and the regulation of the product biosynthesis by the protein expressed thereby. If the activity of a multiple promoter is weaker than that of the endogenous promoter, a multiple promoter can also be used to selectively attenuate unwanted biosynthetic pathways.
  • the regulation of the transcription rate of an expression unit according to the invention containing multiple promoters can be effected by targeted mutation of one or more individual promoters from which the multiple promoter is composed. Increased or decreased promoter activity can be achieved by using nucleotides in the binding site of the RNA polymerase holoenzyme. Binding sites (also known as the -10 region and -35 region) are exchanged. Furthermore, an influencing can take place in that the distance of the described RNA polymerase holoenzyme binding sites from each other is reduced or increased by deletions of nucleotides or insertions of nucleotides.
  • binding sites also known to the person skilled in the art as exciters
  • regulatory proteins known to the person skilled in the art as repressors and activators
  • binding sites are brought into spatial proximity to the binding sites of the RNA polymerase holoenzyme such that these regulators, after binding to a promoter Sequence attenuate or enhance the binding and transcriptional activity of the RNA polymerase holoenzyme, or under a new regulatory influence.
  • the translation activity can also be influenced by mutation of the ribosomal binding mediating, 3'-terminal sequence section of a single promoter Py within the multiple promoter-containing expression unit according to the invention.
  • Preferred biosynthetic products prepared according to the invention are fine chemicals.
  • fine chemical is well known to those skilled in the art and includes compounds produced by an organism that find applications in various industries such as, but not limited to, the pharmaceutical, agricultural, cosmetics, food and feed industries , These compounds include organic acids such as lactic acid, succinic acid, tartaric acid, itaconic acid and diaminopimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides and nucleotides (as described, for example, in Kuninaka, A. (1996) Nucleotides and 6, Rehm et al., ed.
  • organic acids such as lactic acid, succinic acid, tartaric acid, itaconic acid and diaminopimelic acid
  • proteinogenic and non-proteinogenic amino acids purine and pyrimidine bases
  • nucleosides and nucleotides as described, for example, in Kuninaka, A. (1996) Nucleotides and 6, Rehm et al., ed.
  • VCH Weinheim and the citations contained therein
  • lipids saturated and unsaturated fatty acids (eg arachidonic acid), diols (eg. Propanediol and butanediol), carbohydrates (for example hyaluronic acid and trehalose), aromatic compounds (for example aromatic amines, vanillin and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, A27, "Vitamins", Vol. Pp. 443-613 (1996) VCH: Weinheim and the citations therein; and Ong, AS, Niki, E. and Packer, L.
  • biosynthetic products are selected from the group of organic acids, proteins, nucleotides and nucleosides, both proteinogenic and non-proteinogenic amino acids, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, enzymes and proteins.
  • Preferred organic acids are lactic acid, succinic acid, tartaric acid, itaconic acid and diaminopimelic acid.
  • nucleosides and nucleotides are described, for example, in Kuninaka, A. (1996) Nucleotides and Related Compounds, pp. 561-612, Biotechnology Vol. 6, Rehm et al., Ed. VCH: Weinheim and the citations contained therein.
  • Preferred biosynthetic products are also lipids, saturated and unsaturated fatty acids such as arachidonic acid, diols such as propanediol and butanediol, carbohydrates such as hyaluronic acid and trehalose, aromatic compounds such as aromatic amines, vanillin and indigo, vitamins and cofactors as described, for example in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the citations contained therein; and Ong, AS, Niki, E. and Packer, L.
  • biosynthetic products are amino acids, more preferably essential amino acids, in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid, L Serine, L-proline, L-valine, L-isoleucine, L-cysteine, L-tyrosine, L-histidine, L-arginine, L-asparagine, L-aspartic acid and L-threonine, L-homoserine, in particular L- Lysine, L-methionine and L-threonine.
  • essential amino acids in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid, L Serine, L-proline, L
  • an amino acid such as lysine, methionine and threonine
  • both the L and the D form of the amino acid preferably the L-form, that is, for example, L-lysine, L-methionine and L-threonine understood.
  • the lysine, methionine and threonine production which are particularly preferred, are described in more detail.
  • the invention relates to a process for the production of lysine by culturing genetically modified microorganisms with an increased or induced expression rate of at least one gene compared to the wild type, wherein
  • the expression of at least one gene in the microorganism is caused or changed by introduction of an expression cassette according to the invention comprising the gene into the microorganism.
  • the genes are in particular selected from nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a diaminopimelate dehydrogenase, nucleic acids encoding a diaminopimelate decarboxylase, nucleic acids encoding a dihydrodipicolinate synthetase, nucleic acids encoding a dihydridipicolinate -Reductase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a transcriptional regulator LuxR, nucleic acids encoding a transcriptional cell Regulator
  • a further preferred embodiment of the process for the preparation of lysine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from: aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, Diaminopilate dehydrogenase activity, diaminopimelate decarboxylase activity, dihydrodipicolinate synthetase activity, dihydridipicolinate reductase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, Triosephosphate isomerase activity, transcriptional regulator activity LuxR, transcriptional regulator activity LysR1, transcriptional regulator activity LysR2, malate-quinone-oxo-reductase activity, glucose-6-phosphate de-dehydrogenase activity, 6-phosphogluconate dehydrognea
  • a further particularly preferred embodiment of the process for the preparation of lysine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, O-acetyl homoserine sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, homoserine kinase activity, homoserine dehydrogenase activity, threonine exporter activity, threonine efflux protein Activity, asparaginase activity, aspartate decarboxylase activity and threonine synthase activity.
  • the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acet
  • the invention further relates to a method for the production of methionine by culturing genetically modified microorganisms with increased or caused expression rate of at least one gene compared to the wild type, wherein
  • the expression of at least one gene in the microorganism is caused or changed by introduction of an expression cassette according to the invention into the microorganism.
  • the genes are in particular selected from nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a homoserine dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase , Nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine O-acetyltransferase, nucleic acids encoding a cystahionin gamma synthase, nucleic acids encoding a cystahionine beta-lyase, nucleic acids encoding a serine hydroxymethyltransferase, nucleic acids encoding an
  • Nucleic acids encoding a 6-phosphogluconate dehydrogenase, glucose phosphate isomerase, phosphoglycerate mutase, enolase, pyruvate kinase, aspartate transaminase or malate enzyme are included in Nucleic acids encoding a 6-phosphogluconate dehydrogenase, glucose phosphate isomerase, phosphoglycerate mutase, enolase, pyruvate kinase, aspartate transaminase or malate enzyme.
  • a further preferred embodiment of the method for the production of methionine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity , Homoserine dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, homoserine O-acetyltransferase activity, cystahionin-gamma synthase activity, cystahionine beta Lyase Activity Serine hydroxymethyltransferase activity, O-acetyl homoserine sulfhydrylase activity, methylene tetrahydrofolate reductase activity, phosphoserine aminotransferase activity
  • a further particularly preferred embodiment of the method for the production of methionine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the homoserine kinase activity, threonine dehydratase activity , Threonine synthase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthase activity, dihydrodipicolinate reductase activity, and diaminopicolinate decarboxylase activity.
  • the invention further relates to a process for the production of threonine by culturing genetically modified microorganisms with increased or induced expression rate of at least one gene compared to the wild type, wherein
  • the genes are in particular selected from nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine kinase, nucleic acids encoding a threonine synthase, nucleic acids encoding a threonine exporter carrier, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a transaldolase, nucleic acids encoding a transketolase, nucleic acids encoding a malate Quinone
  • a further preferred embodiment of the method for the production of threonine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from the group:
  • Aspartate kinase activity Aspartate kinase activity, aspartate semialdehyde dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, threonine synthase activity, threonine activity Export carriers, transaldolase activity, transketolase activity, glucose-6-phosphate dehydrogenase activity, malate-quinone
  • a further particularly preferred embodiment of the method for producing threonine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-Acetyltransferase- Activity, serine hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthetase activity, dihydrodipolinate reductase activity, asparaginase Activity, aspartate decarboxylase activity, lysine exporter activity, acetolactate synthase activity, ketol-A reductoisomerase activity, branched chain aminotransferase activity, coen
  • activity of a protein is understood as meaning the enzyme activity of the corresponding protein in the case of enzymes, and the physiological activity of the proteins in the case of other proteins, such as, for example, structure or transport proteins.
  • the enzymes are usually able to convert a substrate into a product or to catalyze this conversion step. Accordingly, the "activity" of an enzyme is understood to mean the amount of substrate or amount of product converted by the enzyme in a certain time.
  • the amount of substrate or the amount of product formed is thus increased by the enzyme compared to the wild type in a certain time.
  • this increase in “activity” is at least 1 to 5%, such as at least 20%, at least 50%, at least 100%, at least 300%, or at least 500%, or at least 600% of the " Activity of the wild-type ".
  • the amount of substrate or the amount of product formed is thus reduced by the enzyme compared to the wild type in a certain time.
  • Reduced activity is preferably understood to mean the partial or substantially complete suppression or blocking of the functionality of this enzyme in a microorganism, based on different cell biological mechanisms.
  • Reduction of activity includes a reduction in the amount of an enzyme, to a substantially complete absence of the enzyme (i.e., lack of detectability of the corresponding activity or lack of immunological detectability of the enzyme).
  • the activity in the microorganism is reduced by at least 5% as compared to the wild type, such as at least 20%, at least 50%, or by about 100%.
  • “reduction” also means the complete absence of the corresponding activity.
  • the activity of certain enzymes in genetically modified microorganisms and in the wild type and thus the increase or reduction of the enzyme activity can be determined by known methods, such as enzyme assays.
  • An additional increase of activities can take place in various ways, for example by switching off inhibitory regulation mechanisms on the expression and protein level or by increasing the gene expression of nucleic acids encoding the proteins described above in comparison to the wild type.
  • Increasing the gene expression of the nucleic acids encoding the proteins described above with respect to the wild type can also be done in various ways, for example by inducing the gene by activators or as described above by increasing the promoter activity or increasing the expression activity or by introducing one or more gene copies in the microorganism.
  • the manipulation of the expression of the microorganism itself is also affected. understood endogenous proteins. This can be achieved, for example, as described above by changing the promoter sequences of the genes, introducing expression unit according to the invention for regulatory control of the genes and altering the incorporated expression units according to the invention. Such a change, which results in an increased expression rate of the gene, can be done for example by deletion or insertion of DNA sequences.
  • the person skilled in the art can take further different measures individually or in combination.
  • the copy number of the respective genes can be increased, or the promoter and regulatory region or ribosome binding site located upstream of the structural gene can be mutated.
  • inducible promoters it is additionally possible to increase the expression in the course of fermentative production. Measures to extend the lifetime of mRNA also improve expression.
  • enzyme activity is also enhanced.
  • the genes or gene constructs may either be present in different copy number plasmids or be integrated and amplified in the chromosome. Alternatively, overexpression of the genes in question can be achieved by changing the composition of the medium and culture.
  • biosynthetic products in particular L-lysine, L-methionine and L-threonine
  • L-lysine in particular L-lysine
  • L-methionine in particular L-methionine
  • L-threonine to eliminate unwanted side reactions in addition to the expression or amplification of a gene
  • the gene expression of a nucleic acid encoding one of the proteins described above is increased by introducing at least one nucleic acid encoding a corresponding protein into the microorganism.
  • the introduction of the nucleic acid can be chromosomal or extrachromosomal, ie by increasing the copy number on the chromosome and or a copy of the gene on a replicating plasmid in the Western microorganism.
  • nucleic acid for example in the form of an expression cassette according to the invention containing the nucleic acid, preferably takes place chromosomally, in particular by the SacB method described above.
  • SacB method any gene which codes for one of the proteins described above can be used for this purpose.
  • genomic nucleic acid sequences from eukaryotic sources containing introns in the event that the host microorganism is unable or unable to express the corresponding proteins, preferably already processed nucleic acid sequences, such as the corresponding cDNAs to use.
  • the reduction of the above-described activities in microorganisms is carried out by at least one of the following processes:
  • knockout mutants can be generated by targeted insertion into the desired target gene by homologous recombination or introduction of sequence-specific nucleases against the target gene.
  • RNA sense RNA
  • Each of these methods can cause a reduction in the amount of protein, mRNA amount and / or activity of a protein. Even a combined application is conceivable.
  • Other methods are known to those of skill in the art and may include inhibiting or inhibiting processing of the protein, transport of the protein or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an RNA degrading enzyme and / or inhibition of translation elongation or termination ,
  • the step of cultivating the genetically modified microorganisms is preferably followed by isolating biosynthetic products from the microorganisms or from the fermentation broth. These steps may take place simultaneously and / or preferably after the culturing step.
  • the genetically modified microorganisms according to the invention can be used continuously or batchwise in the batch process or in the fed batch process or repeated fed batch process for the production of biosynthetic products, in particular L-lysine, L-methionine and L- Threonine, to be cultured.
  • biosynthetic products in particular L-lysine, L-methionine and L- Threonine, to be cultured.
  • a summary of known cultivation methods is in the textbook of Chemiel (bioprocess 1. Introduction to bioprocess engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook of Storhas (bioreactors and peripheral facilities (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)) Find.
  • the culture medium to be used must suitably satisfy the requirements of the respective strains. Descriptions of culture media of various microorganisms are contained in the Manual of Methods for General Bacteriology of the American Society of Bacteriology (Washington D.C. 1 USA, 1981).
  • These media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.
  • Preferred carbon sources are sugars, such as mono-, di- or polysaccharides.
  • Very good sources of carbon are, for example, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose.
  • Sugar can also be added to the media via complex compounds such as molasses or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources.
  • Other possible sources of carbon are oils and fats such.
  • Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds.
  • Exemplary nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soybean meal, soy protein, yeast extract, meat extract and others.
  • the nitrogen sources can be used singly or as a mixture.
  • Inorganic salt compounds which may be included in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron
  • inorganic compounds such as, for example, sulfates, sulfites, dithionites, Tetrathionates, thiosulfates, sulfides but also organic sulfur compounds, such as mercaptans and thiols can be used.
  • Phosphoric acid potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the phosphorus source.
  • Chelating agents can be added to the medium to keep the metal ions in solution.
  • Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.
  • the fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine.
  • growth factors and salts are often derived from complex media components, such as yeast extract, molasses, corn steep liquor, and the like.
  • suitable precursors can be added to the culture medium.
  • the exact composition of the media compounds will depend heavily on the particular experiment and will be decided on a case by case basis. Information on the media optimization is available from the textbook "Applied Microbiol Physiology, A Practical Approach” (ed. P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3).
  • Growth media may also be obtained from commercial suppliers, such as standard 1 (Merck) or BHI (Brain Heart Infusion, DIFCO) and the like.
  • All media components are sterilized either by heat (20 min at 1, 5 bar and 121 0 C) or by sterile filtration.
  • the components can either be sterilized together or, if necessary, sterilized separately. All media components may be present at the beginning of the culture or added randomly or in batches as desired.
  • the temperature of the culture is usually between 15 ° C and 45 ° C, preferably at 25 ° C to 40 0 C and can be kept constant or changed during the experiment.
  • the pH of the medium should be in the range of 5 to 8.5, preferably around 7.0.
  • the pH for cultivation can be controlled during cultivation by addition of basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid.
  • foam anti-foaming agents such as.
  • As fatty acid polyglycol are used.
  • suitable selective substances such as e.g. B. Antibiotics, to be added.
  • oxygen or oxygen-containing gas mixtures such as B. ambient air
  • the temperature of the culture is usually from 20 0 C to 45 ° C.
  • the culture is continued until a maximum of the desired product has formed. This goal is usually reached within 10 hours to 160 hours.
  • the fermentation broths thus obtained usually have a dry matter content of 7.5 to 25% by weight.
  • the fermentation is driven sugar-limited at least at the end, but especially over at least 30% of the fermentation period. This means that during this time the concentration of utilizable sugar in the fermentation medium is maintained at 0 to 3 g / l, or lowered.
  • biosynthetic products from the fermentation broth and / or the microorganisms takes place in a manner known per se in accordance with the physico-chemical properties of the biosynthetic desired product and the biosynthetic by-products.
  • the fermentation broth can then be further processed, for example.
  • the biomass can be wholly or partly by separation methods, such. As centrifugation, filtration, decantation or a combination of these methods are removed from the fermentation broth or completely left in it.
  • the fermentation broth with known methods, such as. B. with the aid of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, concentrated or concentrated.
  • This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other methods.
  • the product-containing broth is subjected to chromatography with a suitable resin, the desired product or impurities being wholly or partially retained on the chromatography resin.
  • chromatographic steps may be repeated if necessary, using the same or different chromatography resins.
  • the person skilled in the art is familiar with the choice of suitable chromatography resins and their most effective use.
  • the Purified product can be concentrated by filtration or ultrafiltration and stored at a temperature at which the stability of the product is maximized.
  • biosynthetic products can be obtained in different forms, for example in the form of their salts or esters.
  • the identity and purity of the isolated compound (s) can be determined by techniques of the prior art. These include high pressure liquid chromatography (HPLC), spectroscopic methods, staining methods, thin-layer chromatography, NIRS, enzyme testing or microbiological tests. These analytical methods are summarized in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp.
  • HPLC high pressure liquid chromatography
  • NIRS enzyme testing or microbiological tests.
  • ampicillin resistance and replication origin of the vector pBR322 with the oligonucleotide primers SEQ ID NO: 5 and SEQ ID NO: 6 were amplified by means of the polymerase chain reaction (PCR).
  • SEQ ID NO: 5 ⁇ '-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCGCACA G-3 '
  • SEQ ID NO: 6 5'-TCTAGACTCGAGCGGCCGCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTC G-3 '
  • telomere primer In addition to the pBR322 complementary sequences, contains the oligonucleotide primer
  • the resulting DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the blunt ends of the DNA fragment were ligated together with the Rapid DNA Ligatio ⁇ kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on ampicillin (50 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
  • the resulting plasmid is named pCLiKI.
  • a kanamycin resistance cassette was amplified using the oligonucleotide primers SEQ ID NO: 7 and SEQ ID NO.8.
  • the oligonucleotide primer SEQ ID NO: 7 in 5'-3 'direction contains the cleavage sites for the restriction endonucleases Xbal, Smal, BamHI, NheI and the oligonucleotide primer SEQ ID NO: 8 in 5'-3' direction Interfaces for the restriction endonucleases Ascl and Nhel.
  • the PCR reaction was carried out by standard method as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo polymerase (Stratagene, La JoIIa, USA).
  • the resulting DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonucleases XbaI and AscI (New England Biolabs, Beverly, USA), and then again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions cleaned.
  • the vector pCLiKI was also cut with the restriction endonucleases XbaI and AscI and dephosphorylated with alkaline phosphatase (I (Roche-Diagnostics, Mannheim)) according to the manufacturer's instructions.
  • the linearized vector (approximately 2.1 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation mixture by standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA).
  • plasmid-bearing cells were achieved by plating on ampicillin (50 ⁇ g / ml) and kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
  • the resulting plasmid is named pCLiK2.
  • the vector pCLiK2 was cut with the restriction endonuclease Dral (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, a ca. 2.3 kb vector fragment was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was religated using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture was purified by standard methods as described in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E.
  • coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
  • the resulting plasmid is named pCLiK3.
  • the replication origin pHM1519 was amplified using the oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10.
  • SEQ ID NO: 9 5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-S '
  • SEQ ID NO: 10 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3 '
  • the oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10 contain cleavage sites for the restriction endonuclease NotI.
  • the PCR reaction was carried out by standard method, such as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo polymerase (Stratagene, La JoIIa, USA).
  • the resulting 2.7 kb DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonuclease Notl (New England Biolabs, Beverly, USA) and subsequently purified again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the vector pCLiK3 was also cut with the restriction endonuclease NotI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions.
  • the linearized vector (approximately 2.3 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation mixture by standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
  • the resulting plasmid is named pCLiK5.
  • SEQ ID NO: 11 5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATAT
  • SEQ ID NO: 12 5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAG
  • the vector pCUK5 was cut with the restriction endonuclease Xhol and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (approximately 5.0 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the help of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the synthetic double-stranded DNA fragment and the ligation onsinsatz according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kaamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
  • the resulting plasmid is named pCLiK5MCS.
  • Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid pCLiK5MCS is listed as SEQ ID NO: 13.
  • the obtained DNA fragment of about 1.3 kb size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Asp718 and Spei (Roche Diagnostics, Mannheim) and the DNA fragment was purified with GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector pClik ⁇ MCS SEQ ID NO: 13 was cut with the restriction enzymes Asp718 and Spei and a 5 kb fragment after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit isolated.
  • the vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, CoId Spring Harbor, described (1989)), transformed into competent E. coli XMBIue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the oligonucleotide primers SEQ ID NO 17 and SEQ ID NO 18, the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) were amplified by the polymerase chain reaction (PCR) according to standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press amplified a DNA fragment of about 200 base pairs from the non-coding 5 'region (region of the expression unit) of superoxide dismutase (Psod).
  • the resulting DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the obtained DNA fragment of approximately 470 base pairs was purified with the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions.
  • the two fragments obtained above were used together as a template.
  • the standard method was modified in such a way that the oligonucleotide primers SEQ ID NO: 17 and SEQ ID NO: 20 used were added to the reaction mixture only at the beginning of the second cycle.
  • the amplified DNA fragment of approximately 675 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Ncol (Roche Diagnostics, Mannheim) and separated by gel electrophoresis. Subsequently, the ca. 620 base pair DNA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the plasmid PmetA metA SEQ ID NO 16: was cleaved with the restriction enzymes Ncol and Spei (Roche Diagnostics, Mannheim). After gel electrophoretic separation, a ca. 0.7 kb metA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector pClik5MCS SEQ ID NO: 13 was cut with the restriction enzymes Xhol and Spei (Roche Diagnostics, Mannheim) and a 5 kb fragment after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit isolated.
  • the vector fragment was ligated together with the PCR fragment and the metA fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, CoId Spring Harbor, supra, 1989)), transformed into competent E. coli XL-1Blue (Stratagene, La JoIIa, USA). Selection for plasmid-bearing cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the oligonucleotide primers SEQ ID NO 22 and SEQ ID NO 23, the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) were amplified by polymerase chain reaction (PCR) according to standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, amplified a DNA fragment of about 200 base pairs from the noncoding 5 'region (promoter region) of superoxide dismutase (Psod).
  • the DNA fragment obtained was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the resulting DNA fragment of approximately 470 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions.
  • the two fragments obtained above were used together as a template.
  • the standard This method was modified such that the oligonucleotide primers SEQ ID NO: 22 and SEQ ID NO: 25 used were added to the reaction mixture only at the beginning of the second cycle.
  • the amplified DNA fragment of approximately 675 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Ncol (Roche Diagnostics, Mannheim) and separated by gel electrophoresis. Subsequently, the ca. 620 base pair DNA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the plasmid PmetA metA SEQ ID NO: 16 was cleaved with the restriction enzymes Ncol and Spei (Roche Diagnostics, Mannheim). After gel electrophoresis, a ca. 0.7 kb metA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector pClik ⁇ MCS SEQ ID NO: 13 was cut with the restriction enzymes Xhol and Spei (Roche Diagnostics, Mannheim) and a 5 kb fragment after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit isolated.
  • the vector fragment was ligated together with the PCR fragment and the metA fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weertadt).
  • the resulting plasmid pCLiK5MCS P_EFTUmetA is listed as SEQ ID NO: 26.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the oligonucleotide primers SEQ ID NO 27 and SEQ ID NO 28, the chromosomal DNA as template, and Pfu Turbo Polymerase (Stratagene) were amplified by polymerase chain reaction (PCR) according to standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press amplified a DNA fragment of about 200 base pairs from the noncoding 5 'region (region of the expression unit) of the gene GroES (Pgro).
  • the resulting DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the resulting DNA fragment of approximately 470 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions.
  • the two fragments obtained above were used together as a template.
  • the standard This method was modified so that the oligonucleotide primers SEQ ID NO: 27 and SEQ ID NO: 30 used were added to the reaction mixture only at the beginning of the second cycle.
  • the amplified DNA fragment of approximately 675 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Ncol (Roche Diagnostics, Mannheim) and separated by gel electrophoresis. Subsequently, the ca. 620 base pair DNA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the plasmid PmetA metA SEQ ID NO: 16 was cleaved with the restriction enzymes Ncol and Spei (Roche Diagnostics, Mannheim). After gel electrophoresis, a ca. 0.7 kb metA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector pClik5MCS SEQ ID NO: 13 was cut with the restriction enzymes Xhol and Spei (Roche Diagnostics, Mannheim) and a 5 kb fragment after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit isolated.
  • the vector fragment was ligated together with the PCR fragment and the metA fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weertadt).
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. With the oligonucleotide primer BK 1849 (SEQ ID NO: 32) and BK 1862 (SEQ ID NO: 33), the chromosomal DNA as template and Pfu Turbo Polymerase (Stragene) was detected by the polymerase chain reaction (PCR) Standard methods, as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, amplified the metA gene encoding homoserine O-acetyltransferase.
  • PCR polymerase chain reaction
  • BK 1862 (SEQ ID NO: 33) 5'-ATGCCCACCCTCGCGCC -3 '
  • the obtained DNA fragment of about 1134 bp size was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • oligonucleotide primers Haf 26 (SEQ ID NO: 34) and Haf 27 (SEQ ID NO: 35), the chromosomal DNA as template, and Pfu Turbo Polymerase (Stratagene) were amplified by polymerase chain reaction (PCR) according to standard methods, as in
  • Haf 26 (SEQ ID NO: 34) ⁇ '-GAGAGGATCCCCCCCACGACAATGGAAC-S 'and
  • Haf 27 (SEQ ID NO: 35) 5'-CCTGAAGGCGCGAGGGTGGGCATTACGGGGCGATCCTCCTTATG -3 '
  • the obtained DNA fragment of about 195 bp size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the primers Haf 27 and BK I862 contain an overlapping sequence and are homologous to each other at their 5 'ends.
  • PCR products obtained above were used as templates for a further PCR in which the primers BK 1849 (SEQ ID NO: 32) and Haf 26 (SEQ ID NO: 34) were used.
  • the vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, CoId Spring Harbor, supra; 989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weertadt).
  • the resulting plasmid was designated pClik 5a MCS P EF-TS metA (SEQ ID NO: 36).
  • BK 1754 (SEQ ID NO: 38) GCGACTAGTGCCCCACAAATAAAAACAC
  • the obtained DNA fragment of about 77 bp size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer, cut with the restriction enzymes Xba I and Bcu I and purified again.
  • the vector pClik ⁇ MCS (SEQ ID NO: 13) was linearized with the restriction enzyme Xbal and purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions,
  • the linearized vector was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa 1 USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weertadt).
  • the resulting plasmid was designated H247 (SEQ ID NO: 39).
  • This plasmid was treated with the restriction enzymes Beul and Sali and purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions,
  • the plasmid pClik ⁇ MCS Psod metA (SEQ ID NO: 21) as template and Pfu Turbo Polymerase (Stratagene) was prepared by standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press.
  • the amplified fragment had an expected length of about 1350 bp and was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amerersham Pharmacia, Freiburg) according to the manufacturer's instructions, cut with the restriction enzymes Beul and Sali and again cleaned.
  • This fragment was ligated with the plasmid H247 (cleavage Beul and Sali) using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid was named pG A4 (H344) and is listed under SEQ ID NO: 42.
  • the plasmid pG A4 (SEQ ID NO: 42) was cut with the restriction enzymes Xhol and Beul and purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828 prep. riert.
  • the oligonucleotide primers BK 1695 (SEQ ID NO: 43) and Haf16 (SEQ ID NO: 44), the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) were amplified according to standard methods using polymerase chain reaction (PCR) as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, a DNA fragment of about 182 base pairs from the non-coding 5 'region (region of the expression unit) of the gene EF Tu (Peftu) amplified.
  • SEQ ID NO: 43 (BK1695) GAGACTCGAGGGCCGTTACCCTGCGAATG
  • the obtained DNA fragment of about 200 bp size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer, cut with the restriction enzymes Xho I and Bcu I and purified again.
  • This fragment was ligated with the plasmid plasmid pG A4 (H344) (Xhol and Beul cleavage sites) using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions, and the ligation mixture was determined by standard methods as described in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the resulting plasmid was named pClik ⁇ MCS PeftuPsod metA (H473). It is listed under SEQ ID NO: 45. It contains (from 5 'to 3') a Peftu promoter, a Psod expression unit and immediately afterwards the metA open reading frame.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. With the oligonucleotide primers SEQ ID NO: 46 (Haf64) and SEQ ID NO: 47 (Haf65), the chromosomal DNA as template and Pfu Turbo Polymerase (Fa. days) was determined by the polymerase chain reaction (PCR) according to standard methods, as described in Innis et al. (1990) PCR Protocols. A DNA fragment of about 200 from the non-coding 5 'region (region of the expression unit) of the EF Tu gene (Peftu) was amplified.
  • PCR polymerase chain reaction
  • the obtained DNA fragment of about 200 bp size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the metA open reading frame was determined by standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press. The resulting fragment, approximately 1140 bp in length, was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • SEQ ID NO: 48 (BK1862) ATGCCCACCCTCGCGCC
  • the two fragments obtained above were used together as a template.
  • the meta homologous sequences introduced with the oligonucleotide primer Haf 65 SEQ ID NO: 47 lead to an attachment of the two fragments to one another in the course of the PCR reaction and to a continuous DNA strand through the polymerase used.
  • the standard method was modified in such a way that the oligonucleotide primers Haf 64 and BK 1849 SEQ ID NO: 46 and SEQ ID NO: 49 used were added to the reaction mixture only at the beginning of the second cycle.
  • the amplified DNA fragment of approximately 1350 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions.
  • oligonucleotide primers BK 1697 SEQ ID NO: 50
  • Haf17 SEQ ID NO: 51
  • chromosomal DNA as a template and Pfu Turbo Polymerase (Stratagene) was purified by polymerase chain reaction (PCR) according to standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, amplified a DNA fragment (total length: 193 bp, of which 173 pSOD) from the non-coding 5 'region (region of the expression unit) of the gene SOD (Psod).
  • PCR polymerase chain reaction
  • the plasmid (H344) pG A4 SEQ ID NO: 42 was cleaved with the restriction enzymes Xhol and Sali (Roche Diagnostics, Mannheim) and separated by gel electrophoresis. Subsequently, linearized vector was purified from the agarose using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the linearized vector was ligated with the two fragments (fragment Peftu-metA and fragment Psod) using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, Colard Spring Harbor, described (1989)) into competent E. coli XL-1Blue (Stratagene, La JoIIa, USA). transformed. Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid pClik ⁇ MCS PsodPeftu metA is listed as SEQ ID NO: 52.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the oligonucleotide primers SEQ ID NO: 53 (BK1701) and SEQ ID NO: 54 (Haf18), the chromosomal DNA as template, and Pfu Turbo Polymerase (Stratagene) were purified by polymerase chain reaction (PCR) according to standard methods, as in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, amplified a DNA fragment of approximately 175 Nt. It contains 155 base pairs from the non-coding 5 'region (region of the expression unit) of the GRO EL (Pgro) gene and one restriction restriction at the 5' and 3 'ends (Xhol and Beul, respectively).
  • the obtained DNA fragment of about 175 bp size was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Beul (Roche Diagnostics, Mannheim) and the DNA fragment was purified with GFX TM PCR, DNA and Gel Band Purification Kit. Plasmid H344 (SEQ ID NO: 42) was cut with the restriction enzymes Xhol and Beul, and an approximately 6.4 kb fragment was isolated after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit.
  • the PCR product and the cut open plasmid H344 were ligated using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467.
  • the resulting plasmid contains a Pgro promoter directly followed by a Ps
  • PCR was performed according to standard methods as described in Innis et al , (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press.
  • the amplified fragment comprises about 474 base pairs and contains a Pgro Psod cassette with an Acc65I site at the 3 'end.
  • the DNA fragment obtained was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Acc65I and the DNA fragment (333 base pairs) was purified with GFX TM PCR, DNA and Gel Band Purification Kit.
  • SEQ ID NO: 56 (BK1782) TCGAGAGATTGGATTCTTAC
  • Plasmid H479 (SEQ ID NO: 58) contains the Pefts expression unit fused to the metA ORF. It was cut with the restriction enzymes Xhol and Acc65I (directly upstream from Pefts) and an approximately 6.4 kb fragment was isolated after electrophoretic separation using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid contains the 3 promoters Pgro Psod and P EF -Ts fused to the metA ORF. It is listed as pCLiK5MCS Pgro Psod Pefts metA (H501) is shown as SEQ ID NO: 59.
  • PCR was carried out according to standard methods as described in Innis et al. (1990) PCR Protocols. A guide to
  • the amplified fragment comprises approximately 495 base pairs and contains a Peftu-Psod cassette with an Acc65I site at the 3 'end.
  • the resulting DNA fragment was detected by the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) Information from the manufacturer cleaned. Subsequently, it was cleaved with the restriction enzymes Xhol and Acc65I and the DNA fragment (354 base pairs) was purified with GFX TM PCR, DNA and Gel Band Purification Kit.
  • Plasmid H479 (SEQ ID NO: 58) contains the Pefts expression unit fused to the metA ORF. It was cut with the restriction enzymes Xhol and Acc65I (directly upstream from Pefts) and an approximately 6.4 kb fragment was isolated after electrophoretic separation using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid contains the 3 regulatory sequences Peftu Psod and P EF -Ts fused to the metA ORF. It is listed as pCLiK5MCS Peftu Psod Pefts metA (H501) is shown as SEQ ID NO: 60.
  • the strain Corynebacterium glutamicum ATCC13032 was in each case labeled with the plasmids pClik ⁇ MCS, pClik MCS Psod metA, pClik MCS Peftu metA, pClik ⁇ MCS Pefts metA, pClik ⁇ MCS Peftu Psod metA, pClik ⁇ MCS Psod Peftu metA, pClik ⁇ MCS Pgro Psod meta, pClik ⁇ MCS Pgro Psod Pefts metA, pClik ⁇ MCS Peftu Psod Pefts metA according to the method described (Liebl, et al.
  • the cells were centrifuged at 4 0 C and washed twice with cold Tris-HCl buffer (0.1%, pH 8.0). After another centrifugation, the cells in cold Tris-HCl buffer (0.1 %, pH 8.0) and set an OD 60 O of 160.
  • 1 ml of this cell suspension was transferred to 2 ml Ribolyser tubes from Hybaid and to a Ribolyser from Hybaid at a rotation setting of 6.0 three times lysed for each 30 sec. The lysate was clarified by centrifugation at 15,000 rpm at 4 ° C. for 30 minutes in an Eppendorf centrifuge and the supernatant was transferred to a new Eppendorf village.
  • the protein content was determined by Bradford, MM (1976) Anal. Biochem. 72: 248-254.
  • the enzymatic activity of MetA was performed as follows. Reactions of 1 ml contained 100 mM potassium phosphate buffer (pH 7.5), 5 mM MgCl 2, 100 ⁇ M acetyl CoA, 5 mM L-homoserines, 500 ⁇ M DTNB (Ellman's reagent) and cell extract. The test was started by addition of the respective protein lysate and incubated at room temperature. Kinetics were then recorded at 412 nm for 10 min.
  • MetA could be modulated by the use of different combinations of promoters / expression units.
  • an allelic replacement of the lysC wild-type gene in Corynebacterium glutamicum ATCC13032 was performed.
  • a nucleotide exchange was carried out in the lysC gene, so that in the resulting protein, the amino acid Thr at position 311 was replaced by a He.
  • Starting from the chromosomal DNA from ATCC13032 as a template for a PCR reaction was amplified with the oligonucleotide primers SEQ ID NO: 61 and SEQ ID NO: 62 lysC using the Pfu-Turbo PCR system (Stratagene USA) according to the manufacturer.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the amplified fragment is flanked at its 5 'end by a Sali restriction cut and at its 3''end by a MIuI restriction digest .. Prior to cloning, the amplified fragment was digested by these two restriction enzymes and incubated with GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the resulting polynucleotide was cloned via the Sali and MIuI restriction cleavage into pCLIK ⁇ MCS integratively SacB in the following pCIS (SEQ ID NO: 63) and transformed into E. coli XL-1 blue.
  • Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190). The plasmid was isolated and confirmed by sequencing the expected nucleotide sequence.
  • the preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen. Sequencing reactions were performed according to Sanger et al.
  • the plasmid pCIS lysC thr311ile was isolated in C. glutamicum ATCC13032 by electroporation as described in Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303. Modifications of the protocol are described in DE 10046870.
  • the chromosomal arrangement of the lysC locus of individual transformants was determined by standard techniques by Southern blot and hybridization as described in Sambrook et al. (1989), Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, checked. This ensured that the transformants are those which have integrated the transformed plasmid by homologous recombination at the lysC locus.
  • sucrose CM agar medium (10% sucrose, 10 g / l glucose, 2.5 g / l NaCl, 2 g / l urea, 10 g / l Bacto Peptone (Difco), 10 g / l yeast extract, 22.0 g / L agar (Difco)) and incubated at 30 0 C for 24 hours.
  • Recombination can be deleted either the wild-type gene or the mutated gene together with the sacB gene. When the sacB gene is removed along with the wild-type gene, a mutant transformant results.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the oligonucleotide primers SEQ ID NO: 69 (Old38) and SEQ ID NO: 70 (Old 39), the chromosomal DNA as template, and Pfu Turbo Polymerase (Stratagene) were amplified by the polymerase chain reaction (PCR) according to standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, amplified a DNA fragment of ca. 200 from the noncoding 5 'region (region of the expression unit) of the gene EF Tu (Peftu).
  • the obtained DNA fragment of about 200 bp size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the plasmid pCIS (SEQ ID NO: 63) was cleaved with the restriction enzymes MIlu and Xhol (Roche Diagnostics, Mannheim) and separated by gel electrophoresis. Subsequently, linearized vector was purified from the agarose using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the linearized vector was ligated with the two fragments (fragment Peftu-ddh and fragment 5 'ddh) using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the preparation of the plasmid DNA was prepared by methods and materials of the Fa.
  • the resulting plasmid pCIS Peftu ddh is listed as SEQ ID NO: 75.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the oligonucleotide primers SEQ ID NO: 76 and SEQ ID NO: 77, the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) were amplified by polymerase chain reaction (PCR) according to standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press amplified a DNA fragment of approximately 677 base pairs from the 5 'region of the ddh gene (fragment 5'ddh).
  • SEQ ID NO: 76 (CK461) CCTGACGTCGCAATATAGGCAGCTGAATC
  • the DNA fragment obtained was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Aatll and Muni (Roche Diagnostics, Mannheim) and separated by gel electrophoresis. Subsequently, the ca. 661 base pair DNA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg). The resulting fragment contains the 5 'region of the ddh ORF.
  • a PeftuPsod cassette was amplified with the oligonucleotide primers SEQ ID NO.-78 and SEQ ID NO: 79.
  • SEQ ID NO: 78 (CK426) CGCCAATTGTCGAGGGCCGTTACCCT
  • the resulting DNA fragment of approximately 378 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions.
  • the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) was determined by the polymerase chain reaction (PCR) according to standard methods such as Innis et al., (1990) PCR Protocols, a DNA fragment of about 992 base pairs (ddh ORF) amplified (fragment ddh) .
  • the amplified DNA fragment was amplified with the GFX TM PCR , DNA and Gel Band Purification Kit according to manufacturer's instructions.
  • SEQ ID NO: 80 (CK464) TACGAAAGGATTTTTTACCCATGACCAACATCCGCGTAGC
  • the two fragments obtained above (PeftuPsod cassette and ddh ORF) were used together as a template.
  • the Psod homologous sequences introduced with the oligonucleotide primer SEQ ID NO: 80 (CK464) lead to an attachment of the two fragments to one another and to a continuous DNA strand through the polymerase used.
  • the standard method has been modified to indicates that the oligonucleotide primers SEQ ID NO: 79 (CK426) and SEQ ID NO: 81 (CK467) used were added to the reaction mixture only at the beginning of the second cycle.
  • the amplified DNA fragment of approximately 1359 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions.
  • the vector pCIS was cut with the restriction endonucleases Aatll and Smal and dephosphorylated with alkaline phosphatase (Roche Diagnostics, Mannheim) according to the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (about 4.2 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the two cut PCR fragments (5'ddh and PeftuPsod ddh) and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of individual clones was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digests. 2 correct plasmids were sequenced. Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt). The resulting Plasmid pClik Peftu Psod ddh is capable of chromosomally integrating the PeftuPsod cassette into the ddh ORF by means of 2 consecutive recombination events. The plasmid pCIS PeftuPsod dh is listed as SEQ ID NO: 82.
  • This methylation increases the stability of the plasmids pCIS Peftu ddh and pCIS PeftuPsod ddh in C. glutamicum cells.
  • the plasmid DNA was subsequently isolated from the Mn522 cells by standard methods and introduced by means of electroporation the above-described Corynebacterium glutamicum strain ATCC 13032 ask (fbr). From this electroporation and subsequent selection on CM plates with kanamycin (25 ⁇ g / ml) several transconjugants were obtained.
  • these transconjugants were grown in CM medium overnight without kanamycin and then plated out for selection on CM plates containing 10% sucrose.
  • the sacB gene present on the vector pCIS codes for the enzyme laevan sucrase and, when grown on sucrose, leads to the synthesis of laevan. Since Laevan is toxic to C. glutamicum, only C. glutamicum cells which have lost the integration plasmid through the second recombination step can grow on sucrose-containing medium (Jäger et al., Journal of Bacteriology 174 (1992) 5462-5466 ). 100 sucrose-resistant clones were checked for their kanamycin sensitivity.
  • a sensitivity to kanamycin could also be detected, which is expected in the case of the desired excision of the vector sequences.
  • PCR polymerase chain reaction
  • PCR conditions were chosen as follows: pre-denaturation: 5 min at 95 0 C; Denaturation for 30 sec at 95 ° C; Hybridization for 30 sec at 55 ° C; Amplification for 2 min at 72 0 C; 30 cycles ,; End extension 5 min at 72 ° C.
  • pre-denaturation 5 min at 95 0 C
  • Denaturation for 30 sec at 95 ° C Denaturation for 30 sec at 95 ° C
  • Hybridization for 30 sec at 55 ° C
  • Amplification for 2 min at 72 0 C
  • 30 cycles 30 cycles ,
  • End extension 5 min at 72 ° C In the batch with the DNA of the starting strain, no PCR product could be produced by choice of the oligonucleotides. Only in clones that have undergone the integration of the Peftu or PeftuPsod expression units directly 5 'of the ddh gene through the second recombination, a band was expected.
  • strains were plated on CM plates (10.0 g / L D-glucose, 2.5 g / L NaCl, 2.0 g / L
  • vitamin B12 hydroxycobalamin Sigma Chemicals
  • the amino acid concentration was determined by Agilent high pressure liquid chromatography on an Agilent 1100 Series LC System HPLC.
  • a pre-column derivatization with ortho-pthalaldehyde allows the quantification of the amino acids formed, the separation of the amino acid mixture takes place on a Hypersil AA column (Agilent).
  • the result of the study is shown in the following table

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Description

MEHRFACHPROMOTOREN UND DEREN VERWENDUNG ZUR GENEXPRESSION
Beschreibung
Die vorliegende Erfindung betrifft Mehrfachpromotoren und diese enthaltende Expressionseinheiten; deren Verwendung zur Regulation der Transkription und Expression von Genen; Expressionskassetten, die solche Mehrfachpromotoren oder Expressionseinheiten umfassen; Vektoren, welche solche Expressionskassetten enthalten; genetisch veränderte Mikroorganismen, welche solche Vektoren und/oder Expressionsein- heiten enthalten; sowie Verfahren zur Herstellung von biosynthetischen Produkten durch Kultivierung der genetisch veränderten Mikroorganismen.
HINTERGRUND DER ERFINDUNG
Verschiedene biosynthetische Produkte werden über natürliche Stoffwechselprozesse in Zellen hergestellt und werden in vielen Industriezweigen verwendet, einschließlich der Nahrungsmittel-, Futtermittel-, Kosmetik-, Feed-, Food- und pharmazeutischen Industrie. Diese Substanzen, die zusammen als Feinchemikalien/Proteine bezeichnet werden, umfassen unter anderem organische Säuren, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Nukleotide und Nukleoside, Lipide und Fettsäuren, Diole, Kohlenhydrate, aromatische Verbindungen, Vitamine und Cofaktoren, sowie Proteine und Enzyme. Ihre Produktion erfolgt am zweckmäßigsten im Großmaßstab mittels Anzucht von Bakterienstämmen oder anderen Mikroorganismen, die entwickelt wurden, um große Mengen der jeweils gewünschten Substanz zu produzieren und zu sezernieren. Für diesen Zweck besonders geeignete Organismen sind coryneforme Bakterien, gram-positive nicht-pathogene Bakterien.
Es ist bekannt, dass Aminosäuren durch Fermentation von Stämmen coryneformer Bakterien, insbesondere Corynebacterium glutamicum, hergestellt werden können. Wegen der großen Bedeutung wird ständig an der Verbesserung der Herstellverfahren gearbeitet. Verfahrensverbesserungen können fermentationstechnische Maßnahmen, wie zum Beispiel Rührung und Versorgung mit Sauerstoff, oder die Zusammensetzung der Nährmedien, wie zum Beispiel die Zuckerkonzentration während der Fermentation, oder die Aufarbeitung zum Produkt, beispielsweise durch lonenaustauschchroma- tographie aber auch Sprühtrocknung, oder die intrinsischen Leistungseigenschaften des Mikroorganismus selbst betreffen. Seit einigen Jahren werden ebenfalls Methoden der rekombinanten DNA-Technik zur Stammverbesserung von Feinchemikalien/Proteine produzierender Stämme von Cory- nebacterium eingesetzt, indem man einzelne Gene amplifiziert und die Auswirkung auf die Produktion von Feinchemikalien/Proteine untersucht.
Andere Wege, um ein Verfahren für die Herstellung von Feinchemikalien oder Proteinen zu entwickeln, oder die Produktivität eines bereits existierenden Verfahrens für die Herstellung von Feinchemikalien oder Proteinen zu erhöhen bzw. zu verbessern, umfassen die Erhöhung bzw. die Veränderung der Expression eines oder mehrerer Gene und/oder die Beeinflussung der Translation einer mRNA durch geeignete Polynukleo- tidsequenzen. Beeinflussung kann in diesem Zusammenhang die Erhöhung, Verringerung oder auch andere Parameter der Expression von Genen, wie zeitliche Expressionsmuster, umfassen.
Dem Fachmann sind unterschiedliche Bestandteile von bakteriellen Regulationssequenzen bekannt. Man unterscheidet die Bindungsstellen von Regulatoren, auch Operatoren genannt, die Bindungsstellen von RNA-Polymerase-Holoenzymen, auch -35 und -10 Regionen genannt, und die Bindungsstelle von ribosomaler 16S-RNA, auch ribosomale Bindungsstelle (RBS) oder auch Shine-Dalgamo-Sequenz genannt.
In der Literatur (E. coli und S. typhimurium, Neidhardt F. C. 1995 ASM Press) wird beschrieben, dass sowohl die Zusammensetzung der Polynukleotidsequenz der Shine- Dalgarno-Sequenz, die Sequenzabfolge der Basen, aber auch der Abstand einer in der Shine-Dalgarno-Sequenz enthaltenen Polynukleotidsequenz zum Start-Codon einen wesentlichen Einfluss auf die Initiationstionsrate der Translation hat.
Nukleinsäuresequenzen mit Promotoraktivität können die Bildung von mRNA auf unterschiedliche Weise beeinflussen. Promotoren, deren Aktivität unabhängig von der physiologischen Wachstumsphase des Organismus sind, nennt man konstitutiv. Wie- derum andere Promotoren reagieren auf externe chemische, wie physikalische Stimuli wie Sauerstoff, Metabolite, Hitze, pH, etc.. Wiederum andere zeigen in unterschiedlichen Wachstumsphasen eine starke Abhängigkeit ihrer Aktivität. Beispielsweise sind in der Literatur Promotoren beschrieben, die während der exponentiellen Wachstumsphase von Mikroorganismen eine besonders ausgeprägte Aktivität zeigen, oder aber auch genau in der stationären Phase des mikrobiellen Wachstums. Beide Charakteristika von Promotoren können für eine Produktion von Feinchemikalien und Proteine je nach Stoffwechselweg einen günstigen Einfluss auf die Produktivität haben.
In Corynebactehum-Spezies konnten bereits solche Nukleotidsequenzen isoliert wer- den, die für eine Erhöhung bzw. eine Abschwächung der Genexpression genutzt wer- den können. Diese regulierten Promotoren können die Rate, mit der ein Gen transkribiert wird, abhängig von den internen und/oder externen Bedingungen der Zelle erhöhen oder erniedrigen. Zum Teil kann die Anwesenheit eines bestimmten Faktors, bekannt als Induktor, die Rate der Transkription vom Promotor stimulieren. Induktoren können direkt oder aber indirekt die Transkription vom Promotor beeinflussen. Eine andere Klasse von Faktoren, bekannt als Suppressoren ist in der Lage, die Transkription vom Promotor zu reduzieren oder aber zu inhibieren. Wie auch die Induktoren, können auch die Suppressoren direkt oder indirekt wirken. Es sind jedoch auch Promotoren bekannt, die über die Temperatur reguliert werden. So kann der Level der Transkription solcher Promotoren zum Beispiel durch eine Erhöhung der Wachstumstemperatur über die normale Wachstumstemperatur der Zelle erhöht oder aber abgeschwächt werden.
Eine geringe Anzahl von Promotoren aus C. glutamicum wurde bis zum heutigen Tag beschrieben. Der Promotor des Malatsynthase-Gens aus C. glutamicum wurde in DE- A- 44 40 118 beschrieben. Dieser Promotor wurde einem für ein Protein kodierendes Strukturgen vorgeschaltet. Nach Transformation eines solchen Konstrukts in ein cory- neformes Bakterium wird die Expression des dem Promotor nachgeschalteten Strukturgens reguliert. Die Expression des Strukturgens wird induziert, sobald dem Medium ein entsprechender Induktor zugesetzt wird.
Reinscheid et al., Microbiology 145:503 (1999) haben eine transkriptionelle Fusion zwischen dem pta-ack Promotor aus C. glutamicum und einem Reportergen (ChIo- ramphenicol Acetyltransferase) beschrieben. Zellen von C. glutamicum, die eine solche transkriptionelle Fusion enthalten, wiesen eine erhöhte Expression des Reportergens bei Wachstum auf Acetat-haltigem Medium auf. Im Vergleich dazu zeigten transformierte Zellen, die auf Glucose wuchsen, keine erhöhte Expression dieses Reportergens.
In Patek et al., Microbiology 142:1297 (1996) wurden einige DNA Sequenzen aus C. glutamicum beschrieben, die die Expression eines Reportergens in C. glutamicum Zellen verstärken können, beschrieben. Diese Sequenzen wurden miteinander verglichen, um Consensus-Sequenzen für C. glutamicum Promotoren zu definieren.
Weitere DNA-Sequenzen aus C. glutamicum, die zur Regulation der Genexpression genutzt werden können, sind in der WO 02/40679 beschrieben worden. Diese isolierten Polynukleotide stellen Expressionseinheiten aus Corynebacterium glutamicum dar, die entweder zur Erhöhung oder aber zur Verringerung einer Genexpression genutzt werden können. Weiterhin sind in dieser Druckschrift rekombinante Plasmide be- schrieben, auf denen die Expressionseinheiten aus Corynebacterium glutamicum mit heterologen Genen assoziiert sind. Die hier beschrieben Methode, Fusion von einem Promotor aus Corynebacterium glutamicum mit einem hererlogen Gen, kann unter anderem zur Regulation der Gene der Aminosäurebiosynthese eingesetzt werden.
Aus den älteren, nicht vorveröffentlichten Patentanmeldungen DE-A-103 59 594, DE-A- 103 59 595, DE-A-103 59 660 und DE-A-10 2004 035 065 sind spezielle Einzelpromotoren aus C. glutamicum bekannt.
KURZBESCHREINUNG DER ERFINDUNG
Der Erfindung lag die Aufgabe zugrunde weitere regulatorische Nukleinsäuresequen- zen, insbesondere Promotorkonstrukte und/oder Expressionseinheiten mit vorteilhaften Eigenschaften, beispielsweise mit im Vergleich zum Ausgangspromotor erhöhter oder veränderter Transkriptionsaktivität und/oder Translationsaktivität, zur Verfügung zu stellen.
Die Aufgabe wurde erfindungsgemäß gelöst durch Bereitstellung einer Mehrfachpro- motor-enthaltenden Expressionseinheit, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel (I)
5'-Pr(-Ax-Px-)n-Ay-Py-3' (I)
worin n für einen ganzzahligen Wert von 0 bis 10 steht; Ax und Ay gleich oder verschieden sind und für eine chemische Bindung oder eine Lin- ker-Nukleinsäuresequenz stehen;
Pi, Px und Py für gleiche oder verschiedene Promotorsequenzen kodieren, welche wenigstens einen RNA-Polymerase-bindenden Bereich, wie z.B. die Kernregion, umfassen; und wenigstens Py einen, die Ribosomenbindung vermittelnden, 3'-terminalen Sequenzabschnitt umfasst. Einen derartigen, die Ribosomenbindung vermittelnden Sequenzabschnitt, können unabhängig voneinander auch P1 und einzelne oder alle Px aufweisen.
Gemäß einer Ausführungsform sind P1, Px und Py von gleichen oder verschiedenen eukaryotischen oder insbesondere prokaryotischen Organismen abgeleitet. Auch künstliche Promotoren sind brauchbar.
Gemäß einer bevorzugten Ausführungsform sind P1, Px und Py jeweils abgeleitet von einer zusammenhängenden Sequenz von 35 bis 500 Nukleotidresten, bevorzugt 35 bis 300 Nukleotidresten, noch bevorzugter 35 bis 210 Nukleotidresten und ganz besonders bevorzugt 35 bis 100 Nukleotidresten, die im Genom des Organismus 5'-stromaufwärts von der kodierenden Sequenz für ein Protein, z.B für ein an einem Biosyntheseweg des Organismus beteiligtes Protein, liegt.
Gemäß einer weiteren Ausführungsform sind P1, Px und Py der Expressionseinheit aus einem coryneformen Bakterium abgeleitet.
Gemäß einer bevorzugten Ausführungsform sind P1, Px und Py der Expressionseinheit unabhängig voneinander ausgewählt unter Promotorsequenzen für die kodierende Sequenz eines Proteins mit hoher Abundanz in einem eukaryotischen odder prokaryo- tischen Organismus, insbesondere in einem oryneformen Bakterium, wie z.B. in einem der Gattung Corynebacterium oder Brevibacterium, wie z.B. einer Spezies oder einem Stamm gemäß der Aufstellung in Tabelle 3.
Zusätzlich können einzelne oder alle dieser Promotorsequenzen ausgewählt sein unter Promotorsequenzen für die kodierende Sequenz eines in der Tabelle 1 aufgelisteten und an der Aminosäurebiosynthese eines Organismus beteiligten Proteins. Wenigstens einer der Promotoren der erfindungsgemäßen Expressionseinheit sollte dabei aber hohe Abundanz wie hierin definiert aufweisen.
Gemäß einer weiteren bevorzugten Ausführungsform sind P1, Px und Py der Expressionseinheit unabhängig voneinander ausgewählt unter den in Figur 1 dargestellten Nukleotidsequenzen, beziehungsweise, wie später noch näher erläutert, abgeleitet von SEQ ID NO:1 (pGRO), SEQ ID NO:2 (pEFTs), SEQ ID NO:3 (pEFTu) und SEQ ID NO:4 (pSOD).
Gemäß einer weiteren Ausführungsform sind P1, Px und Py der Expressionseinheit unabhängig voneinander ausgewählt unter starken, konstitutiven oder regulierbaren Promotoren.
Die vorliegende Erfindung betrifft in einem weiteren Aspekt eine Expressionskassette, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel II:
5'.p1.(.Ax-Px-)n-Ay-Py-G-31 (II)
worin n, Ax, Ay, P1, Px und Py wie oben definiert sind und G für wenigstens eine kodierende Nukleinsäuresequenz steht, welche mit der 5'-stromaufwärts gelegenen regulatorischen Sequenz funktionell oder operativ verknüpft ist. Gemäß einer bevorzugten Ausführungsform der Expressionskassette ist G ausgewählt unter a) Nukleinsäuren kodierend ein Protein aus den Biosyntheseweg von proteinogenen und nicht-proteinogenen Aminosäuren, b) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Nukleotiden und Nukleosiden, c) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von organischen Säuren, d) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Lipiden und Fettsäuren, e) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Diolen, f) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Kohlenhydraten, g) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von aromatischen Verbindungen, h) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Vitaminen, i) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Cofaktoren, j) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Enzymen, und k) Nukleinsäuren kodierend ein Protein aus dem Zentralstoffwechsel.
Gemäß einer besonders bevorzugten Ausführungsform der Expressionskassette ist G ausgewählt unter Nukleinsäuren für Proteine aus dem Biosyntheseweg von Aminosäuren, ausgewählt unter Aspartatkinase, Aspartat-Semialdehyd-Dehydrogenase, Diami- nopimelat-Dehydrogenase, Diaminopimelat-Decarboxylase, Dihydrodipicolinate- Synthetase, Dihydrodipicolinate-Reduktase, Glycerinaldehyd-3-Phosphat-
Dehydrogenase, 3-Phosphoglycerat-Kinase, Pyruvat-Carboxylase, Triosephosphat- Isomerase, Transkriptioneller Regulator LuxR, Transkriptioneller Regulator LysR1 , Transkriptioneller Regulator LysR2, Malat-Quinon-Oxidoreduktase, Glucose-6- Phosphat-Deydrogenase, 6-PhosphogIuconat-Dehydrognease, Transketolase, Tran- saldolase, Homoserin-O-Acetyltransferase, Cystahionin-gamma-Synthase, Cystathio- nin-beta-Lyase, Serin-Hydroxymethyltransferase, O-Acetylhσmoserin-Sulfhydrylase, Methylen-Tetrahydrofolat-Reduktase, Phosphoserin-Aminotransferase, Phosphoserin- Phosphatase, Serin-Acetyl-Transferase, Homoserin-Dehydrogenase, Homoserin- Kinase, Threonin-Synthase, Threonin-Exporter-Carrier, Threonin-Dehydratase, Pyru- vat-Oxidase, Lysin-Exporter, Biotin-Ligase, Cystein-Synthasel, Cystein-Synthase II, Coenzym B12-abhängige Methionin-Synthase, Coenzym B12-unabhängige Methionin- Synthase-Aktivität, Sulfatadenyltransferase Untereinheit 1 und 2, Phosphoadenosin Phosphosulfat Reduktase, Ferredoxin-sulfit-reductase, Ferredoxin NADP Reduktase, 3-Phosphoglycerat Dehydrogenase, RXA00655 Regulator, RXN2910-Regulator, Argi- nyl-t-RNA-Synthetase, Phosphoenolpyruvat-Carboxylase, Threonin Efflux-Protein, Se- rinhydroxymethyltransferase, Fruktose-1 ,6-bisphosphatase, Protein der Sulfat- Reduktion RXA077, Protein der Sulfat-Reduktion RXA248, Protein der Sulfat- Reduktion RXA247, Protein OpcA, 1-Phosphofruktokinase und 6-Phosphofruktokinase, Tetrahydropicolinat-Succinylase, Succinyl-aminoketopimelat-Aminotransferase, Succi- nyl-Diaminopimelat-Desuccinylase, Diaminopimelat-Epimerase, 6-Phosphogluconat- Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase, Malat-Enzym kodieren.
Die vorliegende Erfindung betrifft in einem weiteren Aspekt einen Vektor, der wenigs- tens eine der vorstehend genannten Expressionskassetten umfasst.
Gemäß einem noch weiteren Aspekt betrifft die vorliegende Erfindung einen genetisch veränderten Mikroorganismus, der mit wenigstens einem der vorstehend genannten Vektoren transformiert ist, oder wenigstens eine der vorstehend genannten Expressi- onskassetten, vorzugsweise in integrierter Form, enthält.
Gemäß einer Ausführungsform ist der genetisch veränderte Organismus von coryne- formen Bakterien abgeleitet.
Gemäß einer bevorzugten Ausführungsform ist der genetisch veränderte Organismus von Bakterien der Gattung Corynebacterium oder Brevibacterium abgeleitet.
Gemäß einem weiteren Aspekt betrifft die vorliegende Erfindung ein Verfahren zur Herstellung eines biosynthetischen Produkts, wobei man einen der vorstehend ge- nannten, genetisch veränderten Mikroorganismen kultiviert und das gewünschte Produkt aus der Kultur isoliert.
Gemäß einer Ausführungsform des Verfahrens ist das biosynthetische Produkt ausgewählt unter organischen Säuren, Proteinen, Nukleotiden und Nukleosiden, sowohl pro- teinogenen als auch nicht-proteinogenen Aminosäuren, Lipiden und Fettsäuren, Dio- len, Kohlehydraten, aromatischen Verbindungen, Vitaminen und Cofaktoren, Enzymen und Proteinen. Ganz besonders bevorzugte Biosyntheseprodukte sind Lysin, Methio- nin, Threonin und Trehalose.
Gemäß einem weiteren Aspekt betrifft die vorliegende Erfindung die Verwendung einer erfindungsgemäßen Expressionseinheit zur Regulation einer Produkt-Biosynthese. FIGURENBESCHREIBUNG
Figur 1 zeigt spezifische Sequenzen für vier Promotoren, welche zur Herstellung der in den Ausführungsbeispielen beschriebenen Mehrfachpromotoren verwendet wurden. Dargestellt sind die Promotorsequenzen für pEFTu (Figur 1A); für Promotor pGRO (Figur 1 B)1 für Promotor pEFTs (Figur 1C) und für Promotor pSOD (Figur 1 D). Für jeden Promotor sind zwei Sequenzen angegeben, die längere (obere Sequenz) gibt jeweils die vollständige Promotorsequenz einschließlich Ribosomenbindungsstelle (RBS), fett und kursiv gedruckt, an. Im Falle einer 3'-terminalen Anordnung des jeweili- gen Promotors im erfindungsgemäßen Mehrfach-Promotorkonstrukt wird bevorzugt jeweils die längere Nukleotidsequenz (einschließlich RBS) verwendet. Promotorsequenzen, 5'-stromaufwärts zur 3'-terminalen Promotoreinheit umfassen keine RBS und wurden in der jeweils in zweiter Position angegebenen, verkürzten Nukleinsäurese- quenz verwendet (ohne RBS). 3'-terminale, in Großbuchstaben und Fettschrift ange- gebene Teilsequenzen der kürzeren Promotorsequenzen können gegebenenfalls zusätzlich fehlen. Potenzielle ,,-10-Regionen" sind unterstrichen dargestellt.
DETAILLIERTE BESCHREIBUNG DER ERFINDUNG
I. Allgemeine Definitionen:
Ein „biosynthetisches Produkt" im Sinne der Erfindung werden solche verstanden, die über natürliche Stoffwechselprozesse (Biosynthesewege) in Zellen produziert werden. Sie finden vielfältige Verwendung, insbesondere der Nahrungsmittel-, Futtermittel-, Kosmetik-, Feed-, Food- und pharmazeutischen Industrie. Diese Substanzen, die zusammen als Feinchemikalien/Proteine bezeichnet werden, umfassen unter anderem organische Säuren, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Nukleotide und Nukleoside, Lipide und Fettsäuren, Diole, Kohlenhydrate, aromatische Verbindungen, Vitamine und Cofaktoren, sowie Proteine und Enzyme.
Unter einem „Promotor", einer „Nukleinsäure mit Promotoraktivität" oder einer „Promotorsequenz" wird erfindungsgemäß eine Nukleinsäure verstanden, die in funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäure die Transkription dieser Nuk- leinsäure reguliert.
Sofern nicht ausdrücklich auf „Einzelpromotoren" Bezug genommen wird, umfasst der Begriff „Promotor" erfindungsgemäß je nach Zusammenhang auch die sequentielle Anordnung von mehr als einer Nukleinsäuresequenz (also „Mehrfachpromotoren"), von denen jede einzelne bei funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäure zur Regulation von deren Transkription befähigt wäre.
Der Begriff „Einzelpromotor" bezieht sich entsprechend auf eine einzige, zur Regulation der Transkription einer zu transkribierenden Nukleinsäure befähigte Nukleinsäuresequenz, die bei funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäuresequenz diese transkribieren kann.
Bei „Mehrfachpromotoren" sind mindestens zwei gleiche oder unterschiedliche Nuk- leinsäuresequenzen, von denen jede einzelne bei funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäure zur Regulation von deren Transkription befähigt wäre (Einzelpromotoren), sequentiell so verknüpft, dass ein Transkriptionsstart von wahlweise einer der Nukleinsäuresequenzen ein die zu transkribierende Nukleinsäure enthaltendes Transkript hervorbringen könnte. Zwischen jeweils zwei Einzelpromotoren können dabei weitere Sequenzen ohne Promotorfunktion eingefügt werden, beispielsweise ein Linker, der beispielsweise eine oder mehrere Restriktionsschnittstellen aufweist. Wahlweise können jeweils zwei Einzelpromotoren auch direkt miteinander verknüpft werden. Vorzugsweise enthalten die Mehrfachpromotoren nur eine Ribosomen- bindungsstelle (RBS), insbesondere im Bereich des 3'-terminalen Endes des Promotors.
Unter Promotorsequenzen für die kodierende Sequenz eines Proteins mit „hoher A- bundanz" versteht man insbesondere „starke Promotoren". Wenn man Mehrfachpro- motoren zur Verstärkung von Genen einsetzen möchte, werden in geeigneter Weise bevorzugt solche starken Promotoren kombiniert. Starke Promotoren regulieren die Transkription von Genen derart, dass die Ablesehäufigkeit durch die RNA-Polymerase größer ist als bei der Mehrzahl der Gene des Organismus. In den meisten Fällen resultiert das Vorhandensein eines starken Promoters darin, dass auch eine große Menge an Transkript in der Zelle vorliegt. Wenn das Transkript in Relation zu den anderen zellulären Transkripten einen prozentual größeren Anteil einnimmt, spricht man von einem „abundanten Transkript". In Bakterien korreliert die Menge an Transkript und dem entsprechenden davon kodierten Protein in der Regel, d.h. „abundante Transkripte" führen meist auch zu „abundanten Proteinen". Im Folgenden ist beispielhaft eine Methode beschrieben, die die Identifizierung von „starken Promotoren" über die Abun- danz von Proteinen erlaubt. Details zum methodischen Vorgehen sowie weitere Referenzen können z.B. aus Proteomics in Practice - A Laboratory Manual of Proteome Analysis (Autoren: R. Westermeier, T. Naven; Verlag: Wiley-VCH Verlag GmbH, 2002) entnommen werden. Die Bakterienzellen werden aufgeschlossen und die Proteine des Zellextraktes werden mittels 2D-Gelelektrophorese aufgetrennt. Anschließend werden die Proteine durch gängige Methoden, wie z.B. Coomassie-, Silber- oder Fluoreszenzfarbstofffärbung angefärbt. Dabei ist eine Überfärbung der Proteine zu vermeiden, um eine spätere Quantifizierung der einzelnen Proteinspots zu ermöglichen. Im Anschluss daran wird das Gel gescannt und das erhaltenen Bild mit Hilfe einer geeigneten Soft- wäre (z.B. Melanie, Amersham Biosciences) ausgewertet. Dazu werden zunächst alle detektierbaren Spots identifiziert und das Spotvolumen bestimmt. Die Summe aller Spotvolumina entspricht in erster Annäherung dem Gesamtprotein. Mit Hilfe der Bildanalysesoftware können dann die Spots mit besonders großen Spotvolumina ausgewählt werden. Beispielsweise können Spots mit Volumina, die mehr als 0.1 % des Ge- samtspotvolumens einnehmen, als abundant bezeichnet werden. Anschließend werden Spots mit besonders abundanten Proteinen aus dem Gel ausgestochen. Normalerweise wird dann das im Gelstück vorhandene Protein proteolytisch verdaut (z.B. mit Trypsin) und die Molmasse der entstehenden Peptide, z.B. mit Hilfe von MALDI-ToF MS (Matrix assisted laser desorption ionization- Time of Flight Mass Spectrometry) bestimmt. Auf Basis der Molmasse von einigen der tryptischen Peptide des Proteins kann dann in Datenbankrecherchen das zugehörige Protein identifziert werden. Dies ist insbesondere dann möglich, wenn das Genom des zu untersuchenden Organismus sequenziert ist, wie das für C. glutamicum, E. coli und viele andere Bakterien der Fall ist. Auf Basis der Identität des Proteins kann dann das dieses Protein kodierende ORF (offenes Leseraster) bestimmt werden. In Bakterien liegen die dieses Gen regulierenden Promotoren meist direkt stromaufwärts vom Start-Codon. Daher befinden sich auch die „starken" Promoteren häufig in einem Bereich von ca. 200 Nukleotiden stromaufwärts des Start-Codons „abundanter" Proteine.
„Künstliche" Promotoren im Sinne der Erfindung umfassen insbesondere solche Sequenzen, die in situ keine Transkriptionsaktivität aufweisen, in einem anderen Sequenzkontext, wie insbesondere im Kontext einer erfindungsgemäßen Expressionseinheit oder Expressionskassette, transkriptionell aktiv sind.
Unter „Promotoraktivität" wird erfindungsgemäß die in einer bestimmten Zeit durch den Promotor gebildete Menge RNA, also die Transkriptionsrate verstanden.
Unter „spezifischer" Promotoraktivität wird erfindungsgemäß die in einer bestimmten Zeit durch den Promotor gebildete Menge RNA pro Promotor verstanden.
Bei einer „verursachten" Promotoraktivität oder Transkriptionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp die Bildung einer RNA verursacht, die im Wildtyp so nicht vorhanden war.
Bei einer „veränderten" Promotoraktivität oder Transkriptionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit die gebildete Menge der RNA verändert.
Unter „verändert" wird in diesem Zusammenhang bevorzugt erhöht oder erniedrigt ver- standen.
Unter einer „funktionellen" oder „operativen" Verknüpfung versteht man in diesem Zusammenhang beispielsweise die sequentielle Anordnung einer der erfindungsgemäßen Nukleinsäuren mit Promotoraktivität und einer zu transkribierenden Nukleinsäurese- quenz und ggf. weiterer regulativer Elemente, wie zum Beispiel Nukleinsäuresequen- zen, die die Transkription von Nukleinsäuren gewährleisten, sowie zum Beispiel einen Terminator derart, dass jedes der regulativen Elemente seine Funktion bei der Transkription der Nukleinsäuresequenz erfüllen kann. Dazu ist nicht unbedingt eine direkte Verknüpfung im chemischen Sinne erforderlich. Genetische Kontrollsequenzen, wie zum Beispiel Enhancer-Sequenzen, können ihre Funktion auch von weiter entfernten Positionen oder gar von anderen DNA-Molekülen aus auf die Zielsequenz ausüben. Bevorzugt sind Anordnungen, in denen die zu transkribierende Nukleinsäuresequenz hinter (d.h. am 3'-Ende) der erfindungsgemäßen Promotorsequenz positioniert wird, so dass beide Sequenzen kovalent miteinander verbunden sind. Bevorzugt ist dabei der Abstand zwischen der Promotorsequenz und der transgen zu exprimierende Nukleinsäuresequenz geringer als 200 Basenpaare, besonders bevorzugt kleiner als 100 Basenpaare, ganz besonders bevorzugt kleiner als 50 Basenpaare.
Als Sequenz einer „ribosomalen Bindungsstelle" oder „Ribosomenbindungsstelle" (RBS) (oder als Shine-Dalgamo-Sequenz bezeichnet) im Sinne dieser Erfindung werden A/G-reiche Polynukleotidsequenzen verstanden, die sich bis zu 30 Basen stromauf des Initiationscodon der Translation befinden.
Unter „Transkription" wird erfindungsgemäß der Prozess verstanden, durch den aus- gehend von einer DNA-Matrize ein komplementäres RNA-Molekül hergestellt wird. An diesem Prozess sind Proteine, wie die RNA-Polymerase, sogenannte Sigma-Faktoren und transkriptioneile Regulatorproteine beteiligt. Die synthetisierte RNA dient dann als Matrize im Prozess der Translation, der dann zum biosynthetisch aktiven Protein führt.
Unter einer „Kernregion" eines Promotors versteht man erfindungsgemäß eine zusammenhängende Nukleinsäuresequenz von etwa 20 bis 80, oder 30 bis 60 Nukleotiden, die wenigstens eine potentielle sogenannte ,,-10-Region" umfasst. Beispiele für potentielle -10-Regionen sind für einzelne bevorzugte Promotorsequenzen hierin beschrieben; vergleiche insbesondere Figur 1. ,,-10-Regionen" werden auch als TATA- Boxen oder Pribnow-Schaller-Sequenzen bezeichnet. Jeder eingesetzte Promotor soll- te mindestens eine dieser potentiellen -10-Regionen, wie z. B. 1 , 2, 3, 4 oder 5, enthalten. Die Kernregion liegt 5'-stromaufwärts zur RBS und kann von dieser 1 bis 200 oder 10 bis 150 oder 20 bis 100 Nukleotidreste entfernt sein .
Unter einer „Expressionseinheit" wird erfindungsgemäß eine Nukleinsäure mit Expressionsaktivität verstanden, die einen Mehrfachpromotor, wie hierein definiert umfasst, und nach funktioneller Verknüpfung mit einer zu exprimierenden Nukleinsäure oder einem Gen, die Expression, also die Transkription und die Translation dieser Nukleinsäure oder dieses Gens reguliert. Man spricht deshalb auch in diesem Zusammenhang von einer „regulativen Nukleinsäuresequenz". Zusätzlich zum Mehrfachpromotor- Konstrukt können weitere, regulative Elemente, wie z.B. Enhancer, enthalten sein.
Unter einer „Expressionskassette" wird erfindungsgemäß eine Expressionseinheit verstanden, die mit der zu exprimierenden Nukleinsäure oder dem zu exprimierenden Gen funktionell verknüpft ist. Im Gegensatz zu einer Expressionseinheit umfasst eine Expressionskassette somit nicht nur Nukleinsäuresequenzen, welche Transkription und Translation regulieren, sondern auch die Nukleinsäuresequenzen, welche als Folge der Transkription und Translation als Protein exprimiert werden sollen.
Unter „Expressionsaktivität" wird erfindungsgemäß die in einer bestimmten Zeit durch die Expressionskassette bzw. deren Expressionseinheit gebildete Menge Protein, also die Expressionsrate verstanden.
Unter „spezifischer Expressionsaktivität" wird erfindungsgemäß die in einer bestimmten Zeit durch die Expressionskassette bzw. deren Expressionseinheit gebildete Menge Protein pro Expressionseinheit verstanden.
Bei einer „verursachten Expressionsaktivität" oder Expressionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp die Bildung eines Proteins verursacht, das im Wildtyp so nicht vorhanden war.
Bei einer „veränderten Expressionsaktivität" oder Expressionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit die gebildete Menge des Proteins verändert. Unter „verändert" wird in diesem Zusammenhang bevorzugt erhöht oder erniedrigt verstanden. Dies kann beispielsweise durch Erhöhung oder Reduzierung der spezifischen Aktivität der endogenen Expressionseinheit, beispielsweise durch Mutation, oder durch Stimulierung oder Hemmung erfolgen. Weiterhin kann die veränderte Expressionsaktivität oder Expressionsrate beispielsweise durch Regulation der Expression von Genen im Mikroorganismus durch erfindungsgemäße Expressionseinheiten erreicht werden, wobei die Gene im Bezug auf die Expressionseinheiten heterolog sind.
Die „Bildungsrate", mit der ein biosynthetisch aktives Protein hergestellt wird, ist ein Produkt aus der Rate der Transkription und der Translation. Beide Raten können erfindungsgemäß beeinflusst werden und damit die Rate der Bildung von Produkten/Feinchemikalien in einem Mikroorganismus beeinflussen.
Unter dem Begriff "Wildtyp" wird erfindungsgemäß der entsprechende Ausgangsmikro- Organismus verstanden und muss nicht zwingend einem natürlich vorkommenden Organismus entsprechen.
Je nach Zusammenhang kann unter dem Begriff „Mikroorganismus" der Ausgangsmikroorganismus (Wildtyp) oder ein erfindungsgemäßer, genetisch veränderter Mikroorga- nismus oder beides verstanden werden.
Vorzugsweise und insbesondere in Fällen, in denen der Mikroorganismus oder der Wildtyp nicht eindeutig zugeordnet werden kann, wird unter "Wildtyp" für die Veränderung oder Verursachung der Promotoraktivität oder Transkriptionsrate, für die Verände- rung oder Verursachung der Expressionsaktivität oder Expressionsrate und für die Erhöhung des Gehalts an biosynthetischen Produkten jeweils ein „Referenzorganismus" verstanden. In einer bevorzugten Ausführungsform ist dieser „Referenzorganismus" Corynebacterium glutamicum ATCC 13032 oder ein Mikroorganismus, der durch gezielte oder ungerichtete Mutation von ATCC 13032 abgeleitet ist.
Insbesondere werden „Ausgangsmikroorganismen" verwendet, die bereits in der Lage sind, das gewünschte Produkt (Feinchemikalie/Protein) herzustellen.
Unter einer „abgeleiteten" Sequenz, z.B. einer abgeleiteten Promotorsequenz, wird erfindungsgemäß, wenn keine anderen Angaben gemacht werden, eine Sequenz verstanden, die mit der Ausgangssequenz eine Identität von mindestens 80% oder mindestens 90%, insbesondere 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% und 99% aufweist.
Unter „Identität" zwischen zwei Nukleinsäuren wird die Identität der Nukleotide über die jeweils gesamte Nukleinsäurelänge verstanden, insbesondere die Identität, die durch Vergleich mit Hilfe der Vector NTI Suite 7.1 Software der Firma Informax (USA) unter Anwendung der Clustal Methode (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr;5(2):151-1) unter Einstellung folgender Parameter berechnet wird: Multiple alignment parameter:
Gap opening penalty 10
Gap extension penalty 10 Gap Separation penalty ränge 8
Gap Separation penalty off
% identity for alignment delay 40
Residue specific gaps off
Hydrophilic residue gap off Transition weighing 0
Pairwise alignment parameter: FAST algorithm on K-tuplesize 1 Gap penalty 3 Window size 5 Number of best diagonals 5
Unter "hybridisieren" versteht man die Fähigkeit eines PoIy- oder Oligonukleotids unter stringenten Bedingungen an eine nahezu komplementäre Sequenz zu binden, während unter diesen Bedingungen unspezifische Bindungen zwischen nicht-komplementären Partnern unterbleiben. Dazu sollten die Sequenzen vorzugsweise zu 90-100%, komplementär sein. Die Eigenschaft komplementärer Sequenzen, spezifisch aneinander binden zu können, macht man sich beispielsweise in der Northern- oder Southern-Blot- Technik oder bei der Primerbindung in PCR oder RT-PCR zunutze.
Die „Hybridisierung" erfolgt erfindungsgemäß unter stringenten Bedingungen. Solche Hybridisierungsbedingungen sind beispielsweise bei Sambrook, J., Fritsch, E. F., Mani- atis, T., in: Molecular Cloning (A Laboratory Manual), 2. Auflage, CoId Spring Harbor Laboratory Press, 1989, Seiten 9.31-9.57 oder in Current Protocols in Molecular Biolo- gy, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6 beschrieben. Unter stringenten Hybri- disierungs-Bedingungen werden insbesondere verstanden:
Die Inkubation bei 42°C über Nacht in einer Lösung bestehend aus 50 % Formamid, 5 x SSC (750 mM NaCI, 75 mM Tri-Natrium Citrat), 50 mM Natrium Phosphat (pH7,6), 5x Denhardt Lösung, 10% Dextransulfat und 20 g/ml denaturierte, gescheerte Lachsspermien-DNA, gefolgt von einem Waschschritt der Filter mit 0,1x SSC bei 65°C.
Unter einem „funktionell äquivalenten Fragment" werden für Nukleinsäuresequenzen mit Promotoraktivität Fragmente verstanden, die im wesentlichen die gleiche oder eine veränderte, niedrigere oder höhere spezifische Promotoraktivität aufweisen wie die Ausgangssequenz.
Unter „im wesentlichen gleich" wird eine spezifische Promotoraktivität verstanden die mindestens 50%, wie z.B. mindestens 60%, 70%, 80%, 90%, oder mindestens 95% der spezifischen Promotoraktivität der Ausgangssequenz aufweist.
II. Expressionseinheiten, Expressionskassetten und deren Komponenten
a) Expressionseinheiten
Die vorliegende Erfindung betrifft unter anderem die Bereitstellung einer Mehrfachpro- motor-enthaltenden Expressionseinheit, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel (I)
5l-P1-(-Ax-Px-)n-VPy3I
worin n für einen ganzzahligen Wert von 0 bis 10, wie z. B.1 , 2, 3, 4, 5 oder 6 steht;
Ax und Ay gleich oder verschieden sind und für eine chemische, insbesondere kovalen- te, Bindung oder eine chemisch, insbesondere kovalent eingebundene, Linker- Nukleinsäuresequenz stehen;
P1, Px und Py für gleiche oder verschiedene Promotorsequenzen kodieren, welche wenigstens einen RNA-Polymerase-bindenden Bereich, wie z.B. eine Kernregion, umfassen; und wenigstens, wie z.B. nur, Py einen, die Ribosomenbindung vermittelnden, 3'- terminalen Sequenzabschnitt umfasst.
Die Promotorsequenzen P1, Px und Py können von Genen aus Organismen abgeleitet, die für Proteine kodieren, welche an einem Biosyntheseweg des Organismus beteiligt sind. Die Promotorsequenzen liegen dabei im Genom des Organismus 20 bis 500 Nukleotidreste, oder 20 bis 300 Nukleotidreste, beispielsweise 20 bis 210 Nukleo- tidreste und insbesondere 20 bis 100 oder 35 bis 100 Nukleotidreste 5'-stromaufwärts von der kodierenden Sequenz des jeweiligen Proteins.
Beispiele für Sequenzen, von denen Promotorsequenzen P1, Px und Py abgeleitet wer- den können, sind die in folgender Tabelle 1 angeführten Gene.
Nichtlimitierende Beispiele für spezielle Promotorsequenzen sind abgeleitet von den Nukleinsäuresequenzen nach SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4, sowie Figur 1 , ohne jedoch darauf beschränkt zu sein. Dabei entspricht SEQ ID NO: 1 der Sequenz, die stromauf gelegen ist von der kodierenden Region des GroES Chaperonins (pGRO), SEQ ID NO:2 der Sequenz, die stromauf gelegen ist von der kodierenden Region des Protein Elongations Faktor TS (pEFTs), SEQ ID NO.3 der Sequenz, die stromauf gelegen ist von der kodierenden Region des Protein Elongationsfaktor TU (pEFTu) und SEQ ID NO:4 der Sequenz, die stromauf gelegen ist von der kodierenden Region der Superoxiddismutase (pSOD), jeweils aus Corynebacterium glutamicum. SEQ. ID. NO. 1 , SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4 entsprechen den Promotorsequenzen des Wildtyps.
Unter einer „abgeleiteten" Sequenz wird erfindungsgemäß eine Sequenz verstanden, die mit der Ausgangssequenz eine Identität von mindestens 80% oder mindestens 90%, wie 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% und insbesondere 99% aufweist. Dieser Identitätsgrad gilt insbesondere für die oben definierte „Kernregion" des jeweiligen Promotors. Außerhalb der jeweiligen Kernregion kann dabei der Identitäts- grad geringer sein, und im Bereich von 0 bis 80%, wie z.B. 10 bis 80%, 20 bis 70% , 30 bis 60% oder 40 bis 50% betragen.
Brauchbare Kernregionen liegen z.B. für pGRO im Bereich von Position 50 bis 80 von SEQ ID NO: 1 ; für pEFTs im Bereich von Position 130 bis 170 von SEQ ID NO:2; Für pEFTu im Bereich von Position 30 bis 110 von SEQ ID NO:3; für pSOD im Bereich von Position 50 bis 100 von SEQ ID NO:4.
Die erfindungsgemäßen Expressionseinheiten enthalten insbesondere zwei oder mehr Nukleinsäuresequenzen mit Promotoraktivität, a) vorzugsweise abgeleitet von gleichen oder verschiedenen Sequenzen, ausgewählt unter SEQ. ID. NO. 1 , SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4; oder anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz; b) wobei gegebenenfalls eine oder mehrere dieser Sequenzen eine durch Substitution, Insertion, Inversion oder Deletion oder Addition von Nukleotiden abgeleitete Sequenz darstellen, die insbesondere im Kernbereich, eine Identität von mindestens 80 % auf Nukleinsäureebene mit einer vorzugsweise unter Sequenz SEQ ID NO: 1 , 2, 3 oder 4 oder anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz ausgewählten Sequenz aufweist, c) oder wobei gegebenenfalls eine oder mehrere dieser enthaltenen Nukleinsäuresequenzen mit einer Sequenz unter stringenten Bedigungen hybridisiert, die zu einer der Nukleinsäuresequenzen gemäß SEQ ID NO: 1 , 2, 3 oder 4 und oder zu anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz komplementär ist, d) oder wobei gegebenenfalls eine oder mehrere dieser enthaltenen Nukleinsäu- resequenzen als „funktionell äquivalente Fragmente" der Sequenzen unter a), b) oder c) vorliegen.
Weitere natürliche Promotoren, die als Bestandteil eines erfindungsgemäßen Mehrfachpromotors brauchbar sind, lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, durch Identitätsvergleiche der Nuk- leinsäuresequenzen aus Datenbanken mit den vorstehend beschriebenen Sequenzen SEQ ID NO: 1 , 2, 3 oder 4 oder gemäß Figur 1 oder anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz leicht auffinden.
Weitere geeignete natürliche Promotoren lassen sich ausgehend von den vorstehend beschriebenen Nukleinsäuresequenzen, insbesondere ausgehend von Sequenz SEQ ID NO: 1 , 2, 3 oder 4 und/oder Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz aus verschiedenen Organismen, deren genomische Sequenz nicht bekannt ist, unter Anwendung von Hybridisierungstechniken in an sich bekannter Weise leicht auffinden.
Weitere geeignete natürliche Promotoren lassen sich auch nach dem Fachmann be- kannten Methoden isolieren, wie sie z.B. in Cadenas et al (1991) Gene 98, 117-121 ;
Eikmanns et al, (1991) Gene 102, 93-98.; Patek et al (1996) Microbiology 142, 1297-
1309 oder Santamaria et al (1987) Gene 56, 199-208 beschrieben sind. Üblicherweise werden dazu sogenannte „Promoter probe" Vektoren verwendet, in die genomische
Fragmente aus dem betreffenden Genom inseriert werden. Die Promoteraktivität eines einzelnen Fragmentes kann in dem genannten experimentellen Setup dann durch
Messen der Aktivität eines nachgeschalteten Reportergens, z.B. Chloramphenicol-
Acetyltransferase, bestimmt werden.
Die Erfindung umfasst daher auch die Kombination von solchen Promotoren, die hier nicht namentlich aufgeführt sind. Dies trifft auch zu für die Kombination von schon bekannten Einzelpromotoren, wie sie z.B. in (Patek et al (2003). J of Biotechnology 104, 311-323; Vasicova et al. (1999) J. Bacteriol 181 , 6188—6191) beschrieben sind.
Ein weiterer Gegenstand der Erfindung betrifft daher Nukleinsäuren mit Promotoraktivi- tat zum Einbau in eine erfindungsgemäße, Mehrfachpromotoren-enthaltende Expressionseinheit, wobei die Nukleinsäuren mit Promotoraktivität eine Nukleinsäuresequenz umfassen, die mit der Nukleinsäuresequenz SEQ ID NO: 1 , 2, 3 oder 4 oder Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz unter stringenten Bedingungen hybridisiert. Diese Nukleinsäuresequenz umfasst mindestens 10, bevorzugt mehr als 12, 15, 30, 50 oder mehr als 150 Nukleotide. Künstliche Promotorsequenzen zum Einbau in eine erfindungsgemäße, Mehrfachpro- motor-enthaltende Expressionseinheit lassen sich ausgehend von der Sequenz SEQ ID NO: 1 , 2, 3 oder 4 oder gemäß Figur 1 und/oder Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz durch künstliche Variation und Mutation, beispielsweise durch Addition, Substitution, Insertion, Inversion oder Deletion von einem oder mehreren, einzelnen oder zusammenhängenden Nukleotidresten leicht herstellen. (Patek et al (2003). J of Biotechnology 104, 311-323; Vasicova et al. (1999) J. bacteriol 181 , 6188 — 6191) und darin genannte Referenzen).
Geeignete Ribosomenbindung vermittelnde 3'-terminale Sequenzabschnitte einer Promotorsequenz Py sind beispielsweise die RBS von pGRO: GGAGGGA; die RBS von pEFTs: AGGAGGA; die RBS von pEFTu: AGGAGGA; sowie die RBS von pSOD : GGAGGGA ( vgl. auch beiliegenden Figur 1). Die theoretisch optimale RBS, d.h. die Sequenz die 100% komplementär ist zur Anti-Shine-Dalgarno-Sequenz auf der 16S rRNA von C. glutamicum lautet: 5' GAAAGGAGG 3'. Weitere geeignete RBS Sequenzabschnitte lassen sich beispielsweise durch künstliche Variation und Mutation, beispielsweise durch Substitution, Insertion, Inversion, Addition oder Deletion von Nukleotiden herstellen, oder über Homologievergleiche mit Promotorsequenzen in Da- tenbanken leicht auffinden.
Nichtlimitierende Beispiele für erfindungsgemäße, Mehrfachpromotoren-enthaltende Expressionseinheiten sind ausgewählt unter: e) Sequenzen, kodierend für PeftuPsod, von Position 18 bis 390 in SEQ ID NO: 45;
PsodPeftu, von Position 18 bis 395 in SEQ ID NO: 52;
PgroPsod, von Position 18 bis 369 in SEQ ID NO: 55;
PgroPsodPefts, von Position 11 bis 538 in SEQ ID NO: 59;
PeftuPsod Pefts; von Position 11 bis 559 in SEQ ID NO: 60; oder f) von Sequenzen gemäß e) durch Substitution, Insertion, Inversion, Addition oder Deletion von Nukleotiden abgeleitete Sequenzen, die im Vergleich mit dieser Ausgangssequenz eine Identität von mindestens 80 % oder mindestens 90% auf Nukleinsäureebene aufweist; oder g) Nukleinsäuresequenzen, die mit einer zu e) komplementären Sequenz unter stringenten Bedingungen hybridisiert; oder h) „funktionell äquivalenten Fragmente" der vorstehend genannten Sequenzen e), f) und g). Unter einem „funktionell äquivalenten Fragment", insbesondere gemäß den Ausführungsformen d) und h), werden für Expressionseinheiten, Fragmente verstanden, die im wesentlichen die gleiche oder eine höhere spezifische Expressionsaktivität aufwei- sen wie die Ausgangssequenz.
Unter „im wesentlichen gleich" wird eine spezifische Expressionsaktivität verstanden die mindestens 50%, vorzugsweise 60%, bevorzugter 70%, bevorzugter 80%, bevorzugter 90%, besonders bevorzugt 95% der spezifischen Expressionsaktivität der Aus- gangssequenz aufweist.
Unter „Fragmente" werden Teilsequenzen der durch Ausführungsform a) bis h) beschriebenen Sequenzen verstanden. Vorzugsweise weisen diese Fragmente mehr als 10, bevorzugter aber mehr als 12,15, 30, 50 oder besonders bevorzugt mehr als 150 zusammenhängende Nukleotide der Ausgangssequenz auf.
Die erfindungsgemäßen Expressionseinheiten können vorzugsweise eines oder mehrere der folgenden genetischen Elemente umfassen: eine -10-Region; einen Transkriptionsstart, eine Enhancer Region; und eine Operator Region.
Vorzugsweise sind diese genetischen Elemente spezifisch für die Spezies Corynebac- terien, speziell für Corynebacterium glutamicum.
Bakterielle Promotoren bestehen normalerweise aus drei RNA-Polymerase Erkennungsstellen, nämlich der -10-Region, der -35-Region und dem UP-Element.
Diese Promotorelemente sind in E. coli stark konserviert, nicht jedoch in C. glutamicum. Dies trifft in besonderem Maße für die -35-Region zu. Diese kann daher oft gar nicht oder nur unzuverlässig von der Sequenz abgeleitet werden. Auch die -10-
Region ist weniger stark konserviert als in Organismen mit AT-reichen Genomen. Als Konsensus-Sequenzen sind hier TGNGNTA(C/T)AATGG oder GNTANAATNG vorbeschrieben (Patek et al (2003), J. of Biotechnology 104, 311-323; Vasicova et al.
(1999) J. Bacteriol 181 , 6188—6191).
Es ist allgemein bekannt, dass bei Bakterien mit moderatem oder hohem GC-Gehalt (wie z.B. C. glutamicum) im allgemeinen eine hohe Variabilität in den Konsensus- Sequenzen auftritt (Bourn and Babb, 1995., Bashyam et al, 1996). Dies gilt besonders für die -35-Region, die daher oft nicht vorhergesagt werden kann. Dies ist z.B. in Patek et al (2003). J of Biotechnology 104, 325-334 beschrieben. b) Expressionskassetten
Die Erfindung betrifft ferner die erfindungsgemäßen, Mehrfachpromotoren- enthaltenden Expressionseinheiten, funktionell verknüpft mit einer translatierbaren Nukleinsäuresequenz. Diese zur Expression von Genen befähigten Konstrukte werden und im Rahmen der Erfindung auch als Expressionskassetten bezeichnet.
Unter einer „funktionellen Verknüpfung" versteht man in diesem Zusammenhang beispielsweise die sequentielle Anordnung einer der erfindungsgemäßen Expressionsein- heiten und einer transgen zu exprimierenden Nukleinsäuresequenz und ggf. weiterer regulativer Elemente, wie zum Beispiel einem Terminator, derart, dass jedes der regulativen Elemente eine Funktion bei der transgenen Expression der Nukleinsäuresequenz erfüllen kann. Dazu ist nicht unbedingt eine direkte Verknüpfung im chemischen Sinne erforderlich. Genetische Kontrollsequenzen, wie zum Beispiel Enhancer- Sequenzen, können ihre Funktion auch von weiter entfernten Positionen oder gar von anderen DNA-Molekülen aus auf die Zielsequenz ausüben. Bevorzugt sind Anordnungen, in denen die transgen zu exprimierende Nukleinsäuresequenz hinter (d.h. am 3'- Ende) der erfindungsgemäßen Expressionseinheitssequenz positioniert wird, so dass beide Sequenzen kovalent miteinander verbunden sind. Bevorzugt ist dabei der Ab- stand zwischen der Expressionseinheitssequenz und der transgen zu exprimierende Nukleinsäuresequenz geringer als 200 Basenpaare, besonders bevorzugt kleiner als 100 Basenpaare, ganz besonders bevorzugt kleiner als 50 Basenpaare.
Durch die erfindungsgemäßen, Mehrfachpromotoren enthaltenden Expressionskasset- ten wird die Möglichkeit geschaffen, eine im Vergleich zur ursprünglichen Expressionsaktivität unterschiedliche Expressionsaktivität zu erreichen und somit eine Feinregulierung der Expression des gewünschten Gens vorzunehmen.
Vorzugsweise wird die Regulation der Expression von Genen im Mikroorganismus durch erfindungsgemäße Expressionseinheiten dadurch erreicht, dass man
- eine oder mehrere erfindungsgemäße Expressionseinheiten, gegebenenfalls mit veränderter spezifischer Expressionsaktivität, in das Genom des Mikroorganismus einbringt, so dass die Expression eines oder mehrerer endogener Gene unter der Kontrolle der eingebrachten erfindungsgemäßen Expressionseinheiten erfolgt; oder
- ein oder mehrere Nukleinsäurekonstrukte, enthaltend eine erfindungsgemäße Expressionseinheit, gegebenenfalls mit veränderter spezifischer Expressionsaktivität, und funktionell verknüpft eine oder mehrere, zu exprimierende Nukleinsäuren, d.h. eine Expressionskassettβr in den Mikroorganismus einbringt. In den erfindungsgemäßen Expressionskassetten ist die physikalische Lage der Expressionseinheit relativ zum zu exprimierenden Gen so gewählt, dass die Expressionseinheit die Transkription und vorzugsweise auch die Translation des zu exprimierenden Gens reguliert und damit die Bildung eines oder mehrerer Proteine ermöglicht. Die "Bildung ermöglichen" beinhaltet dabei die konstitutive Steigerung der Bildung, Abschwächung bzw. Blockierung der Bildung unter spezifischen Bedingungen und /oder die Steigerung der Bildung unter spezifischen Bedingungen. Die "Bedingungen" umfassen dabei: (1) Zugabe einer Komponente zum Kulturmedium, (2) Entfernen einer Komponente vom Kulturmedium, (3) Austausch einer Komponente im Kulturmedium durch eine zweite Komponente, (4) Erhöhung der Temperatur des Kulturmediums, (5) Erniedrigung der Temperatur des Kulturmediums, und (6) Regulierung der atmosphärischen Bedingungen, wie z.B. die Sauerstoff- oder Stickstoffkonzentration, in der das Kulturmedium gehalten wird.
c) Allgemeine Angaben:
Alle vorstehend erwähnten Nukleinsäuren mit Promotoraktivität sowie Expressionseinheiten und Expressionskassetten sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen, wie beispielsweise durch Fragmentkondensation, einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, S. 896-897) erfolgen. Die Anlagerung synthetischer OM- gonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA- Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, CoId Spring Harbor Laboratory Press, beschrieben.
Für die vorliegende Erfindungen wurden Methoden und Techniken genutzt, die dem Fachmann, der in mikrobiologischen und rekombinanten DNA-Techniken geübt ist, bekannt sind. Methoden und Techniken für das Wachstum von Bakterienzellen, das Einschleusen von isolierten DNA-Molekülen in die Wirtszelle, und die Isolierung, KIo- nierung und Sequenzierung von isolierten Nukleinsäuremolekülen usw. sind Beispiele für solche Techniken und Methoden. Diese Methoden sind in vielen Standardliteraturstellen beschrieben: Davis et al., Basic Methods In Molecular Biology (1986); J. H. Miller, Experiments in Molecular Genetics, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, New York (1972); J. H. Miller, A Short Course in Bacterial Genetics, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, New York (1992); M. Singer and P. Berg, Genes & Genomes, University Science Books, MiII Valley, Carlifornia (1991); J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed., CoId Spring Harbor Laboratory Press, CoId Spring Harbor, New York (1989); P.B. Kaufmann et al., Handbook of Molcular and Cellular Methods in Biology and Medicine, CRC Press, Boca Raton, Florida (1995); Methods in Plant Molecular Biology and Biotechnology, B.R. Glick and J.E. Thompson, eds., CRC Press, Boca Raton, Florida (1993); and P. F. Smith-Keary, Molecular Genetics of Escherichia coli, The Guilford Press, New York, NY (1989).
Alle Nukleinsäuremoleküle der vorliegenden Erfindung liegen bevorzugt in Form eines isolierten Nukleinsäuremoleküls vor. Ein "isoliertes" Nukleinsäuremolekül wird von anderen Nukleinsäuremolekülen abgetrennt, die in der natürlichen Quelle der Nukleinsäure zugegen sind und kann überdies im wesentlichen frei von anderem zellulären Material oder Kulturmedium sein, wenn es durch rekombinante Techniken hergestellt wird, oder frei von chemischen Vorstufen oder anderen Chemikalien sein, wenn es chemisch synthetisiert wird.
Die Erfindung umfasst weiterhin die zu den konkret beschriebenen Nukleotidsequen- zen komplementären Nukleinsäuremoleküle oder einen Abschnitt davon.
Die erfindungsgemäßen Nukleotidsequenzen ermöglichen ferner die Erzeugung von Sonden und Primern, die zur Identifizierung und/oder Klonierung von homologer Sequenzen in anderen Zelltypen und Mikroorganismen verwendbar sind. Solche Sonden bzw. Primer umfassen gewöhnlich einen Nukleotidsequenzbereich, der unter stringeπ- ten Bedingungen an mindestens etwa 12, vorzugsweise mindestens etwa 25, wie z.B. etwa 40, 50 oder 75 aufeinanderfolgende Nukleotide eines Sense-Stranges einer erfindungsgemäßen Nukleinsäuresequenz oder eines entsprechenden Antisense-Stranges hybridisiert.
Erfindungsgemäß umfasst sind auch solche Nukleinsäuresequenzen, die sogenannte stumme Mutationen umfassen oder entsprechend der Codon-Nutzung eins speziellen Ursprungs- oder Wirtsorganismus, im Vergleich zu einer konkret genannten Sequenz verändert sind, ebenso wie natürlich vorkommende Varianten, wie z.B. Spleißvarianten oder Allelvarianten, davon.
III. Expressionsvektoren
Die Erfindung betrifft ferner Expressionsvektoren, enthaltend eine vorstehend beschriebene, erfindungsgemäße Expressionskassette. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden. Unter Vektoren sind außer Plasmiden auch alle anderen dem Fachmann bekannten Vektoren, wie beispielsweise Phagen, Transposons, IS- Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA zu verstehen. Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden.
Als Plasmide eignen sich solche besonders bevorzugt, die in coryneformen Bakterien repliziert werden. Zahlreiche bekannte Plasmidvektoren, wie z. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExi (Eikmanns et al., Gene 102: 93-98 (1991)) oder pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) beruhen auf den kryptischen Plasmiden pHM1519, pBL1 oder pGA1. Andere Plasmidvektoren, wie z. B. pCLiK5MCS (siehe Beispiel 1), oder solche, die auf pCG4 (US-A 4,489,160) oder pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) oder pAG1 (US-A 5,158,891) beruhen, können in gleicher Weise verwendet werden.
Weiterhin eignen sich auch solche Plasmidvektoren mit Hilfe derer man das Verfahren der Genamplifikation durch Integration in das Chromosom anwenden kann, so wie es beispielsweise von Remscheid et al. (Applied and Environmental Microbiology 60,126- 132 (1994)) zur Duplikation bzw. Amplifikation des hom-thrB-Operons beschrieben wurde. Bei dieser Methode wird das vollständige Gen in einen Plasmidvektor kloniert, der in einem Wirt (typischerweise E. coli), nicht aber in C. glutamicum replizieren kann. Als Vektoren kommen beispielsweise pSUP301 (Simon et al., Bio/ Technology 1 ,784- 791 (1983)), pK18mob oder pK19mob (Schäfer et al., Gene 145,69-73 (1994)), Bernard et al., Journal of Molecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991 , Journal of Bacteriology 173: 4510-4516) oder pBGSδ (Spratt et al.,1986, Gene 41 : 337-342) in Frage. Der Plasmidvektor, der das zu amplifizierende Gen enthält, wird anschließend durch Transformation in den gewünschten Stamm von C. glutamicum überführt. Methoden zur Transformation sind beispielsweise bei Thierbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican und Shivnan (Biotechnology 7, 1067-1070 (1989)) und Tauch et al. (FEMS Microbiological Letters 123,343-347 (1994)) beschrieben.
IV. Gene und davon kodierte Proteine
Die Veränderung oder Verursachung der Transkriptionsrate und/oder der Translationsrate von Genen in Mikroorganismen im Vergleich zum Wildtyp kann dadurch erfolgen, dass man die Transkription von Genen im Mikroorganismus durch erfindungsgemäße Expressionseinheiten reguliert, wobei die Gene in Bezug auf die Expressionseinheiten heterolog sind.
Dies wird bevorzugt dadurch erreicht, dass man
- eine oder mehrere erfindungsgemäße Nukleinsäuren mit Promotoraktivität in das Genom des Mikroorganismus einbringt, so dass die Transkription eines o- der mehrerer endogenen Gene unter der Kontrolle der eingebrachten Nukleinsäure mit Promotoraktivität, gegebenenfalls mit veränderter spezifischer Promo- toraktivität, erfolgt oder
- ein oder mehrere Nukleinsäurekonstrukte, enthaltend eine erfindungsgemäße Nukleinsäure mit Promotoraktivität und funktionell verknüpft eine oder mehrere, zu transkribierende exogener oder endogener Nukleinsäuren, in den Mikroorganismus einbringt.
Werden ein oder mehrere Gene in das Genom eines Mikroorganismus eingebracht, so dass die Transkription eines oder mehrerer eingebrachter Gene unter der Kontrolle der erfindungsgemäßen Nukleinsäuren erfolgt, dann kann die Insertion so erfolgen, dass das Gen bzw. die Gene in kodierende oder nicht kodierende Bereiche integriert wird/werden. Vorzugsweise erfolgt die Insertion in nicht kodierende Bereiche.
Die Insertion von Nukleinsäurekonstrukten kann dabei chromosomal oder extrachromosomal erfolgen. Vorzugsweise erfolgt die Insertion der Nukleinsäurekonstrukte chromosomal. Eine „chromosomale" Integration ist die Insertion eines DNA- Fragmentes in das Chromosom einer Wirtszelle.
Unter „endogen" werden genetische Informationen, wie beispielsweise Gene, verstanden, die bereits im Wildtypgenom (wie oben definiert) enthalten sind.
Unter „exogen" werden genetische Informationen, wie beispielsweise Gene, verstanden, die im Wildtypgenom nicht enthalten sind. Werden exogene genetische Informationen, beispielsweise die erfindungsgemäßen Mehrfachpromotoren-enthaltenden Expressionseinheiten, in das Genom eines Wildtypstammes eingebracht und dadurch ein genetisch veränderter Stamm erzeugt, so sind diese genetischen Informationen im Vergleich des erstmals erzeugten genetischen Stammes mit seinen Nachkommen endogen, dagegen exogen im Vergleich mit dem ursprünglichen Wildtypstamm, der diese genetischen Informationen nicht enthielt.
Unter dem Begriff „Gene" in Bezug auf Regulation der Transkription durch die erfin- dungsgemäßen Nukleinsäuren mit Promotoraktivität werden vorzugsweise Nukleinsäu- ren verstanden, die einen zu transkribierenden Bereich, also beispielsweise einen Bereich der die Translation reguliert, einen kodierenden Bereich, sowie gegebenenfalls weitere Regulationselemente, wie beispielsweise einen Terminator, enthalten.
Unter dem Begriff „Gene" in Bezug auf die Regulation der Expression durch die erfindungsgemäßen Expressionseinheiten werden vorzugsweise Nukleinsäuren verstanden, die einen kodierenden Bereich, sowie gegebenenfalls weitere Regulationselemente, wie beispielsweise einen Terminator, enthalten.
Unter einem „kodierenden Bereich" wird eine Nukleinsäuresequenz verstanden, die ein Protein kodiert.
Unter „heterolog" in Bezug auf Nukleinsäuren mit Promotoraktivität und Gene wird verstanden, dass die verwendeten Gene im Wildtyp nicht unter Regulation der ertϊn- dungsgemäßen Nukleinsäuren mit Promotoraktivität transkribiert werden, sondern das eine neue, im Wildtyp nicht vorkommende funktionelle Verknüpfung entsteht und die funktionelle Kombination aus erfindungsgemäßer Nukleinsäure mit Promotoraktivität und spezifischem Gen im Wildtyp nicht vorkommt.
Unter „heterolog" in Bezug auf Expressionseinheiten und Gene wird verstanden, dass die verwendeten Gene im Wildtyp nicht unter Regulation der erfindungsgemäßen Expressionseinheiten exprimiert werden, sondern das eine neue, im Wildtyp nicht vorkommende funktionelle Verknüpfung entsteht und die funktionelle Kombination aus erfindungsgemäßer Expressionseinheit und spezifisches Gen im Wildtyp nicht vor- kommt.
In einer bevorzugten Ausführungsform der vorstehend beschriebenen erfindungsgemäßen Verfahren zur Veränderung oder Verursachung der Transkriptionsrate und/oder Expressionsrate von Genen in Mikroorganismen sind die Gene ausgewählt aus der Gruppe Nukleinsäuren kodierend ein Protein aus den Biosyntheseweg von Feinchemikalien, wobei die Gene gegebenenfalls weitere Regulationselemente enthalten können.
In einer besonders bevorzugten Ausführungsform der vorstehend beschriebenen erfindungsgemäßen Verfahren zur Veränderung oder Verursachung der Transkriptionsrate und/oder Expressionsrate von Genen in Mikroorganismen sind die Gene ausgewählt unter:
Nukleinsäuren, kodierend ein Protein aus den Biosyntheseweg von proteinogenen und nicht-proteinogenen Aminosäuren, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Nukleotiden und Nukleosiden, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von organischen Säuren, Nukleinsäuren kodierend ein Pro- tein aus dem Biosyntheseweg von Lipiden und Fettsäuren, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Diolen, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Kohlenhydraten, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von aromatischen Verbindung, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Vitaminen, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Cofaktoren und Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Enzymen, Nukleinsäuren kodierend ein Protein aus dem Zentralstoffwechsel, wobei die Gene gegebenenfalls weitere Regulationselemente enthalten können.
In einer besondere bevorzugten Ausführungsform sind die Proteine aus dem Biosyntheseweg von Aminosäuren ausgewählt, nämlich:
Aspartatkinase, Aspartat-Semialdehyd-Dehydrogenase, Diaminopimelat-
Dehydrogenase, Diaminopimelat-Decarboxylase, Dihydrodipicolinate-Synthetase, Di- hydrodipicolinate-Reduktase, Glycerinaldehyd-3-Phosphat-Dehydrogenase, 3- Phosphoglycerat-Kinase, Pyruvat-Carboxylase, Triosephosphat-Isomerase, Transkrip- tioneller Regulator LuxR, Transkriptioneller Regulator LysR1 , Transkriptioneller Regulator LysR2, Malat-Quinon-Oxidoreduktase, Glucose-6-Phosphat-Deydrogenase, 6- Phosphogluconat-Dehydrognease, Transketolase, Transaldolase, Homoserin-O- Acetyltransferase, Cystahionin-gamma-Synthase, Cystahionin-beta-Lyase, Serin- Hydroxymethyltransferase, O-Acetylhomoserin-Sulfhydrylase, Methylen-
Tetrahydrofolat-Reduktase, Phosphoserin-Aminotransferase, Phosphoserin-
Phosphatase, Serin-Acetyl-Transferase, Homoserin-Dehydrogenase, Homoserin- Kinase, Threonin-Synthase, Threonin-Exporter-Carrier, Threonin-Dehydratase, Pyru- vat-Oxidase, Lysin-Exporter, Biotin-Ligase, Cystein-Synthasel, Cystein-Synthase II, Coenzym B12-abhängige Methionin-Synthase, Coenzym B12-unabhängige Methionin- Synthase-Aktivität, Sulfatadenyltransferase Untereinheit 1 und 2, Phosphoadenosin Phosphosulfat Reduktase, Ferredoxin-sulfit-reductase, Ferredoxin NADP Reduktase, 3-Phosphoglycerat Dehydrogenase, RXA00655 Regulator, RXN2910-Regulator, Argi- nyl-t-RNA-Synthetase, Phosphoenolpyruvat-Carboxylase, Threonin Efflux-Protein, Se- rinhydroxymethyltransferase, Fruktose-1 ,6-bisphosphatase, Protein der Sulfat- Reduktion RXA077, Protein der Sulfat-Reduktion RXA248, Protein der Sulfat- Reduktion RXA247, Protein OpcA, 1-Phosphofruktokinase , 6-Phosphofruktokinase, Tetrahydropicolinat-Succinylase, Succinyl-aminoketopimelat-Aminotransferase, Succi- nyl-Diaminopimelat-Desuccinylase, Diaminopimelat-Epimerase, 6-Phosphogluconat- Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase, Malat-Enzym.
Bevorzugte Proteine und Nukleinsäuren, kodierend diese Proteine sind Proteinsequen- zen bzw. Nukleinsäuresequenzen mikrobiellen Ursprungs, vorzugsweise aus Bakterien der Gattung Corynebacterium oder Brevibacterium, bevorzugt aus coryneformen Bakterien, besonders bevorzugt aus Corynebacterium glutamicum.
Beispiele für besonders bevorzugte Proteinsequenzen und die entsprechenden Nuk- leinsäuresequenzen, kodierend diese Proteine aus dem Biosyntheseweg von Aminosäuren, deren Bezugsdokument, sowie deren Bezeichnung im Bezugsdokument sind in Tabelle 1 aufgelistet:
Tabelle 1
Aus den oben aufgelisteten Genen ist bevorzugt das erfindungsgemäß zu regulierende Target-Gen G ausgewählt.
Weitere besonders bevorzugte Proteinsequenzen aus dem Biosyntheseweg von Aminosäuren, weisen jeweils die in Tabelle 1 für dieses Protein angegebene Aminosäuresequenz auf, wobei das jeweilige Protein jeweils an mindestens einer der in Tabelle 2, Spalte 2 für diese Aminosäuresequenz angegebenen Aminosäurepositionen eine andere proteinogene Aminosäure aufweist als die jeweilige, in Tabelle 2, Spalte 3 in der gleichen Zeile angegebene Aminosäure. In einer weiter bevorzugten Ausführungsform, weisen die Proteine an mindestens einer der in Tabelle 2, Spalte 2 für die Aminosäuresequenz angegebenen Aminosäureposition die in Tabelle 2, Spalte 4 in der gleichen Zeile angegebene Aminosäure auf. Es handelt sich bei den in Tabelle 2 angegebenen Proteinen um mutierte Proteine des Biosyntheseweges von Aminosäuren, die besonders vorteilhafte Eigenschaften aufweisen und sich deshalb insbesondere zur Expression der entsprechenden Nukleinsäuren durch ein erfindungsgemäßes Promotorkon- strukt und zur Herstellung von Aminosäuren eignen. Beispielsweise führt die Mutation T311 I zu einem Ausschalten der feedback-lnhibierung von ask.
Die entsprechenden Nukleinsäuren, die ein vorstehend beschriebenes mutiertes Protein aus Tabelle 2 kodieren, lassen sich durch übliche Verfahren herstellen.
Als Ausgangspunkt zur Herstellung der Nukleinsäuresequenzen, kodierend ein mutier- tes Protein, eignet sich beispielsweise das Genom eines Corynebacterium glutamicum-
Stammes, der von der American Type Culture Collection unter der Bezeichnung ATCC
13032 erhältlich ist oder die in Tabelle 1 in Bezug genommenen Nukleinsäuresequen- zen. Für die Rückübersetzung der Aminosäuresequenz der mutierten Proteine in die Nukleinsäuresequenzen, kodierend diese Proteine ist es vorteilhaft, die codon usage desjenigen Organismus zu verwenden, in den die Nukleinsäuresequenz eingebracht werden soll oder in der die Nukleinsäuresequenz vorliegt. Beispielsweise ist es vortei- haft für Corynebacterium glutamicum die codon usage von Corynebacterium glutami- cum zu verwenden. Die codon usage des jeweiligen Organismus lässt sich in an sich bekannter Weise aus Datenbanken oder Patentanmeldungen ermitteln, die zumindest ein Protein und ein Gen, das dieses Protein kodiert, aus dem gewünschten Organismus beschreiben.
Die Angaben in Tabelle 2 sind folgendermaßen zu verstehen:
In Spalte 1 "Identifikation" wird eine eindeutige Bezeichnung für jede Sequenz in Bezug auf Tabelle 1 aufgeführt.
In Spalte 2 "AS-POS" bezieht sich die jeweilige Zahl auf die Aminosäureposition der entsprechenden Polypeptidsequenz aus Tabelle 1. Eine "26" in der Spalte "AS-POS" bedeutet demzufolge die Aminosäureposition 26 der entsprechend angegebenen Polypeptidsequenz. Die Zählung der Position beginnt N-Terminal bei +1.
In Spalte 3 "AS-Wildtyp" bezeichnet der jeweilige Buchstabe die Aminosäure - dargestellt im Ein-Buchstaben-Code- an der in Spalte 2 angegebenen Position beim entsprechenden Wildtyp-Stamm der Sequenz aus Tabelle 1.
In Spalte 4 "AS-Mutante" bezeichnet der jeweilige Buchstabe die Aminosäure - dargestellt im Ein-Buchstaben-Code- an der in Spalte 2 angegebenen Position beim entsprechenden Mutanten-Stamm.
In Spalte 5 "Funktion" wird die physiologische Funktion der entsprechenden Polypep- tidsequenz aufgeführt.
Für ein mutiertes Protein mit einer bestimmten Funktion (Spalte 5) und einer bestimmten Ausgangsaminosäuresequenz (Tabelle 1) werden in den Spalten 2,3 und 4 mindestens eine Mutation, bei einigen Sequenzen auch mehrere Mutationen beschrieben. Diese mehreren Mutationen beziehen sich immer auf die jeweils obenstehende, nächstliegendste Ausgangsaminosäuresequenz (Tabelle 1). Unter dem Begriff „mindestens eine der Aminsäurepositionen" einer bestimmten Aminosäuresequenz wird vorzugsweise mindestens eine der für diese Aminosäuresequenz in Spalte 2, 3 und 4 beschriebenen Mutationen verstanden. Ein-Buchstaben-Code der proteinogenen Aminosäuren:
A Alanin I Isoleucin Q Glutamin C Cy stein K Lysin R Arginin D Aspartat L Leucin S Serin E Glutamat M Methionin T Threonin F Phenylalanin N Asparagin V Valin G Glycin P Prolin W Tryptophan H His Y Tyrosin
Tabelle 2
Genetisch veränderte Mikroorganismen
Das Einbringen der erfindungsgemäßen Expressionseinheiten, der vorstehend beschriebenen Gene und der vorstehend beschriebenen Nukleinsäurekonstrukte oder Expressionskassetten in den Mikroorganismus, insbesondere in coryneforme Bakterien, erfolgt nach dem Fachmann bekannten Methoden, wie Konjugation oder Elektropo- ration (wie z.B. Liebl et al (1989) FEMS Microbiology Letters 53, 299-303).
Die Selektion von integrierten Expressionskassetten erfolgt vorzugsweise durch die SacB-Methode. Die SacB-Methode ist dem Fachmann bekannt und beispielsweise in Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A.; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutami- cum, Gene. 1994 JuI 22;145(1):69-73 und Blomfield IC, Vaughn V, Rest RF, Eisenstein Bl.; Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon; Mol Microbiol. 1991 Jun;5(6): 1447-57 beschrieben. Bevorzugt werden erfindungsgemäß als Ausgangsmikroorganismen solche verwendet, welche das gewünschte Wertprodukt (Feinchemikalie/Protein) bereits produzieren.
Die Erfindung betrifft daher auch einen genetisch veränderten Mikroorganismus, der eine erfindungsgemäße Expressionskassette oder einen die erfindungsgemäße Expressionskassette umfassenden Vektor enthält.
Besonders bevorzugt betrifft die vorliegende Erfindung genetisch veränderte Mikroorganismen, insbesondere coryneforme Bakterien, die einen Vektor, insbesondere Pen- delvektor oder Plasmidvektor, der wenigstens eine erfindungsgemäße Expressionskassette trägt, enthalten.
Bevorzugte Mikroorganismen oder genetisch veränderte Mikroorganismen sind Bakterien, Algen, Pilze oder Hefen.
Besonders bevorzugte Mikroorganismen sind insbesondere coryneforme Bakterien.
Bevorzugte coryneforme Bakterien sind Bakterien der Gattung Corynebacterium, insbesondere der Arten Corynebacterium glutamicum, Corynebacterium acetoglutami- cum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola und Corynebacterium efficiens oder der Gattung Brevibacte- rium, insbesondere der Arten Brevibacterium flavum, Brevibacterium lactofermentum und Brevibacterium divaricatum.
Besonders bevorzugte Bakterien der Gattungen Corynebacterium und Brevibacterium sind ausgewählt aus der Gruppe Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens DSM 44547, Corynebacterium effi- ciens DSM 44548. Corynebacterium efficiens DSM 44549, Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869, Brevibacterium divaricatum ATCC 14020, Corynebacterium glutamicum KFCC 10065 und Corynebacterium glutamicum ATCC 21608 sowie Stämme, die davon abgeleitet sind, z.B. durch klassische Mutation und Selektion oder durch gerichtete Mutation.
Mit der Abkürzung KFCC ist die Korean Federation of Culture Collection gemeint, mit der Abkürzung ATCC die American type strain culture collection, mit der Abkürzung DSM (bzw. DSMZ) die Deutsche Sammlung von Mikroorganismen (Deutsche Sammlung von Mikroorganismen und Zellkulturen). Weitere besonders bevorzugte Bakterien der Gattungen Corynebacterium und Brevi- bacterium sind in Tabelle 3 aufgelistet:
Tabelle 3
Die Abkürzungen haben folgende Bedeutung
ATCC American Type Culture Collection, Rockville, MD, USA FERM Fermentation Research Institute, Chiba, Japan NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL, USA
CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK CBS: Centraalbureau voor Schimmelcultures, Baarn, NL NCTC: National Collection of Type Cultures, London, UK
DSMZ: Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany
Besonders bevorzugt sind dabei Mikroorganismen der Bakterien der Gattung Coryne- bacterium, insbesondere diejenigen, die bereits in der Lage sind, L-Lysin, L-Methionin und/oder L-Threonin herzustellen. Dies sind insbesondere Corynebakterien bei denen beispielsweise das Gen kodierend für eine Aspartatkinase (ask-Gen) dereguliert ist oder die feed-back-lnhibierung aufgehoben oder reduziert ist. Beispielsweise weisen solche Bakterien im ask-Gen eine Mutation auf, die zu einer Reduzierung oder Aufhebung der feed-back-lnhibierung führen, wie beispielsweise die Mutation T311 I.
Durch die erfindungsgemäßen Expressionseinheiten ist es möglich, in den vorstehend beschriebenen, erfindungsgemäßen genetisch veränderten Mikroorganismen die Stoffwechselwege zu spezifischen biosynthetischen Produkten zu regulieren.
Dazu werden beispielsweise Stoffwechselwege, die zu einem spezifischen biosyntheti- sehen Produkt führen, durch Verursachung oder Erhöhung der Transkriptionsrate bzw. Expressionsrate von Genen dieses Biosyntheseweges verstärkt in dem die erhöhte Proteinmenge zu einer erhöhten Gesamtaktivität dieser Proteine des gewünschten Biosyntheseweges und damit zu einem verstärkten Stoffwechselfluss zu dem gewünschten biosynthetischen Produkt führt.
Weiterhin können Stoffwechselwege, die von einem spezifischen biosynthetischen Produkt wegführen, durch Reduzierung der Transkriptionsrate bzw. Expressionsrate von Genen dieses wegführenden Biosyntheseweges abgeschwächt werden in dem die reduzierte Proteinmenge zu einer reduzierten Gesamtaktivität dieser Proteine des un- erwünschten Biosyntheseweges und damit zusätzlich zu einem verstärkten Stoffwechselfluss zu dem gewünschten biosynthetischen Produkt führt.
Die erfindungsgemäßen genetisch veränderten Mikroorganismen sind beispielsweise in der Lage aus Glucose, Saccharose, Lactose, Fructose, Maltose, Melasse, Stärke, Cellulose oder aus Glycerin und Ethanol biosynthetische Produkte herzustellen. Die Erfindung betrifft daher ein Verfahren zur Herstellung von biosynthetischen Produkten durch Kultivierung von erfindungsgemäßen, genetisch veränderten Mikroorganismen.
Je nach gewünschtem biosynthetischen Produkt muss die Transkriptionsrate bzw. Expressionsrate verschiedener Gene erhöht bzw. reduziert werden. In der Regel ist es vorteilhaft die Transkriptionsrate bzw. Expressionsrate mehrere Gene zu verändern, d.h. die Transkriptionsrate bzw. Expressionsrate einer Kombination von Gene zu Erhö- hen und/oder die Transkriptionsrate bzw. Expressionsrate einer Kombination von Gene zu reduzieren.
In den erfindungsgemäßen genetisch veränderten Mikroorganismen ist mindestens eine veränderte, das heißt erhöhte oder reduzierte Transkriptionsrate bzw. Expressi- onsrate eines Gens auf eine erfindungsgemäße Nukleinsäure mit Promotoraktivität bzw. erfindungsgemäße Expressionseinheit zurückzuführen.
Weitere, zusätzliche veränderte, d.h. zusätzlich erhöhte oder zusätzlich reduzierte Transkriptionsraten bzw. Expressionsraten von weiteren Genen im genetisch veränder- ten Mikroorganismus können, müssen aber nicht auf die erfindungsgemäßen Nukleinsäuren mit Promotoraktivität bzw. die erfindungsgemäßen Expressionseinheiten zurück gehen.
Die Erfindung betrifft deshalb weiterhin ein Verfahren zur Herstellung von biosyntheti- sehen Produkten durch Kultivierung von erfindungsgemäßen, genetisch veränderten Mikroorganismen.
V. Anwendungsgebiete der Erfindung
Die erfindungsgemäßen Mehrfachpromotoren-enthaltenden Expressionseinheiten, Expressionskassetten und Vektoren lassen sich beispielsweise besonders vorteilhaft in verbesserten Verfahren zur fermentativen Herstellung von biosynthetischen Produkten wie nachstehend beschrieben verwenden.
Die erfindungsgemäßen Mehrfachpromotoren-enthaltenden Expressionseinheiten oder diese umfassende Expressionskassetten weisen insbesondere den Vorteil auf, dass sie eine Modulation der Expression des funktionell verknüpften Strukturgens erlauben. Die erfindungsgemäßen Expressionseinheiten oder diese umfassende Expressionskassetten können zur Veränderung, also zur Erhöhung oder Reduzierung, oder zur Verursachung der Expressionsrate von Genen in Mikroorganismen im Vergleich zum Wildtyp verwendet werden. Dadurch wird die Möglichkeit bereitgestellt, im Falle einer Erhöhung der Expressionsrate die Expression des betreffenden Gens zu maximieren. Durch Wahl einer geeigneten Expressionseinheit kann die Expression aber auch in einer Stärke erfolgen, die unter dem durch eine andere Expressionseinheit erhältlichen Maximalwert liegt, gleichzeitig aber das Expressionsprodukt in einer für den exprimie- renden Mikroorganismus verträglicheren Menge liefert. Dies ist insbesondere dann vorteilhaft, wenn zu hohe Konzentrationen an Expressionsprodukt für den exprimieren- den Mikroorganismus toxisch sind. Die erfindungsgemäßen Expressionseinheiten ermöglichen somit durch Auswahl unter Expressionseinheiten mit jeweils unterschiedlicher Expressionsstärke die Feinregulierung der Expression auf einen - insbesondere bei Langzeitexpression - optimierten Wert.
Ferner können die erfindungsgemäßen Expressionseinheiten bzw. diese Expressionseinheiten umfassende Expressionskassetten zur Regulation und Verstärkung der Bildung von verschiedenen biosynthetischen Produkten, wie beispielsweise Feinchemika- lien, Proteinen, insbesondere Aminosäuren, in Mikroorganismen, insbesondere in Co- rynebacterium Species dienen.
Die Erfindung betrifft daher die Verwendung einer erfindungsgemäßen, Mehrfachpro- motoren-enthaltenden Expressionseinheit zur Regulation einer Produkt-Biosynthese. Dabei wird das Gen eines an der Regulation einer Produkt-Biosynthese beteiligten Proteins unter die Kontrolle einer solchen Expressionseinheit gestellt. Die Produkt- Biosynthese wird in Abhängigkeit der Transkriptionsrate der ausgewählten, Mehrfach- promotoren-enthaltenden Expressionseinheit beeinflusst. Alternativ kann das Gen eines an der Regulation einer Produkt-Biosynthese beteiligten Proteins als Bestandteil einer erfindungsgemäßen Expressionskassette in einem Mikroorganismus exprimiert werden und die Regulation der Produkt-Biosynthese durch das dadurch exprimierte Protein erfolgen. Wenn die Aktivität eines Mehrfachpromotors schwächer ist als die des endogenen Promotors, kann ein Mehrfachpromotor auch dazu eingesetzt werden, gezielt ungewollte Biosynthesewege abzuschwächen.
Weiterhin kann die Regulation der Transkriptionsrate einer erfindungsgemäßen, Mehrfachpromotoren enthaltenden Expressionseinheit durch gezielte Mutation eines oder mehrerer Einzelpromotoren erfolgen, aus denen der Mehrfachpromotor zusammengesetzt ist. Eine erhöhte bzw. erniedrigte Promotoraktivität kann dadurch erreicht wer- den, dass Nukleotide in der Bindungsstelle des RNA-Polymerase-Holoenzym- Bindungsstellen (dem Fachmann auch als -10-Region und -35 Region bekannt) ausgetauscht werden. Weiterhin kann eine Beeinflussung dadurch erfolgen, dass der Abstand der beschriebenen RNA-Polymerase-Holoenzym-Bindungsstellen zueinander durch Deletionen von Nukleotiden oder Insertionen von Nukleotiden verkleinert oder vergrößert werden. Weiterhin dadurch dass Bindungsstellen (dem Fachmann auch als -Operatoren bekannt) für Regulationsproteine (dem Fachmann bekannt als Represso- ren und Aktivatoren) in räumliche Nähe an die Bindungsstellen des RNA-Polymerase- Holoenzyms gebracht werden, dass diese Regulatoren nach Bindung an eine Promotor-Sequenz die Bindung des und Transkriptionsaktivität des RNA-Polymerase- Holoenzyms abschwächen oder verstärken, oder auch unter einen neuen regulatori- schen Einfluss stellen. Die Translationsaktivität kann auch durch Mutation des Ribo- somenbindung vermittelnden, 3'-terminalen Sequenzabschnitts eines Einzelpromotors Py innerhalb der erfindungsgemäßen, Mehrfachpromotoren-enthaltenden Expressionseinheit beeinflusst werden.
VI. Biosynthetische Produkte und bevorzugte Herstellungsverfahren
Bevorzugte erfindungsgemäß hergestellte biosynthetische Produkte sind Feinchemika- lien.
Der Begriff "Feinchemikalie" ist dem Fachmann geläufig und beinhaltet Verbindungen, die von einem Organismus produziert werden und in verschiedenen Industriezweigen Anwendungen finden, wie beispielsweise, jedoch nicht beschränkt auf die pharmazeu- tische Industrie, die Landwirtschafts-, Kosmetik , Food und Feed-Industrie. Diese Verbindungen umfassen organische Säuren, wie beispielsweise Milchsäure, Bernsteinsäure, Weinsäure, Itaconsäure und Diaminopimelinsäure, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Purin- und Pyrimidinbasen, Nukleoside und Nukleotide (wie bspw. beschrieben in Kuninaka, A. (1996) Nucleotides and related Compounds, S. 561-612, in Biotechnology Bd. 6, Rehm et al., Hrsg. VCH: Weinheim und den darin enthaltenen Zitaten), Lipide, gesättigte und ungesättigte Fettsäuren (bspw. Arachidon- säure), Diole (bspw. Propandiol und Butandiol), Kohlenhydrate (bspw. Hyaluronsäure und Trehalose), aromatische Verbindungen (bspw. aromatische Amine, Vanillin und Indigo), Vitamine und Cofaktoren (wie beschrieben in Ullmann's Encyclopedia of Indus- trial Chemistry, Bd. A27, "Vitamins", S. 443-613 (1996) VCH: Weinheim und den darin enthaltenen Zitaten; und Ong, A.S., Niki, E. und Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research - Asien, abgehalten am 1.-3. Sept. 1994 in Penang, Malysia, AOCS Press (1995)), En- zyme und sämtliche anderen von Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 und den darin angegebenen Literaturstellen, beschriebenen Chemikalien.
Besonders bevorzugte biosynthetische Produkte sind ausgewählt aus der Gruppe or- ganische Säuren, Proteine, Nukleotide und Nukleoside, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Lipide und Fettsäuren, Diole, Kohlehydrate, aromatische Verbindungen, Vitamine und Cofaktoren, Enzyme und Proteine.
Bevorzugte organische Säuren sind Milchsäure, Bernsteinsäure, Weinsäure, Itacon- säure und Diaminopimelinsäure.
Bevorzugte Nukleoside und Nukleotide sind beispielsweise beschrieben in Kuninaka, A. (1996) Nucleotides and related Compounds, S. 561-612, in Biotechnology Bd. 6, Rehm et al., Hrsg. VCH: Weinheim und den darin enthaltenen Zitaten.
Bevorzugte biosynthetische Produkte sind weiterhin Lipide, gesättigte und ungesättigte Fettsäuren, wie beispielsweise Arachidonsäure, Diole wie beispielsweise Propandiol und Butandiol, Kohlenhydrate, wie beispielsweise Hyaluronsäure und Trehalose, aromatische Verbindungen, wie beispielsweise aromatische Amine, Vanillin und Indigo, Vitamine und Cofaktoren, wie beispielsweise beschrieben in Ullmann's Encyclopedia of Industrial Chemistry, Bd. A27, "Vitamins", S. 443-613 (1996) VCH: Weinheim und den darin enthaltenen Zitaten; und Ong, A. S., Niki, E. und Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research - Asien, abgehalten am 1.-3. Sept. 1994 in Penang, Malysia, AOCS Press (1995)), Enzyme Polyketide (Cane et al. (1998) Science 282: 63-68), und sämtliche anderen von Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 und den darin angegebenen Literaturstellen, beschriebenen Chemikalien.
Besonders bevorzugte biosynthetische Produkte sind Aminosäuren, besonders bevorzugt essentielle Aminosäuren, insbesondere L-Glycin, L-Alanin, L-Leucin, L- Methionin, L-Phenylalanin, L-Tryptophan, L-Lysin, L-Glutamin, L-Glutaminsäure, L- Serin, L-Prolin, L-Valin, L-Isoleucin, L-Cystein, L-Tyrosin, L-Histidin, L-Arginin, L- Asparagin, L-Asparaginsäure und L-Threonin, L-Homoserin, insbesondere L-Lysin, L- Methionin und L-Threonin. Im folgenden wird unter einer Aminosäure, wie beispielsweise Lysin, Methionin und Threonin, sowohl jeweils die L- und die D-Form der Aminosäure, vorzugsweise die L-Form, also beispielsweise L-Lysin, L-Methionin und L- Threonin verstanden. In den folgenden Abschnitten werden die Lysin-, Methionin- und Threoninherstellung, welche besonders bevorzugt sind, genauer beschrieben.
a) Lvsinherstellung
Die Erfindung betrifft insbesondere ein Verfahren zur Herstellung von Lysin durch Kultivierung von genetisch veränderten Mikroorganismen mit erhöhter oder verursachter Expressionsrate mindestens eines Gens im Vergleich zum Wildtyp, wobei man
- die Expressionsaktivität im Mikroorganismus von mindestens einem endogenen Gen durch eine erfindungsgemäße Expressionseinheit reguliert oder
- die Expression mindestens eines Gens im Mikroorganismus durch Einbringen einer - das Gen umfassenden erfindungsgemäßen Expressionskassette in den Mikroorganis- mus verursacht oder verändert.
Dabei sind die Gene insbesondere ausgewählt unter Nukleinsäuren kodierend eine Aspartatkinase, Nukleinsäuren kodierend eine Aspartat-Semialdehyd-Dehydrogenase, Nukleinsäuren kodierend eine Diaminopimelat- Dehydrogenase, Nukleinsäuren kodie- rend eine Diaminopimelat- Decarboxylase, Nukleinsäuren kodierend eine Dihydrodipi- colinate-Synthetase, Nukleinsäuren kodierend eine Dihydridipicolinate-Reduktase, Nukleinsäuren kodierend eine Glycerinaldehyd-3-Phosphat Dehydrogenase, Nukleinsäuren kodierend eine 3-Phosphoglycerat-Kinase, Nukleinsäuren kodierend eine Pyru- vat Carboxylase, Nukleinsäuren kodierend eine Triosephosphat-Isomerase, Nuklein- säuren kodierend einen Transkriptionellen Regulator LuxR, Nukleinsäuren kodierend einen Transkriptionellen Regulator LysR1 , Nukleinsäuren kodierend einen Transkriptionellen Regulator LysR2, Nukleinsäuren kodierend eine Malat-Quinon- Oxodoreduktase, Nukleinsäuren kodierend eine Glucose-6-Phosphat-Deydrognease, Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrognease, Nukleinsäuren kodierend eine Transketolase, Nukleinsäuren kodierend eine Transaldolase, Nukleinsäuren kodierend einen Lysin Exporter, Nukleinsäuren kodierend eine Biotin-Ligase, Nukleinsäuren kodierend eine Arginyl-t-RNA-Synthetase, Nukleinsäuren kodierend eine Phosphoenolpyruvat-Carboxylase, Nukleinsäuren kodierend eine Fruktose-1 ,6- bisphosphatase, Nukleinsäuren kodierend ein Protein OPCA, Nukleinsäuren kodierend eine 1-Phosphofructokinase, Nukleinsäuren kodierend eine 6-Phosphofructokinase Nukleinsäuren kodierend eine Tetrahydropicolinat-Succinylase, Nukleinsäuren kodierend eine Succinyl-aminoketopimelat-Aminotransferase, Nukleinsäuren kodierend eine Succinyl-Diaminopimelat-Desuccinylase, Nukleinsäuren kodierend eine Diaminopime- lat-Epimerase, Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrogenase, Nukleinsäuren kodierend eine Glucosephosphat-Isomerase, Nukleinsäuren kodierend eine Phosphoglycerat-Mutase, Nukleinsäuren kodierend eine Enolase, Nukleinsäuren kodierend eine Pyruvat-Kinase, Nukleinsäuren kodierend eine Aspartat-Transaminase und Nukleinsäuren kodierend eine Malat-Enzym.
Eine weiter bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Lysin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine erhöhte Aktivität, mindestens einer der Aktivitäten, ausgewählt unter: Aspartatkinase-Aktivität, Aspartat-Semialdehyd-Dehydrogenase-Aktivität, Diaminopi- melat- Dehydrogenase-Aktivität, Diaminopimelat-Decarboxylase-Aktivität, Dihydrodipi- colinate-Synthetase-Aktivität, Dihydridipicolinate-Reduktase-Aktivität, Glycerinaldehyd- 3-Phosphat Dehydrogenase-Aktivität, 3-Phosphoglycerat-Kinase-Aktivität, Pyruvat Carboxylase-Aktivität, Triosephosphat-Isomerase-Aktivität, Aktivität des Transkriptionellen Regulators LuxR, Aktivität des Transkriptionellen Regulators LysR1 , Aktivität des Transkriptionellen Regulators LysR2, Malat-Quinon-Oxodoreduktase-Aktivität, Glucose-6-Phosphat-Deydrognease-Aktivität, 6-Phosphogluconat-Dehydrognease- Aktivität, Transketolase-Aktivität, Transaldolase-Aktivität, Lysin-Exporter-Aktivität, Argi- nyl-t-RNA-Synthetase-Aktivität, Phosphoenolpyruvat-Carboxylase-Aktivität, Fruktose- 1 ,6-bisphosphatase-Aktivität, Protein OpcA-Aktivität, 1-Phosphofructokinase-Aktivität, 6-Phosphofructokinase-Aktivität, Biotin-Ligase-Aktivität und Tetrahydropicolinat- Succinylase-Aktivität, Succinyl-aminoketopimelat-Aminotransferase-Aktivität, Succinyl- Diaminopimelat-Desuccinylase-Aktivität, Diaminopimelat-Epimerase-Aktivität, 6- Phosphogluconat-Dehydrogenase-Aktivität, Glucosephosphat-Isomerase-Aktivität, Phosphoglycerat-Mutase-Aktivität, Enolase-Aktivität, Pyruvat-Kinase-Aktivität, Aspar- tat-Transaminase-Aktivität und Malat-Enzym-Aktivität aufweisen.
Eine weiter besonders bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Lysin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine reduzierte Ak- tivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Threonin Dehydra- tase-Aktivität, Homoserin O-Acetyltransferase-Aktivität, O-Acetylhomoserin- Sulfhydrylase-Aktivität, Phosphoenolpyruvat-Carboxykinase-Aktivität, Pyruvat-Oxidase- Aktivität, Homoserine-Kinase-Aktivität, Homoserin-Dehydrogenase-Aktivität, Threonin- Exporter-Aktivität, Threonin-Efflux-Protein-Aktivität, Asparaginase-Aktivität, Aspartat- Decarboxylase-Aktivität und Threonin-Synthase-Aktivität aufweisen.
b) Methioninherstellung Die Erfindung betrifft ferner ein Verfahren zur Herstellung von Methionin durch Kultivierung von genetisch veränderten Mikroorganismen mit erhöhter oder verursachter Expressionsrate mindestens eines Gens im Vergleich zum Wildtyp, wobei man
- die Expressionsaktivität im Mikroorganismus von mindestens einem endogenen Gen durch eine erfindungsgemäße Expressionseinheit reguliert oder
- die Expression mindestens eines Gens im Mikroorganismus durch Einbringen einer das Gen umfassenden erfindungsgemäßen Expressionskassette in den Mikroorganis- mus verursacht oder verändert.
Dabei sind die Gene insbesondere ausgewählt unter Nukleinsäuren kodierend eine Aspartatkinase, Nukleinsäuren kodierend eine Aspartat-Semialdehyd-Dehydrogenase, Nukleinsäuren kodierend eine Homoserin Dehydrogenase, Nukleinsäuren kodierend eine Glycerinaldehyd-3-Phosphat Dehydrogenase, Nukleinsäuren kodierend eine 3- Phosphoglycerat Kinase, Nukleinsäuren kodierend eine Pyruvat Carboxylase, Nukleinsäuren kodierend eine Triosephosphat Isomerase, Nukleinsäuren kodierend eine Homoserin O-Acetyltransferase, Nukleinsäuren kodierend eine Cystahionin-gamma- Synthase, Nukleinsäuren kodierend eine Cystahionin-beta-Lyase, Nukleinsäuren ko- dierend eine Serin-Hydroxymethyltransferase, Nukleinsäuren kodierend eine O- Acetylhomoserin-Sulfhydrylase, Nukleinsäuren kodierend eine Methylen- Tetrahydrofolat-Reduktase, Nukleinsäuren kodierend eine Phosphoserin- Aminotransferase, Nukleinsäuren kodierend eine Phosphoserin-Phosphatase, Nukleinsäuren kodierend eine Sehne Acetyl-Transferase, Nukleinsäuren kodierend eine Cystein-Synthase Aktivität I1 Nukleinsäuren kodierend eine Cystein-Synthase Aktivität Il , Nukleinsäuren kodierend eine Coenzym B12-abhängige Methionin-Synthase- Aktivität, Nukleinsäuren kodierend eine Coenzym B12-unabhängige Methionin- Synthase-Aktivität, Nukleinsäuren kodierend eine Sulfat-Adenylyltransferase-Aktivität, Nukleinsäuren kodierend eine Phosphoadenosin-Phosphosulfat-Reductase-Aktivität, Nukleinsäuren kodierend eine Ferredoxin-Sulfit-Reduktase-Aktivität, Nukleinsäuren kodierend eine Ferredoxin NADPH-Reduktase Aktivität, Nukleinsäuren kodierend eine Ferredoxin-Aktivität, Nukleinsäuren kodierend ein Protein der Sulfat-Reduktion RXA077, Nukleinsäuren kodierend ein Protein der Sulfat-Reduktion RXA248, Nukleinsäuren kodierend ein Protein der Sulfat-Reduktion RXA247, Nukleinsäuren kodierend eine, RXA0655 Regulator undNukleinsäuren kodierend einen RXN2910 Regulator. Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrogenase, Glucosephosphat- Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat- Transaminase oder Malat-Enzym. Eine weiter bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Methionin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine erhöhte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Aspartatkinase-Aktivität, Aspartat-Semialdehyd-Dehydrogenase-Aktivität, Homoserin Dehydrogenase-Aktivität, Glycerinaldehyd-3-Phosphat Dehydrogenase-Aktivität, 3-Phosphoglycerat Kinase- Aktivität, Pyruvat Carboxylase-Aktivität, Triosephosphat Isomerase-Aktivität, Homoserin O-Acetyltransferase-Aktivität, Cystahionin-gamma-Synthase-Aktivität, Cystahionin- beta-Lyase-Aktivität Serin-Hydroxymethyltransferase-Aktivität, O-Acetylhomoserin- Sulfhydrylase-Aktivität, Methylen-Tetrahydrofolat-Reduktase-Aktivität, Phosphoserin- Aminotransferase-Aktivität, Phosphoserin-Phosphatase-Aktivität, Serine Acetyl- Transferase-Aktivität, Cystein-Synthase-Aktivität, Cystein-Synthase Il -Aktivität, Coen- zym B12-abhängige Methionin-Synthase-Aktivität, Coenzym B12-unabhängige Methio- nin-Synthase-Aktivität, Sulfat-Adenylyltransferase-Aktivität, Phosphoadenosin- Phosphosulfat-Reductase-Aktivität, Ferredoxin-Sulfit-Reduktase-Aktivität, Ferredoxin NADPH-Reduktase Aktivität, Ferredoxin-Aktivität Aktivität Proteins der Sulfat- Reduktion RXA077, Aktivität eines Proteins der Sulfat-Reduktion RXA248, Aktivität eines Proteins der Sulfat-Reduktion RXA247, Aktivität eines RXA655-Regulators und Aktivität eines RXN2910-Regulators, Aktivität einer 6-Phosphogluconat- Dehydrogenase, Aktivität einer Glucosephosphat-Isomerase, Aktivität einer Phosphoglycerat-Mutase, Aktivität einer Enolase, Aktivität einer Pyruvat-Kinase, Aktivität einer Aspartat-Transaminase und Aktivität des Malat-Enzyms aufweisen.
Eine weiter besonders bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Methionin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine reduzierte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Homoserine-Kinase- Aktivität, Threonin-Dehydratase-Aktivität, Threonin Synthase-Aktivität, Meso- Diaminopimelat D-Dehydrogenase-Aktivität, Phosphoenolpyruvat-Carboxykinase- Aktivität, Pyruvat-Oxidase-Aktivität, Dihydrodipicolinat Synthase-Aktivität, Dihydrodipi- colinat Reduktase-Aktivität, und Diaminopicolinat Decarboxylase-Aktivität aufweisen.
c) Threoninherstellung
Die Erfindung betrifft ferner ein Verfahren zur Herstellung von Threonin durch Kultivierung von genetisch veränderten Mikroorganismen mit erhöhter oder verursachter Expressionsrate mindestens eines Gens im Vergleich zum Wildtyp, wobei man
- die Expressionsaktivität im Mikroorganismus von mindestens einem endogenen Gen durch eine erfindungsgemäße Expressionseinheit reguliert oder - die Expression mindestens eines Gens im Mikroorganismus durch Einbringen einer das Gen umfassenden erfindungsgemäßen Expressionskassette in den Mikroorganismus verursacht oder verändert.
Dabei sind die Gene insbesondere ausgewählt unter Nukleinsäuren kodierend eine Aspartatkinase, Nukleinsäuren kodierend eine Aspartat-Semialdehyd-Dehydrogenase, Nukleinsäuren kodierend eine Glycerinaldehyd-3-Phosphat Dehydrogenase, Nuklein- säuren kodierend eine 3-Phosphoglycerat Kinase, Nukleinsäuren kodierend eine Pyru- vat Carboxylase, Nukleinsäuren kodierend eine Triosephosphat Isomerase, Nukleinsäuren kodierend eine Homoserin-Kinase, Nukleinsäuren kodierend eine Threonin Synthase, Nukleinsäuren kodierend einen Threonin Exporter Carrier, Nukleinsäuren kodierend eine Glucose-6-Phosphat-Dehydrogenase, Nukleinsäuren kodierend eine Transaldolase, Nukleinsäuren kodierend eine Transketolase, Nukleinsäuren kodierend einer Malat-Quinon-Oxidoreductase, Nukleinsäuren kodierend eine 6- Phosphogluconat-Dehydrogenase, Nukleinsäuren kodierend einen Lysin-Exporter, Nukleinsäuren kodierend eine Biotin-Ligase, Nukleinsäuren kodierend eine Phosphoe- nolpyruvat-Carboxylase, Nukleinsäuren kodierend ein Threonin Efflux-Protein, Nuklein- säuren kodierend eine Fruktose-1 ,6-bisphosphatase, Nukleinsäuren kodierend ein Op- cA Protein, Nukleinsäuren kodierend eine 1-Phosphofructokinase, Nukleinsäuren kodierend eine 6-Phosphofructokinase, und Nukleinsäuren kodierend eine Homoserin- Dehydrogenase und Kukleinsäuren kodierend eine 6-Phosphogluconat- Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase und Malat-Enzym.
Eine weiter bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Threonin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine erhöhte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe :
Aspartatkinase-Aktivität, Aspartat-Semialdehyd-Dehydrogenase-Aktivität, Glycerinal- dehyd-3-Phosphat Dehydrogenase-Aktivität, 3-Phosphoglycerat Kinase-Aktivität, Pyru- vat Carboxylase-Aktivität, Triosephosphat Isomerase-Aktivität, Threonin Synthase- Aktivität, Aktivität eines Threonin Export-Carriers, Transaldolase-Aktivität, Transketola- se-Aktivität, Glucose-6-Phosphat-dehydrogenase-Aktivität, Malat-Qinon-
Oxidoreductase-Aktivität, Homoserin-Kinase-Aktivität, Biotin-Ligase-Aktivität, Phosphoenolpyruvat-Carboxylase-Aktivität, Threonin-Efflux-Protein-Aktivität, Protein OpcA-Aktivität, 1-Phosphofructokinase-Aktivität, 6-Phosphofructokinase-Aktivität, Fruktose 1 ,6 bisphosphatase-Aktivität, 6-Phosphogluconat-Dehydrogenase , Homoserin- Dehydrogenase-Aktivität und Aktivität einer 6-Phosphogluconat-Dehydrogenase, Akti- vität einer Glucosephosphat-Isomerase, Aktivität einer Phosphoglycerat-Mutase, Aktivität einer Enolase, Aktivität einer Pyruvat-Kinase, Aktivität einer Aspartat-Transaminase und Aktivität des Malat-Enzyms aufweisen.
Eine weiter besonders bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Threonin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine reduzierte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Threonin Dehydratase-Aktivität, Homoserin O-Acetyltransferase-Aktivität, Serin- Hydroxymethyltransferase-Aktivität, O-Acetylhomoserin-Sulfhydrylase-Aktivität, Meso- Diaminopimelat D-Dehydrogenase-Aktivität, Phosphoenolpyruvat-Carboxykinase- Aktivität, Pyruvat-Oxidase-Aktivität, Dihydrodipicolinat Synthetase-Aktivität, Dihydrodi- picolinat Reduktase-Aktivität, Asparaginase-Aktivität, Aspartat-Decarboxylase-Aktivität, Lysin-Exporter-Aktivität, Acetolactat-Synthase-Aktivität , Ketol-Aid-Reductoisomerase- Aktivität , Branched chain aminotransferase- Aktivität , Coenzym B12-abhängige Methionin Synthase- Aktivität , Coenzym B12-unabhängige Methion Synthase- Aktivität, Dihydroxy-acid Dehydratase- Aktivität und Diaminopicolinat Decarboxylase-Aktivität aufweisen.
d) Weitere Angaben zur erfindungsgemäßen Herstellung von Bioprodukten
Diese zusätzlichen, erhöhten oder reduzierten Aktivitäten mindestens einer der vorstehend beschriebenen Aktivitäten können, müssen aber nicht durch eine erfindungsgemäße Expressionseinheit oder eine erfindungsgemäße Expressionskassette verur- sacht sein.
Unter dem Begriff der „Aktivität" eines Proteins wird bei Enzymen die Enzymaktivität des entsprechenden Proteins, bei anderen Proteinen, wie beispielsweise Struktur oder Transport-Proteinen, die physiologische Aktivität der Proteine verstanden.
Die Enzyme sind in der Regel in der Lage ein Substrat in ein Produkt umzuwandeln bzw. diesen Umwandlungsschritt zu katalysieren. Dementsprechend wird unter der „Aktivität" eines Enzyms die in einer bestimmten Zeit durch das Enzym umgesetzte Menge Substrat bzw. gebildete Menge Produkt verstanden.
Bei einer erhöhten Aktivität im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Enzym die umgesetzte Menge Substrat bzw. die gebildete Menge Produkt erhöht. Beispielsweise beträgt diese Erhöhung der „Aktivität" bei allen vorstehend und nachstehend beschriebenen Aktivitäten mindestens 1 bis 5 %, wie z.B. mindestens 20 %, mindestens 50 %, mindestens 100 %, mindestens 300 %, oder mindestens 500 %, oder mindestens 600 % der „Aktivität des Wildtyps".
Bei einer reduzierten Aktivität im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Enzym die umgesetzte Menge Substrat bzw. die gebildete Menge Produkt reduziert.
Unter einer reduzierten Aktivität wird vorzugsweise die teilweise oder im wesentlichen vollständige, auf unterschiedliche zellbiologische Mechanismen beruhende Unterbindung oder Blockierung der Funktionalität dieses Enzyms in einem Mikroorganismus verstanden. Eine Reduzierung der Aktivität umfasst eine mengenmäßige Verringerung eines Enzyms bis hin zu einem im wesentlichen vollständigen Fehlen des Enzyms (d.h. fehlende Nachweisbarkeit der entsprechenden Aktivität oder fehlende immunologische Nachweisbarkeit des Enzyms). Vorzugsweise wird die Aktivität im Mikroorganismus im Vergleich zum Wildtyp um mindestens 5 %, wie mindestens 20 %, mindestens 50 %, oder um etwa 100 % reduziert. Insbesondere meint "Reduzierung" auch das vollständige Fehlen der entsprechenden Aktivität.
Die Aktivität bestimmter Enzyme in genetisch veränderten Mikroorganismen sowie im Wildtyp und damit die Erhöhung oder Reduzierung der Enzymaktivität lassen sich nach bekannten Verfahren, wie beispielsweise Enzymassays ermitteln.
Eine zusätzliche Erhöhung von Aktivitäten kann auf verschiedenen Wegen erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Expressions- und Proteinebene oder durch Erhöhung der Genexpression von Nuk- leinsäuren kodierend die vorstehend beschriebenen Proteine im Vergleich zum Wildtyp.
Die Erhöhung der Genexpression der Nukleinsäuren kodierend die vorstehend beschriebenen Proteine gegenüber dem Wildtyp kann ebenfalls auf verschiedenen We- gen erfolgen, beispielsweise durch Induzierung des Gens durch Aktivatoren oder wie vorstehend beschrieben durch Erhöhung der Promotoraktivität oder Erhöhung der Expressionsaktivität oder durch Einbringen von einer oder mehrerer Genkopien in den Mikroorganismus.
Unter Erhöhung der Genexpression einer Nukleinsäure kodierend ein Protein wird erfindungsgemäß auch die Manipulation der Expression der dem Mikroorganismus eige- nen, endogenen Proteine verstanden. Dies kann beispielsweise, wie vorstehend beschrieben durch Veränderung der Promotorsequenzen der Gene, Einbringen von erfindungsgemäßen Expressionseinheit zur regulatorischen Kontrolle der Gene und Veränderung der eingebrachten erfindungsgemäßen Expressionseinheiten erreicht werden. Eine solche Veränderung, die eine erhöhte Expressionsrate des Gens zur Folge hat, kann beispielsweise durch Deletion oder Insertion von DNA Sequenzen erfolgen.
Es ist, wie vorstehend beschrieben, möglich, die Expression der endogenen Proteine durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere phy- siologische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.
Zur Erzielung einer Erhöhung der Genexpression kann der Fachmann weitere unterschiedliche Maßnahmen einzeln oder in Kombination ergreifen. So kann beispielsweise die Kopienzahl der entsprechenden Gene erhöht werden, oder es kann die Promotor- und Regulationsregion oder die Ribosomenbindungsstelle, die sich stromaufwärts des Strukturgens befindet, mutiert werden. Durch induzierbare Promotoren ist es zusätzlich möglich, die Expression im Verlaufe der fermentativen Produktion zu steigern. Durch Maßnahmen zur Verlängerung der Lebensdauer der mRNA wird ebenfalls die Expression verbessert. Weiterhin wird durch Verhinderung des Abbaus des Enzymproteins ebenfalls die Enzymaktivität verstärkt. Die Gene oder Genkonstrukte können entweder in Plasmiden mit unterschiedlicher Kopienzahl vorliegen oder im Chromosom integriert und amplifiziert sein. Alternativ kann weiterhin eine Überexpression der betreffenden Gene durch Veränderung der Medienzusammensetzung und Kulturführung erreicht werden.
Anleitungen hierzu findet der Fachmann unter anderem bei Martin et al. (Biontechnolo- gy 5, 137-146 (1987)), bei Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya und Mo- rinaga (Bio/Technology 6, 428-430 (1988)), bei Eikmanns et al. (Gene 102, 93-98 (1991)), in der EP-A-0472869, im US -A-4,601 ,893, bei Schwarzer und Pühler (Bio- technology 9, 84-87 (1991), bei Remscheid et al. (Applied and Environmental Microbio- logy 60,126-132 (1994), bei LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in der WO 96/15246, bei Malumbres et al. (Gene 134, 15-24 (1993)), in der J P-A- 10-229891 , bei Jensen und Hammer (Biotechnology and Bioengineering 58, .191- 195 (1998)), bei Makrides (Microbiological Reviews 60 : 512-538 (1996) und in bekann- ten Lehrbüchern der Genetik und Molekularbiologie.
Weiterhin kann es für die Produktion von biosynthetischen Produkten, insbesondere L- Lysin, L-Methionin und L-Threonin, vorteilhaft sein, neben der Expression bzw. Verstärkung eines Gens unerwünschte Nebenreaktionen auszuschalten (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure, kodierend eines der vorstehend beschriebenen Proteine, durch Einbringen von mindestens einer Nukleinsäure kodierend ein entsprechendes Protein in den Mikroorganismus. Das Einbringen der Nukleinsäure kann chromosomal oder extrachromosomal erfolgen, also durch Erhöhung der Kopienzahl auf dem Chromosom und oder eine Kopie des Gens auf einem sich replizierenden Plasmid in dem Wϊrtsmikroor- ganismus.
Vorzugsweise erfolgt das Einbringen der Nukleinsäure, beispielsweise in Form einer erfindungsgemäßen Expressionskassette, enthaltend die Nukleinsäure, chromosomal, insbesondere durch die vorstehend beschriebene SacB-Methode. Dazu kann prinzipiell jedes Gen, das eines der vorstehend beschriebenen Proteine kodiert, verwendet werden.
Bei genomischen Nukleinsäure-Sequenzen aus eukaryontischen Quellen, die Introns enthalten, sind für den Fall, dass der Wirtsmikroorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Proteine zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen, wie die entsprechenden cDNAs zu verwenden.
Beispiele für die entsprechenden Gene sind in Tabelle 1 und 2 aufgelistet.
Vorzugsweise erfolgt die Reduzierung der vorstehend beschriebenen Aktivitäten in Mikroorganismen durch mindestens eines der nachfolgenden Verfahren:
• Einbringen mindestens einer sense-Ribonukleinsäuresequenz zur Induktion ei- ner Cosuppression oder einer deren Expression gewährleistenden Expressionskassette
• Einbringen mindestens eines DNA- oder Protein-bindenden Faktors für ein entsprechedes Gen, eine RNA oder ein Protein, oder einer dessen Expression gewährleistenden Expressionskassette
• Einbringen mindestens einer den RNA-Abbau bewirkenden viralen Nukleinsäu- resequenz oder einer deren Expression gewährleistenden Expressionskassette • Einbringen mindestens eines Konstruktes zur Erzeugung eines Funktionsverlustes, wie beispielsweise die Generierung von Stop-Codons oder von Verschiebungen im Leseraster, an einem Gen, beispielsweise durch Erzeugung einer Insertion, Deletion, Inversion oder Mutation in einem Gen. Bevorzugt kön- nen Knockout-Mutanten mittels gezielter Insertion in das gewünschte Zielgen durch homologe Rekombination oder Einbringen von sequenzspezifischen Nukleasen gegen das Zielgen generiert werden.
• Einbringen eines Promotors mit reduzierter Promotoraktivität oder einer Ex- pressionseinheit mit reduzierter Expressionsaktivität.
• Einbringen einer antisense-RNA, die die Translation der sense RNA (mRNA) vermindert.
Dem Fachmann ist bekannt, dass auch weitere Verfahren im Rahmen der vorliegenden Erfindung zur Reduzierung seiner Aktivität oder Funktion eingesetzt werden können. Beispielsweise kann auch das Einbringen einer dominant-negativen Variante eines Proteins oder einer deren Expression gewährleistenden Expressionskassette vorteilhaft sein.
Dabei kann jedes einzelne dieser Verfahren eine Verminderung der Proteinmenge, mRNA-Menge und/oder Aktivität eines Proteins bewirken. Auch eine kombinierte Anwendung ist denkbar. Weitere Methoden sind dem Fachmann bekannt und können die Behinderung oder Unterbindung der Prozessierung des Proteins, des Transports des Proteins oder dessen mRNA, Hemmung der Ribosomenanlagerung, Hemmung des RNA-Spleißens, Induktion einesRNA-abbauenden Enzyms und/oder Hemmung der Translationselongation oder -termination umfassen.
VII. Kultivierung von Mikroorganismen und Produktisolierung
Im erfindungsgemäßen Verfahren zur Herstellung von biosynthetischen Produkten wird vorzugsweise dem Kultivierungsschritt der genetisch veränderten Mikroorganismen ein Isolieren von biosynthetischen Produkten aus den Mikroorganismen oder/oder aus der Fermentationsbrühe angeschlossen. Diese Schritte können gleichzeitig und/oder vor- zugsweisie nach dem Kultivierungsschritt stattfinden.
Die erfindungsgemäßen genetisch veränderten Mikroorganismen können kontinuierlich oder diskontinuierlich im batch-Verfahren (Satzkultivierung) oder im fed batch (Zulauf- verfahren) oder repeated fed batch Verfahren (repetitives Zulaufverfahren) zur Produk- tion von biosynthetischen Produkten, insbesondere L-Lysin, L-Methionin und L- Threonin, kultiviert werden. Eine Zusammenfassung über bekannte Kultivierungsmethoden ist im Lehrbuch von Chemiel (Bioprozeßtechnik 1. Einführung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) oder im Lehrbuch von Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)) zu finden.
Das zu verwendende Kulturmedium hat in geeigneter Weise den Ansprüchen der jeweiligen Stämme zu genügen. Beschreibungen von Kulturmedien verschiedener Mikroorganismen sind im Handbuch "Manual of Methods für General Bacteriology" der American Society für Bacteriology (Washington D. C1 USA, 1981) enthalten.
Diese erfindungsgemäß einsetzbaren Medien umfassen gewöhnlich eine oder mehrere Kohlenstoffquellen, Stickstoffquellen, anorganische Salze, Vitamine und/oder Spurenelemente.
Bevorzugte Kohlenstoffquellen sind Zucker, wie Mono-, Di- oder Polysaccharide. Sehr gute Kohlenstoffquellen sind beispielsweise Glucose, Fructose, Mannose, Galactose, Ribose, Sorbose, Ribulose, Lactose, Maltose, Saccharose, Raffinose, Stärke oder CeI- lulose. Man kann Zucker auch über komplexe Verbindungen, wie Melassen, oder an- dere Nebenprodukte der Zucker-Raffinierung zu den Medien geben. Es kann auch vorteilhaft sein, Gemische verschiedener Kohlenstoffquellen zuzugeben. Andere mögliche Kohlenstoffquellen sind Öle und Fette wie z. B. Sojaöl. Sonnenblumenöl. Erdnußöl und Kokosfett, Fettsäuren wie z. B. Palmitinsäure, Stearinsäure oder Linolsäure, Alkohole wie z. B. Glycerin, Methanol oder Ethanol und organische Säuren wie z. B. Essigsäure oder Milchsäure.
Stickstoffquellen sind gewöhnlich organische oder anorganische Stickstoffverbindungen oder Materialien, die diese Verbindungen enthalten. Beispielhafte Stickstoffquellen umfassen Ammoniak-Gas oder Ammoniumsalze, wie Ammoniumsulfat, Ammoniumch- lorid, Ammoniumphosphat, Ammoniumcarbonat oder Ammoniumnitrat, Nitrate, Harnstoff, Aminosäuren oder komplexe Stickstoffquellen, wie Maisquellwasser, Sojamehl, Sojaprotein, Hefeextrakt, Fleischextrakt und andere. Die Stickstoffquellen können einzeln oder als Mischung verwendet werden.
Anorganische Salzverbindungen, die in den Medien enthalten sein können, umfassen die Chlorid-, Phosphor- oder Sulfatsalze von Calcium, Magnesium, Natrium, Kobalt, Molybdän, Kalium, Mangan, Zink, Kupfer und Eisen
Als Schwefelquelle für die Herstellung von Feinchemikalien, insbesondere von Methio- nin, können anorganische Verbindungen wie beispielsweise Sulfate, Sulfite, Dithionite, Tetrathionate, Thiosulfate, Sulfide aber auch organische Schwefelverbindungen, wie Mercaptane und Thiole, verwendet werden.
Als Phosphorquelle können Phosphorsäure, Kaliumdihydrogenphosphat oder Dikali- umhydrogenphosphat oder die entsprechenden, Natrium-haltigen Salze verwendet werden.
Chelatbildner können zum Medium gegeben werden, um die Metallionen in Lösung zu halten. Besonders geeignete Chelatbildner umfassen Dihydroxyphenole, wie Catechol oder Protocatechuat, oder organische Säuren, wie Citronensäure.
Die erfindungsgemäß eingesetzten Fermentationsmedien enthalten üblicherweise auch andere Wachstumsfaktoren, wie Vitamine oder Wachstumsförderer, zu denen beispielsweise Biotin, Riboflavin, Thiamin, Folsäure, Nikotinsäure, Panthothenat und Pyri- doxin gehören. Wachstumsfaktoren und Salze stammen häufig von komplexen Medienkomponenten, wie Hefeextrakt, Melassen, Maisquellwasser und dergleichen. Dem Kulturmedium können überdies geeignete Vorstufen zugesetzt werden. Die genaue Zusammensetzung der Medienverbindungen hängt stark vom jeweiligen Experiment ab und wird für jeden spezifischen Fall individuell entschieden. Information über die Me- dienoptimierung ist erhältlich aus dem Lehrbuch "Applied Microbiol. Physiology, A Practical Approach" (Hrsg. P.M. Rhodes, P. F. Stanbury, IRL Press (1997) S. 53-73, ISBN 0 19 963577 3). Wachstumsmedien lassen sich auch von kommerziellen Anbietern beziehen, wie Standard 1 (Merck) oder BHI (Brain heart infusion, DIFCO) und dergleichen.
Sämtliche Medienkomponenten werden entweder durch Hitze (20 min bei 1 ,5 bar und 1210C) oder durch Sterilfiltration sterilisiert. Die Komponenten können entweder zusammen oder nötigenfalls getrennt sterilisiert werden. Sämtliche Medienkomponenten können zu Beginn der Anzucht zugegen sein oder wahlfrei kontinuierlich oder char- genweise hinzugegeben werden.
Die Temperatur der Kultur liegt normalerweise zwischen 15°C und 45°C, vorzugsweise bei 25°C bis 4O0C und kann während des Experimentes konstant gehalten oder verändert werden. Der pH-Wert des Mediums sollte im Bereich von 5 bis 8,5, vorzugsweise um 7,0 liegen. Der pH-Wert für die Anzucht lässt sich während der Anzucht durch Zugabe von basische Verbindungen wie Natriumhydroxid, Kaliumhydroxid, Ammoniak bzw. Ammoniakwasser oder saure Verbindungen wie Phosphorsäure oder Schwefelsäure kontrollieren. Zur Kontrolle der Schaumentwicklung können Antischaummittel, wie z. B. Fettsäurepolyglykolester, eingesetzt werden. Zur Aufrechterhaltung der Stabi- lität von Plasmiden können dem Medium geeignete selektiv wirkende Stoffe, wie z. B. Antibiotika, hinzugefügt werden. Um aerobe Bedingungen aufrechtzuerhalten, werden Sauerstoff oder Sauerstoff haltige Gasmischungen, wie z. B. Umgebungsluft, in die Kultur eingetragen. Die Temperatur der Kultur liegt normalerweise bei 200C bis 45°C. Die Kultur wird solange fortgesetzt, bis sich ein Maximum des gewünschten Produktes gebildet hat. Dieses Ziel wird normalerweise innerhalb von 10 Stunden bis 160 Stunden erreicht.
Die so erhaltenen Fermentationsbrühen haben üblicherweise eine Trockenmasse von 7,5 bis 25 Gew.-%.
Vorteilhaft ist außerdem auch, wenn die Fermentation zumindest am Ende, insbesondere jedoch über mindestens 30% der Fermentationsdauer zuckerlimitiert gefahren wird. Das heißt, dass während dieser Zeit die Konzentration an verwertbarem Zucker im Fermentationsmedium auf 0 bis 3 g/l gehalten, beziehungsweise abgesenkt wird.
Die Isolierung von biosynthetischen Produkten aus der Fermentationsbrühe und/oder den Mikroorganismen erfolgt in an sich bekannter Weise entsprechend den physikalisch-chemischen Eigenschaften des biosynthetischen Wertprodukts und den biosynthetischen Nebenprodukten.
Die Fermentationsbrühe kann anschließend beispielsweise weiterverarbeitet werden. Je nach Anforderung kann die Biomasse ganz oder teilweise durch Separationsmethoden, wie z. B. Zentrifugation, Filtration, Dekantieren oder einer Kombination dieser Methoden aus der Fermentationsbrühe entfernt oder vollständig in ihr belassen werden.
Anschließend kann die Fermentationsbrühe mit bekannten Methoden, wie z. B. mit Hilfe eines Rotationsverdampfers, Dünnschichtverdampfers, Fallfilmverdampfers, durch Umkehrosmose, oder durch Nanofiltration, eingedickt beziehungsweise auf konzentriert werden. Diese aufkonzentrierte Fermentationsbrühe kann anschließend durch Gefriertrocknung, Sprühtrocknung, Sprühgranulation oder durch anderweitige Verfahren aufgearbeitet werden.
Es ist aber auch möglich die biosynthetischen Produkte, insbesondere L-Lysin, L- Methionin und L-Threonin, weiter aufzureinigen. Hierzu wird die produkthaltige Brühe nach dem Abtrennen der Biomasse einer Chromatographie mit einem geeigneten Harz unterworfen, wobei das gewünschte Produkt oder die Verunreinigungen ganz oder teilweise auf dem Chromatographieharz zurückgehalten werden. Diese Chromatographieschritte können nötigenfalls wiederholt werden, wobei die gleichen oder andere Chromatographieharze verwendet werden. Der Fachmann ist in der Auswahl der geeigneten Chromatographieharze und ihrer wirksamsten Anwendung bewandert. Das gereinigte Produkt kann durch Filtration oder Ultrafiltration konzentriert und bei einer Temperatur aufbewahrt werden, bei der die Stabilität des Produktes maximal ist.
Die biosynthetischen Produkte können in unterschiedlichen Formen anfallen, bei- spielsweise in Form ihrer Salze oder Ester.
Die Identität und Reinheit der isolierten Verbindung(en) kann durch Techniken des Standes der Technik bestimmt werden. Diese umfassen Hochdruckflüssigkeitschromatographie (HPLC), spektroskopische Verfahren, Färbeverfahren, Dünnschichtchroma- tographie, NIRS, Enzymtest oder mikrobiologische Tests. Diese Analyseverfahren sind zusammengefaßt in: Patek et al. (1994) Appl. Environ. Microbiol. 60:133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; und Schmidt et al. (1998) Bioprocess Engineer. 19:67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Bd. A27, VCH: Weinheim, S. 89-90, S. 521-540, S. 540-547, S. 559-566, 575-581 und S. 581-587; Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, Bd. 17.
Die Erfindung wird nun anhand der folgenden nicht-limitierenden Beispiele näher beschrieben:
Beispiel 1 :
Herstellung des Vektors pCLiK5MCS
Zunächst wurden Ampicillinresistenz und Replikationsursprung des Vektors pBR322 mit den Oligonukleotidprimern SEQ ID NO:5 und SEQ ID NO: 6 mit Hilfe der Polyme- rase-Kettenreaktion (PCR) amplifiziert.
SEQ ID NO: 5: δ'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCGCACA G-3'
SEQ ID NO: 6: 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTC G-3'
Neben den zu pBR322 komplementären Sequenzen, enthält der Oligonukleotidprimer
SEQ ID NO: 5 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Smal, BamHI, Nhel und Ascl und der Oligonukleotidprimer SEQ ID NO: 6 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Xbal, Xhol, Notl und Dral. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La JoIIa, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 2,1 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Die stumpfen Enden des DNA-Fragmentes wurden mit dem Rapid DNA Ligatioπ Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers miteinander ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben (1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Ampicillin (50μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 : 190) erreicht.
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiKI .
Ausgehend vom Plasmid pWLT1 (Liebl et al.,1992) als Template für eine PCR Reakti- on wurde mit den Oligonukleotidprimern SEQ ID NO:7 und SEQ ID NO.8 eine Kana- mycin-Resistenzcassette amplifiziert.
SEQ ID NO:7:
5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-S'
SEQ ID NO:8 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-S'
Neben den zu pWLT1 komplementären Sequenzen, enthält der Oligonukleotidprimer SEQ ID NO: 7 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Xbal, Smal, BamHI, Nhel und der Oligonukleotidprimer SEQ ID NO:8 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Ascl und Nhel. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La JoIIa, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 1 ,3 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit den Restriktionsendonukleasen Xbal und Ascl (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFX™PCR, DNA and Gel Band Puri- fication Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Der Vektor pCLiKI wurde ebenfalls mit den Restriktionsendonukleasen Xbal und Ascl geschnitten und mit alkalischer Phosphatase (I (Roche-Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 2,1kb) mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben (1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Ampicillin (50μg/ml) und Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK2.
Der Vektor pCLiK2 wurde mit der Restriktionsendonuklease Dral (New England Bio- labs, Beverly, USA) geschnitten. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde ein ca. 2,3 kb großes Vektorfragment mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor- Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers religiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK3.
Ausgehend vom Plasmid pWLQ2 (Liebl et al., 1992) als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimem SEQ ID NO:9 und SEQ ID NO: 10 der Repli- kationsursprung pHM1519 amplifiziert.
SEQ ID NO:9: 5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-S' SEQ ID NO:10: 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3'
Neben den zu pWLQ2 komplementären Sequenzen, enthalten die Oligonukleotidpri- mer SEQ ID NO:9 und SEQ ID NO: 10 Schnittstellen für die Restriktionsendonuklease Notl. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La JoIIa, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 2,7 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit der Restriktionsendonuklease Notl (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Der Vektor pCLiK3 wurde ebenfalls mit der Restriktionsendonuklease Notl geschnitten und mit alkalischer Phosphatase (I (Roche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 2,3kb) mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5.
Für die Erweiterung von pCLiKδ um eine „multiple cloning Site" (MCS) wurden die bei- de synthetischen, weitestgehend komplementären Oligonukleotide SEQ ID NO:11 und SEQ ID NO:12, die Schnittstellen für die Restriktionsendonukleasen Swal, Xhol, Aatl, Apal, Asp718, MIuI, Ndel, Spei, EcoRV, Sali, CIaI, BamHI, Xbal und Smal enthalten, durch gemeinsames erhitzen auf 950C und langsames abkühlen zu einem dop- pelsträngigen DNA-Fragment vereinigt. SEQ ID N0:11 : 5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATAT
GACTAGTTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCTGCGTTAATTAAC AATTGGGATCCTCTAGACCCGGGATTTAAAT-3'
SEQ ID NO: 12: 5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAG
CATCGATGTCGACGATATCCCTAGGTCCGAACTAGTCATATGACGCGTGGTACCG GGCCCGACGTCAGGCCTCTCGAGATTTAAAT-S'
Der Vektor pCUK5 wurde mit den Restriktionsendonuklease Xhol und BamHI (New England Biolabs, Beverly, USA) geschnitten und mit alkalischer Phosphatase (I (Roche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach E- lektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 5,0 kb) mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem synthetischen Doppelsträngigen DNA-Fragment ligiert und der Ligati- onsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL- 1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kaπamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5MCS.
Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pCLiK5MCS ist als SEQ ID NO: 13 aufgeführt.
Beispiel 2:
Herstellung des Plasmids PmetA metA Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 14 und SEQ ID NO: 15, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein das metA Gen inklusice des nichkodierenden 5'-Bereichs amplifiziert.
SEQ ID NO: 14 δ'-GCGCGGTACCTAGACTCACCCCAGTGCT -31 und
SEQ ID NO: 15 5'-CTCTACTAGTTTAGATGTAGAACTCGATGT -S'
Das erhaltene DNA Fragment von ca. 1 ,3 kb Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Asp718 und Spei (Roche Diagnostics, Mannheim) gespalten und das DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit aufgereinigt.
Der Vektor pClikδMCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen Asp718 und Spei geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Das Vektorfragment wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XMBIue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pCüK5MCS PmetA metA ist als SEQ ID NO 16: aufgeführt. Beispiel 3:
Herstellung des Plasmids pCLiK5MCS Psod metA
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO 17 und SEQ ID NO 18, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Frag- ment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) der Superoxiddismutase (Psod) amplifiziert.
SEQ ID NO: 17
5'-GAGACTCGAGAGCTGCCAATTATTCCGGG-S' und
SEQ ID NO: 18 5'-CCTGAAGGCGCGAGGGTGGGCATGGGTAAAAAATCCTTTCG -S'
Das erhaltene DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
Ausgehend vom Plasmid PmetA metA SEQ ID NO: 16 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO: 19: und SEQ ID NO: 20: ein Teil von metA amplifiziert.
SEQ ID NO: 19 δ'-CCCACCCTCGCGCCTTCAG -3' und SEQ ID NO: 20
5'-CTGGGTACATTGCGGCCC -3'
Das erhaltene DNA Fragment von ungefähr 470 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gerei- nigt.
In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 18 eingebrachten, zu metA homologen Sequenzen, kommt es im Zuge der PCR- Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidpri- mer SEQ ID NO: 17 und SEQ ID NO: 20 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.
Das amplifizierte DNA Fragment von ungefähr 675 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Ncol (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 620 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.
Das Plasmid PmetA metA SEQ ID NO 16: wurde mit den Restriktionsenzymen Ncol und Spei (Roche Diagnostics, Mannheim) gespalten. Nach gelelektrophoretischer Auf- trennung wurde ein ca. 0,7 kb großes metA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit aus der Agarose aufgereinigt.
Der Vektor pClik5MCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen Xhol und Spei (Roche Diagnostics, Mannheim) geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Das Vektorfragment wurde zusammen mit dem PCR-Fragment und dem metA- Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschriebe^ 1989)), in kompetente E. coli XL-1Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) er- reicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pCLiK5MCS PSODmetA ist als SEQ ID NO: 21 : aufgeführt. Beispiel 4:
Herstellung des Plasmids pCLiK5MCS P EF-TU metA
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO 22 und SEQ ID NO 23, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Frag- ment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Promotorregion) der Superoxiddismutase (Psod) amplifiziert.
SEQ ID NO: 22 δ'-GAGACTCGAGGGCCGTTACCCTGCGAATG -S' und
SEQ ID NO: 23 5'-CCTGAAGGCGCGAGGGTGGGCATTGTATGTCCTCCTGGAC -S'
Das erhaltene DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purifica- tion Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
Ausgehend vom Plasmid PmetA metA SEQ ID NO: 16 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimem SEQ ID NO: 24 und SEQ ID NO: 25 ein Teil von metA amplifiziert.
SEQ ID NO: 24
5'-CCCACCCTCGCGCCTTCAG -3' und
SEQ ID NO: 25 5'-CTGGGTACATTGCGGCCC -3'
Das erhaltene DNA Fragment von ungefähr 470 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.
In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 18 eingebrachten, zu metA homologen Sequenzen, kommt es im Zuge der PCR- Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Stan- dardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidpri- mer SEQ ID NO: 22 und SEQ ID NO: 25 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.
Das amplifizierte DNA Fragment von ungefähr 675 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Ncol (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 620 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.
Das Plasmid PmetA metA SEQ ID NO: 16 wurde mit den Restriktionsenzymen Ncol und Spei (Roche Diagnostics, Mannheim) gespalten. Nach gelelektrophoretischer Auftrennung wurde ein ca. 0,7 kb großes metA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit aus der Agarose aufgereinigt.
Der Vektor pClikδMCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen Xhol und Spei (Roche Diagnostics, Mannheim) geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Das Vektorfragment wurde zusammen mit dem PCR-Fragment und dem metA- Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Wei- terstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pCLiK5MCS P_EFTUmetA ist als SEQ ID NO: 26 aufgeführt.
Beispiel 5: Herstellung des Plasmid pCLiK5MCS Pgro metA
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpa- riert. Mit den Oligonukleotidprimer SEQ ID NO 27 und SEQ ID NO 28, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Region der Ex- pressionseinheit) der Gens GroES (Pgro) amplifiziert.
SEQ ID NO: 27 δ'-GAGACTCGAGCGGCTTAAAGTTTGGCTGCC -31
SEQ ID NO :28
5'-CCTGAAGGCGCGAGGGTGGGCATGATGAATCCCTCCATGAG -S'
Das erhaltene DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
Ausgehend vom Plasmid PmetA metA als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimem SEQ ID NO:29 und SEQ ID NO: 30 ein Teil von metA amplifiziert.
SEQ ID NO: 29 δ'-CCCACCCTCGCGCCTTCAG -3'
SEQ ID NO: 30 5'-CTGGGTACATTGCGGCCC -3'
Das erhaltene DNA Fragment von ungefähr 470 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.
In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 28 eingebrachten, zu metA homologen Sequenzen, kommt es im Zuge der PCR- Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Stan- dardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidpri- mer SEQ ID NO: 27 und SEQ ID NO: 30 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.
Das amplifizierte DNA Fragment von ungefähr 675 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Ncol (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 620 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.
Das Plasmid PmetA metA SEQ ID NO: 16 wurde mit den Restriktionsenzymen Ncol und Spei (Roche Diagnostics, Mannheim) gespalten. Nach gelelektrophoretischer Auftrennung wurde ein ca. 0,7 kb großes metA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit aus der Agarose aufgereinigt.
Der Vektor pClik5MCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen Xhol und Spei (Roche Diagnostics, Mannheim) geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Das Vektorfragment wurde zusammen mit dem PCR-Fragment und dem metA- Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Wei- terstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pCLι'K5MCS Pgro metA ist als SEQ ID NO: 31 aufgeführt. Beispiel 6:
Herstellung des Plasmids P EF-TS metA
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer BK 1849 (SEQ ID NO: 32) und BK 1862 (SEQ ID NO: 33), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stra- tagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, das metA Gen, das für die Homoserin-O- Acetyltransferase kodiert, amplifiziert.
BK 1849 (SEQ ID NO: 32)
5'- GTGTGTCGACTTAGATGTAGAACTCGATGTAG -3' und
BK 1862 (SEQ ID NO: 33) 5'-ATGCCCACCCTCGCGCC -3'
Das erhaltene DNA Fragment von ca. 1134 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
Mit den Oligonukleotidprimer Haf 26 (SEQ ID NO: 34) und Haf 27 (SEQ ID NO: 35), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in
Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic
Press beschrieben, ein DNA Fragment von ca. 200 Basenpaaren aus dem nichtkodie- renden 5'-Bereich (Region der Expressionseinheit) der Gens, das für den Elongations- faktor TS kodiert, amplifiziert.
Haf 26 (SEQ ID NO: 34) δ'-GAGAGGATCCCCCCCACGACAATGGAAC-S' und
Haf 27 (SEQ ID NO: 35) 5'-CCTGAAGGCGCGAGGGTGGGCATTACGGGGCGATCCTCCTTATG -3'
Das erhaltene DNA Fragment von ca. 195 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Die Primer Haf 27 und BK I862enthalten eine überlappende Sequenz und sind an ihren 5'-Enden homolog zueinander.
Die oben erhaltenen PCR-Produkte wurden als Template für eine weitere PCR eigen- setzt, in der die Primer BK 1849 (SEQ ID NO: 32) und Haf 26 (SEQ ID NO: 34) genutzt wurden.
Mit diesem Ansatz konnte ein DNA-Fragment amplifiziert werden, das der erwarteten Größe von 1329 bp entsprach. Diese P EF-TS/metA-Fusion wurde dann über die Restriktionschnittstellen BamHI und Sali in den Vektor pClik 5a MCS (SEQ ID NO: 13) kloniert.
Das Vektorfragment wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben^ 989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Wei- terstadt) aufgetrennt und ausgewertet.
Das resultierende Plasmid wurde mit pClik 5a MCS P EF-TS metA (SEQ ID NO: 36 ) bezeichnet.
Beispiel 7:
Herstellung des Plasmids P EF-Tu pSOD metA (H473)
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer BK 1753 (SEQ ID NO: 37) und BK 1754 (SEQ ID NO: 38) , der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, der GroEL-Terminator amplifiziert. BK 1753 (SEQ ID NO: 37) GGATCTAGAGTTCTGTGAAAAACACCGTG
BK 1754 (SEQ ID NO: 38) GCGACTAGTGCCCCACAAATAAAAAACAC
Das erhaltene DNA Fragment von ca. 77 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, mit den Restriktionsenzymen Xba I und Bcu I geschnitten und nochmals gereinigt.
Der Vektor pClikδMCS (SEQ ID NO: 13) wurde mit dem Restriktionsenzym Xbal line- arisiert und mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt,
Der linearisierte Vektor wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa1 USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Wei- terstadt) aufgetrennt und ausgewertet.
Das resultierende Plasmid wurde mit H247 bezeichnet (SEQ ID NO: 39) bezeichnet.
Dieses Plasmid wurde mit den Restriktionsenzymen Beul und Sali behandelt und mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt,
Eine PCR mit den Oligonukleotiden BK 1848 (SEQ ID NO: 40) und BK 1849 (SEQ ID
NO: 41 ), dem Plasmid pClikδMCS Psod metA (SEQ ID NO: 21 ) als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, durchgeführt. Das amplifizierte Fragment hatte eine erwartete Länge von ca 1350 bp und wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (A- mersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, mit den Re- striktionsenzymen Beul und Sali geschnitten und nochmals gereinigt.
Dieses Fragment wurde mit dem Plasmid H247 (Schnittstellen Beul und Sali) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das resultierende Plasmid wurde als pG A4 (H344) bezeichnet und ist unter der SEQ ID NO: 42 aufgeführt.
SEQ ID NO: 40 (BK 1848)
GAGAACTAGTAGCTGCCAATTATTCCGGG
SEQ ID NO: 41 (BK 1849) GTGTGTCGACTTAGATGTAGAACTCGATGTAG
Das Plasmid pG A4 (SEQ ID NO: 42) wurde mit den Restriktionsenzymen Xhol und Beul geschnitten und mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
Konstruktion von H473:
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpa- riert. Mit den Oligoπukleotidprimer BK 1695 (SEQ ID NO: 43) und Haf16 (SEQ ID NO: 44), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratage- ne) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Acade- mic Press beschrieben, ein DNA Fragment von ca. 182 Basenpaaren aus dem nicht- kodierenden 5'-Bereich (Region der Expressionseinheit) der Gens EF Tu (Peftu) ampli- fiziert.
SEQ ID NO: 43 (BK1695) GAGACTCGAGGGCCGTTACCCTGCGAATG
SEQ ID NO: 44 (Haf 16) GAGAACTAGTGTGGCTACGACTTTCGCAGC
Das erhaltene DNA Fragment von ca. 200 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, mit den Restriktionsenzymen Xho I und Bcu I geschnitten und nochmals gereinigt.
Dieses Fragment wurde mit dem Plasmid Plasmid pG A4 (H344) (Schnittstellen Xhol und Beul) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E.coli XL-1Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Das erhaltene Plasmid wurde pClikδMCS PeftuPsod metA genannt (H473). Es ist unter SEQ ID NO: 45 aufgeführt. Es enthält (von 5' nach 3') einen Peftu-Promoter, eine Psod Expressionseinheit und direkt anschließend das metA open reading frame.
Beispiel 8: Herstellung des Plasmides PsodPeftu metA (H505)
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 46 (Haf64) und SEQ ID NO: 47 (Haf65), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stra- tagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 200 aus dem nichtkodieren- den 5'-Bereich (Region der Expressionseinheit) des Gens EF Tu (Peftu) amplifiziert.
SEQ ID NO: 46 (Haf64) GAGAACTAGTGGCCGTTACCCTGCGAATG
SEQ ID NO: 47 (Haf65) GCGCGAGGGTGGGCATTGTATGTCCTCCTGGACTTC
Das erhaltene DNA Fragment von ca. 200 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
In einer zweiten PCR mit den Oligonukleotidprimern BK1862 (SEQ ID NO: 48) und BK1849 (SEQ ID NO: 49) und dem Plasmid H344 (SEQ ID NO: 42) als Template wurde das metA open reading frame nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, amplifiziert. Das erhaltene Fragment von ca. 1140 bp Länge wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
SEQ IDNO:48(BK1862) ATGCCCACCCTCGCGCC
SEQ IDNO:49(BK1849) GTGTGTCGACTTAGATGTAGAACTCGATGTAG
In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer Haf 65 SEQ ID NO: 47 eingebrachten zu metA homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlänge- rung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer Haf 64 und BK 1849 SEQ ID NO: 46 und SEQ ID NO: 49 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden. Das amplifizierte DNA Fragment von ungefähr 1350 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Beul und Sali (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1340 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Arπersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Dieses Fragment enthält die Peftu-Expressionseinheit fusioniert mit dem metA ORF (= Fragment Peftu-metA).
Mit den Oligonukleotidprimer BK 1697 (SEQ ID NO: 50) und Haf17 (SEQ ID NO:51 ). der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment (Gesamtlänge: 193 bp, davon 173 pSOD) aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) des Gens SOD (Psod) amplifiziert.
SEQ ID NO: 50 (BK 1697) GAGACTCGAGAGCTGCCAATTATTCCGGG
SEQ ID NO: 51 (Haf 17) GAGAACTAGTTAGGTTTCCGCACCGAGC
Das amplifizierte DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purifi- cation Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Beul (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 180 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt (= Fragment Psod).
Das Plasmid (H344) pG A4 SEQ ID NO: 42 wurde mit den Restriktionsenzymen Xhol und Sali (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde linearisierte Vektor mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.
Der linearisierte Vektor wurde mit den beiden Fragmenten (Fragment Peftu-metA und Fragment Psod) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pClikδMCS PsodPeftu metA ist als SEQ ID NO: 52 aufgeführt.
Beispiel 9:
Herstellung des Plasmides pClik5MCS Pgro Psod metA (H472)
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpa- riert. Mit den Oligonukleotidprimem SEQ ID NO: 53 (BK1701) und SEQ ID NO: 54 (Haf18), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stra- tagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 175 Nt amplifiziert. Es enthält 155 Basenparre aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) des Gens GRO EL (Pgro) und je eine Restriktionsschnittstelle am 5' und 3' Ende (Xhol bzw. Beul).
SEQ ID NO: 53 (BK1701) GAGACTCGAGCGGCTTAAAGTTTGGCTGCC
SEQ ID NO: 54 (HafO18) GAGAACTAGTATTTTGTGTGTGCCGGTTGTG
Das erhaltene DNA Fragment von ca. 175 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Beul (Roche Diagnostics, Mannheim) gespalten und das DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit aufgereinigt. Das Plasmid H344 (SEQ ID NO: 42) wurde mit den Restriktionsenzymen Xhol und Beul geschnitten und ein ca. 6.4 kb großes Fragment nach elektrophoretischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Das PCR-Produkt und das aufgeschnittene Plasmid H344 wurden mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt.
. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das resultierende Plasmid enthält einen Pgro-Promoter direkt gefolgt von einer Psod-
Expressionseinheit und dem metA ORF.
Es ist als pCLiK5MCS PgroPsod metA (H472) ist als SEQ ID NO: 55 aufgeführt.
Beispiel 10:
Herstellung des Plasmides PgroPsod Pefts metA (H501)
Mit den Oligonukleotidphmern BK1782 (SEQ ID NO: 56) und Haf63 (SEQ ID NO: 57) und dem Plasmid pClikδMCS Pgro Psod metA (SEEQ ID NO: 55 (H472)) als template wurde ein PCR nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, durchgeführt. Das amplifizierte Fragment umfasst ca. 474 Basenparre und enthält eine Pgro-Psod- Kassette mit einer Acc65l-Schnittstelle am 3'-Ende. Das erhaltene DNA Fragment wur- de mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Acc65l gespalten und das DNA Fragment (333 Basenpaare) mit GFX™PCR, DNA and Gel Band Purification Kit aufgereinigt.
SEQ ID NO: 56 (BK1782) TCGAGAGATTGGATTCTTAC
SEQ ID NO: 57 (Haf 63)
TCTCGGTACCCCGCACCGAGCATATACATC
Das Plasmid H479 (SEQ ID NO: 58) enthält die Pefts Expressionseinheit fusioniert mit dem metA ORF. Es wurde mit den Restriktionsenzymen Xhol und Acc65l (direkt upstream von Pefts) geschnitten und ein ca. 6.4 kb großes Fragment nach elektropho- retischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Anschließend wurde es mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem PCR-Fragment (Pgro-Psod- Kassette) ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das resultierende Plasmid enthält die 3 Promotoren Pgro Psod und P EF -Ts fusioniert mit dem metA ORF. Es ist als pCLiK5MCS Pgro Psod Pefts metA (H501 ) ist als SEQ ID NO: 59 aufgeführt.
Beispiel 11 :
Herstellung des Plasmides Peftu Psod Pefts metA (H502)
Mit den Oligonukleotidprimern BK1782 (SEQ ID NO: 56) und Haf63 (SEQ ID NO: 57) und dem Plasmid pClikδMCS Peftu Psod (SEQ ID NO: 45 (H473)) als Template wurde ein PCR nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to
Methods and Applications, Academic Press beschrieben, durchgeführt. Das amplifizier- te Fragment umfasst ca. 495 Basenparre und enthält eine Peftu-Psod-Kassette mit einer Acc65l-Schnittstelle am 3'-Ende. Das erhaltene DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Acc65l gespalten und das DNA Fragment (354 Basenpaare) mit GFX™PCR, DNA and Gel Band Purification Kit aufgereinigt.
SEQ ID NO: 56 (BK1782)
TCGAGAGATTGGATTCTTAC
SEQ ID NO: 57 (Haf 63) TCTCGGTACCCCGCACCGAGCATATACATC
Das Plasmid H479 (SEQ ID NO: 58) enthält die Pefts Expressionseinheit fusioniert mit dem metA ORF. Es wurde mit den Restriktionsenzymen Xhol und Acc65l (direkt upstream von Pefts) geschnitten und ein ca. 6.4 kb großes Fragment nach elektropho- retischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.
Anschließend wurde es mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem PCR-Fragment (Peftu-Psod- Kassette) ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben^ 989)), in kompetente E.coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das resultierende Plasmid enthält die 3 regulatorischen Sequenzen Peftu Psod und P EF -Ts fusioniert mit dem metA ORF. Es ist als pCLiK5MCS Peftu Psod Pefts metA (H501 ) ist als SEQ ID NO: 60 aufgeführt.
Beispiel 12:
Messung der metA-Aktivitäten Der Stamm Corynebacterium glutamicum ATCC13032 wurde jeweils mit den Plasmiden pClikδ MCS, pClik MCS Psod metA, pClik MCS Peftu metA, pClikδ MCS Pefts metA, pClikδ MCS Peftu Psod metA, pClikδ MCS Psod Peftu metA, pClikδ MCS Pgro Psod meta, pClikδ MCS Pgro Psod Pefts metA, pClikδ MCS Peftu Psod Pefts metA nach der beschriebenen Methode (Liebl, et al. (1989) FEMS Microbiology Letters 53:299-303) transformiert. Die Transformationsmischung wurde auf CM-Platten plattiert, die zusätzlich 20mg/l Kanamycin enthielten, um eine Selektion auf Plasmid-haltige Zellen zu erreichen. Erhaltene Kan-resistente Klone wurden gepickt und vereinzelt.
C. glutamicum Stämme, die eines dieser Plasmidkonstrukte enthielten, wurden in MMA-Medium ((40 g/l Saccharose, 20 g/l (NhU)2SO4, 1 g/l KH2PO4, 1 g/l K2HPO4, 0,25g/t MgSO4 x 7H2O, 54 g Aces, 1 ml CaCI2 (10 g/l), 1 ml Protocatechoat (300 mg/10 ml), 1 ml Spurenelementelösung (10 g/l FeSO4 x /H2O, 10 g/l MnSO4 x H2O, 2 g/l ZnSO4 x 7 H2O, 0,2 g/l CuSO4, 0,02 g/l NiCI2 x 6 H2O)J OO μg/l Vitamin B12, 0,3 mg/l Thiamin, 1 mM Leucin, 1 mg/l Pyridoxal HCl, 1 ml Biotin ( 100 mg/l), pH7,0) bei 300C über Nacht angezogen. Die Zellen wurden bei 40C abzentrifugiert und das zweimal mit kaltem Tris-HCI-Puffer (0,1%, pH 8,0) gewaschen. Nach erneuter Zentrifugation wurden die Zellen in kalten Tris-HCI-Puffer ( 0,1 %, pH 8,0) aufgenommen und eine OD60O von 160 eingestellt. Für den Zellaufschluß wurden 1 ml dieser Zellsuspension in 2 ml Ribolyserröhrchen der Fa. Hybaid überführt und in einem Ribolyser der Fa. Hybaid bei einer Rotationseinstellung von 6,0 dreimal für jeweils 30 sec lysiert. Das Lysat wurde durch 30minütige Zentrifugation bei 15.000 rpm bei 4°C in einer Eppendorfzentrifu- ge geklärt und der Überstand in ein neues Eppendororfcup überführt. Der Proteingehalt wurde nach Bradford, M. M. (1976) Anal. Biochem. 72:248-254 bestimmt.
Die enzymatische Aktivität von MetA wurde wie folgt durchgeführt. Die Reaktionsansätze von 1 ml enthielten 100 mM Kaliumphosphatpuffer (pH 7,5), 5mM MgCI2, 100 μM Acetyl CoA, 5mM L-Homoserine, 500 μM DTNB (Ellmans Reagenz) und Zellextrakt. Der Test wurde durch Zugabe von dem jeweiligen Proteinlysat gestartet und bei Raumtemperatur inkubiert. Es wurde dann eine Kinetik bei 412 nm über 10 min aufgenommen.
Die Ergebnisse sind in Tabelle 1a gezeigt.
Tabelle 1a
Die Aktivität von MetA konnte durch die Verwendung der verschiedenen Kombinationen von Promotern/Expressionseinheiten moduliert werden.
Beispiel 13:
Konstruktion von Plasmid pCIS lysC
Um einen Lysin-produzierenden Stamm zu generieren wurde ein allelischer Austausch des lysC Wildtypgens in Corynebakterium glutamicum ATCC13032 durchgeführt. Dabei wurde im lysC Gen ein Nukleotidaustausch durchgeführt, so daß im resultierenden Protein die Aminosäure Thr an der Position 311 durch ein He ausgetauscht wurde. Ausgehend von der chromosomalen DNA aus ATCC13032 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO:61 und SEQ ID NO:62 lysC mit Hilfe des Pfu-Turbo PCR Systems (Stratagene USA) nach Angaben des Herstellers amplifiziert.
SEQ ID NO:61 5'-GAGAGAGAGACGCGTCCCAGTGGCTGAGACGCATC -S'
SEQ ID NO:62 5'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-S'
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Das amplifizierte Fragment wird an seinem 5'-Ende von einem Sali Restriktionsschnitt und an seinem 3"-Ende von einem MIuI Restriktionsschnitt flankiert. Vor der Klonierung wurde das amplifizierte Fragment durch diese beiden Restriktionsenzyme verdaut und mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharma- cia, Freiburg) aufgereinigt. Das erhaltenen Polynukleotid wurde über die Sali und MIuI Restriktionsschnitte in pCLIKδ MCS integrativ SacB im folgenden pCIS genannt (SEQ ID NO: 63) kloniert und in E. coli XL-1 blue transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht. Das Plasmid wurdn isoliert und durch Sequenzierung die erwartete Nukleotidsequenz bestätigt. Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet. Das erhaltene Plasmid pCIS lysC ist als SEQ ID NO:64 aufgeführt.
Beispiel 14:
Mutagenese des lysC Gens aus C. glutamicum
Die gerichtete Mutagenese des lysC Gens aus C. glutamicum wurde mit dem Quick- Change Kit (Fa. Stratagene/USA) nach Angaben des Herstellers durchgeführt. Die Mutagenese wurde im Plasmid pCIS lysC, SEQ ID NO:64 durchgeführt. Für den Austausch von thr 311 nach 31 1 ile mit Hilfe der Quickchange Methode (Stratagene) wur- den folgende Oligonukleotidprimer synthetisiert:
SEQ ID NO:65 δ'-CGGCACCACCGACATCATCTTCACCTGCCCTCGTTCCG -S'
SEQ ID NO:66
5'-CGGAACGAGGGCAGGTGAAGATGATGTCGGTGGTGCCG -S'
Der Einsatz dieser Oligonukleotidprimer in der Quickchange Reaktion führt in dem lysC Gen SEQ ID NO:67 zu einem Austausch des Nukleotids in Position 932 (von C nach T). Der resultierende Aminosäureaustausch Thr311 lle im lysC Gen wurde nach Transformation in E. coli XL1-blue und Plasmidpräparation durch ein Sequenzierungsreaktionen bestätigt. Das Plasmid erhielt die Bezeichnung pCIS lysC thr311ile und ist als SEQ ID NO:68 aufgeführt.
Das Plasmid pCIS lysC thr311ile wurde in C. glutamicum ATCC13032 mittels Elektro- poration wie bei Liebl, et al. (1989) FEMS Microbiology Letters 53:299-303 beschrieben, transformiert. Modifikationen des Protokolls sind in DE 10046870 beschrieben. Die chromosomale Anordnung des lysC-Lokus einzelner Transformanten wurde mit Standardmethoden durch Southernblot und Hybridisierung wie in Sambrook et al. (1989), Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben, überprüft. Dadurch wurde sichergestellt, daß es sich bei den Transformanten um solche handelt, die das transformierte Plasmid durch homologe Rekombination am lysC- Lokus integriert haben. Nach Wachstum solcher Kolonien über Nacht in Medien, die kein Antibiotikum enthalten, werden die Zellen auf ein Saccharose-CM-Agarmedium (10% Saccharose, 10 g/l Glucose; 2,5 g/l NaCI; 2 g/l Harnstoff, 10 g/l Bacto Peptone (Fa. Difco); 10 g/l Hefeextrakt, 22,0 g/L Agar (Difco)) ausplattiert und bei 300C für 24 Stunden inkubiert.
Da das im Vektor pCIS lysC thr31 1 ile enthaltende sacB Gen Saccharose in ein toxi- sches Produkt umwandelt, können nur solche Kolonien anwachsen, die das sacB Gen durch einen zweiten homologen Rekombinationsschritt zwischen dem Wildtyp lysC
Gen und dem mutierten Gen lysC thr311ile deletiert haben. Während der homologen
Rekombination kann entweder das Wildtyp Gen, oder das mutierte Gen zusammen mit dem sacB Gen deletiert werden. Wenn das sacB Gen zusammen mit dem Wildtyp Gen entfernt wird, resultiert eine mutierte Transformante.
Anwachsende Kolonien wurden gepickt, und auf eine Kanamycin-sensitiven Phänotyp hin untersucht. Klone mit deletiertem SacB Gen müssen gleichzeitg Kanamycin sensitives Wachstumsverhalten zeigen. Solche Kan-sensitiven Klone wurde im einem Schüttelkolben auf ihre Lysin-Produktivivät hin untersucht (siehe Beispiel 19). Zum Vergleich wurde der nicht behandelte C. glutamicum ATCC13032 angezogen. Klone mit einer gegenüber der Kontrolle erhöhten Lysin-Produktion wurden selektiert, chromosomale DNA gewonnen und der entsprechende Bereich des lysC Gens durch eine PCR-Reaktion amplifiziert und sequenziert. Ein solcher Klon mit der Eigenschaft erhöh- ter Lysin-Synthese und nachgewiesener Mutation in lysC an der Stelle 932 wurde mit ATCC 13032 lysCfbr bezeichnet.
Beispiel 15: Herstellung des Plasmides pCIS Peftu ddh
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimern SEQ ID NO: 69 (Old38) und SEQ ID NO: 70 (Old 39), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratage- ne) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Acade- mic Press beschrieben, ein DNA Fragment von ca. 200 aus dem nichtkodierenden 5'- Bereich (Region der Expressionseinheit) des Gens EF Tu (Peftu) amplifiziert. SEQ ID NO: 69 (Old38) ACATCCATGGTGGCCGTTACCCTGCGAAT
SEQ ID NO: 70 (Old 39) TGTATGTCCTCCTGGACTTC
Das erhaltene DNA Fragment von ca. 200 bp Größe wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
In einer zweiten PCR mit den Oligonukleotidprimern Old40 (SEQ ID NO: 71 ) und SEQ ID NO: 72 (Old 37) und chromosomaler DNA aus C. glutamicum ATCC 13032 als template wurde das ddh open reading frame nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, amplifiziert. Das erhaltene Fragment von ca. 1017 bp Länge wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.
Old40 (SEQ ID NO: 71 ) GAAGTCCAGGAGGACATACAATGACCAACATCCGCGTAGC
Old 37 (SEQ ID NO: 72) GAAACCACACTGTTTCCTTGC
In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer Old40 SEQ ID NO: 71 eingebrachten zu Peftu homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer Old37 und Old 38 (SEQ ID NO: 72 und SEQ ID NO: 69) erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.
Das amplifizierte DNA Fragment von ungefähr 1207 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Ncol und Xhol (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1174 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Dieses Fragment enthält die Peftu-Expressionseinheit fusioniert mit dem ddh ORF (= Fragment Peftu-ddh).
Mit den Oligonukleotidprimer Old 32 (SEQ ID NO: 73) und Old 33 (SEQ ID NO: 74), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in
Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic
Press beschrieben, ein DNA Fragment aus dem nichtkodierenden 5'-Bereich des Gens ddh amplifiziert.
SEQ ID 73 (Old32)
ATCAACGCGTCGACACCACATCATCAATCAC
SEQ ID 74 (Old33) ATCACCATGGGTTCTTGTAATCCTCCAAAATTG
Das amplifizierte DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purifi- cation Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen MIuI und Ncol (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 720 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt (= Fragment 5' ddh).
Das Plasmid pCIS (SEQ ID NO: 63) wurde mit den Restriktionsenzymeπ MIuI und Xhol (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde linearisierte Vektor mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.
Der linearisierte Vektor wurde mit den beiden Fragmenten (Fragment Peftu-ddh und Fragment 5' ddh) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E.coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Aus- plattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa.
Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.
Das entstandene Plasmid pCIS Peftu ddh ist als SEQ ID NO: 75 aufgeführt.
Beispiel 16:
Herstellung von pCIS Peftu Psod ddh
Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168-179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 76 und SEQ ID NO: 77, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 677 Basenpaaren aus dem 5'-Bereich der ddh-Gens amplifiziert (Fragment 5'ddh).
SEQ ID NO: 76 (CK461 ) CCTGACGTCGCAATATAGGCAGCTGAATC
SEQ ID NO : 77 (CK466) GCCCAATTGGTTCTTGTAATCCTCCAAAA
Das erhaltene DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purifica- tion Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Aatll und Muni (Roche Di- agnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 661 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Das entstandene Fragment enthät den 5'-Bereich des ddh-ORFs.
Ausgehend vom Plasmid P EF-Tu pSOD metA (H473) (SEQ ID 45) als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimem SEQ ID NO.-78 und SEQ ID NO: 79 eine PeftuPsod Kassette amplifiziert. SEQ ID NO: 78 (CK426) CGCCAATTGTCGAGGGCCGTTACCCT
SEQ ID NO: 79 (CK463) GCTACGCGGATGTTGGTCATGGGTAAAAAATCCTTTCGTA
Das erhaltene DNA Fragment von ungefähr 378 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.
In einer nachfolgenden PCR wurde das ddh ORF amplifiziert. Dazu wurde chromosomale DNA aus C. glutamicum ATCC 13032 nach Tauch et al. (1995) Plasmid 33:168- 179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Mit den Oli- gonukleotidprimer SEQ ID NO: 80 (CK464) und SEQ ID NO: 81 (CK467=, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 992 Basenpaaren (ddh-ORF) amplifiziert (Fragment ddh). Das ampli- fizierte DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.
SEQ ID NO: 80 (CK464) TACGAAAGGATTTTTTACCCATGACCAACATCCGCGTAGC
SEQ ID NO: 81 (CK467) AGACCCGGGTTAGACGTCGCGTGCGATCA
In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente (Pef- tuPsod-Kassette und ddh-ORF) gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 80 (CK464) eingebrachten, zu Psod homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifi- ziert, dass die verwendeten Oligonukleotidprimer SEQ ID NO: 79 (CK426) und SEQ ID NO: 81 (CK467) erst mit Beginn des 2. Zyklus dem Reaktionsansatz zugegeben wurden.
Das amplifizierte DNA Fragment von ungefähr 1359 Basenpaaren wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.
Im Anschluß daran wurde es mit den Restriktionsenzymen Muni und Smal (Roche Di- agnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1349 Basenpaar große DNA Fragment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Das entstandene Fragment enthält (von 5' nach 3') einen Peftu-Promoter, eine Psod Expressionseinheit und direkt anschließend das ddh open reading frame (PeftuPsod ddh).
Der Vektor pCIS wurde mit den Restriktionsendonukleasen Aatll und Smal geschnitten und mit alkalischer Phosphatase (Roche Diagnostics, Mannheim) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 4.2 kb) mit dem GFX™PCR, DNA and Gel Band Purifi- cation Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit den beiden geschnittenen PCR Fragmenten (5'ddh sowie PeftuPsod ddh) ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben(1989)), in kompetente E. coli XL-1 Blue (Stratagene, La JoIIa, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1 :190) erreicht.
Die Plasmid-DNA von individuellen Klonen wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. 2 korrekte Plasmide wurden sequenziert. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet. Das entstandene Plasmid pClik Peftu Psod ddh ist dazu geeignet, um mit Hilfe von 2 aufeinanderfolgenden Rekombinationsereignissen die PeftuPsod-Kassette vor das ddh-ORF chromosomal zu integrieren. Das Plasmid pCIS PeftuPsod ddh ist als SEQ ID NO: 82 aufgeführt.
Beispiel 17:
Generierung der Stämme ATCC13032 lysCfbr Peftu ddh und ATCC13032 lysCfbr
PeftuPsod ddh
Zellen des E. coli-Stammes Mn522 (Firma Stratagene, Amsterdam, Nierderlande) wurde mit einem der Plasmide pCIS Peftu ddh und pCIS PeftuPsod ddh sowie mit dem Plasmid pTc15AcglM nach Liebl, et al. (1989) FEMS Microbiology Letters 53:299-303 transformiert. Das Plasmid pTc15AcglM ermöglicht die Methylierung von DNA nach dem Methylierungsmuster von Corynebacterium glutamicum (DE 10046870). Durch diese Methylierung wird die Stabilität der Plasmide pCIS Peftu ddh und pCIS PeftuPsod ddh in C. glutamicum-Zellen erhöht. Die Plasmid-DNA wurde anschließend aus den Mn522-Zellen nach Standardmethoden isoliert und mit Hilfe von Elektroporation den oben beschriebenen Corynebacterium glutamicum -Stamm ATCC 13032 ask (fbr) eingebracht. Aus dieser Elektroporation und der nachfolgenden Selektion auf CM- Platten mit Kanamycin (25 μg/ml) wurden mehrere Transkonjuganten erhalten. Zur Selektion auf das zweite Rekombinationsereignis, das zur Excision des Vektors führen soll, wurden diese Transkonjuganten in CM-Medium über Nacht ohne Kanamycin angezogen und anschließend zur Selektion auf CM-Platten mit 10% Saccharose ausplat- tiert. Das auf dem Vektor pCIS vorhandenen sacB-Gen kodiert für das Enzym Laevan- sucrase und führt bei Wachstum auf Saccharose zur Synthese von Laevan. Da Laevan für C. glutamicum toxisch ist, können nur C. glutamicum Zellen, die das Integrati- onsplasmid durch den zweiten Rekombinationsschritt verloren haben, auf Saccharose- haltigem Medium wachsen (Jäger et al., Journal of Bacteriology 174 (1992) 5462- 5466). 100 Saccharose-resistente Klone wurden auf ihre Kanamycin-Sensitivität hin überprüft. Für mehrere der getesteten Klone konnte neben der Resistenz gegenüber Saccharose auch eine Sensitivität gegenüber Kanamycin nachgewiesen werden, was bei der erwünschten Excision der Vektorsequenzen erwartet wird. Ob auch die gewünschte Integration der Peftu bzw PeftuPsod-Expressionseinheit erfolgt war, wurde mittels Polymerase-Kettenreaktion (PCR) überprüft. Hierzu wurden die jeweiligen KIo- ne mit einem Zahnstocher von der Agarplatte abgenommen und in 100 μl H2O suspendiert und 10 min bei 95°C aufgekocht. Jeweils 10 μl der erhaltenen Lösung wurden als Template in die PCR eingesetzt. Als Primer wurden Oligonukleotide verwendet, die zur einzuführenden Expressionseinheit und dem ddh-Gen homolog sind. Die PCR- Bedingungen wurden wie folgt gewählt: Vorabdenaturierung:5 min bei 950C; Denaturierung 30 sec bei 95°C; Hybridisierung 30 sec bei 55°C; Amplifizierung 2 min bei 720C; 30 Zyklen,; End-Extension 5 min bei 720C. Im Ansatz mit der DNA des Ausgangsstammes konnte durch Wahl der Oligonukleotide kein PCR-Produkt entstehen. Nur bei Klonen, die durch die 2. Rekombination die Integration der Peftu oder PeftuPsod- Expressionseinheiten direkt 5' des ddh-Gens vollzogen haben, wurde ein Bande erwartet. Die erfolgreiche Integration der dabei positiv getesteten Klone wurde zudem noch per Southern blot Analyse bestätigt (nach Standardmethoden, wie z.B. in Sambrook et al. (Molecular Cloning. A Laboratory Manual, CoId Spring Harbor, beschrieben (1989)). Für jeden zu generierenden Stamm wurden dabei 2 unterschiedliche Hydrolysen mit Restriktionsenzymen durchgeführt, die eine eindeutige Unterscheidung von Ausgangsstamm (ATCC13032 ask (fbr)) und erwünschtem Stamm zulassen. Zudem wurde mit Hilfe einer Sonde, die homolog zum Kanamycin-Resistenz-Gen ist, bestätigt, dass die erhaltenen Stämme keine Kanamycin-Gene im Chromosom aufweisen. So konnten folgende Stämme generiert werden: ATCC13032 lysCftr Peftu ddh
ATCC 13032 lysCfbr PeftuPsod ddh
All diese Stämme enthalten ein feedback-dereguliertes ask-Gen und produzieren daher Lysin. Sie unterscheiden sich ausschließlich durch die Regulationseinheit, die die Transkription des ddh-Gens steuert.
Beispiel 18:
Auswirkung der Verstärkung von ddh durch einen Doppelpromoter auf die Ly- sinproduktion
Zur Untersuchung der Auswirkung der Verstärkung des ddh-Gens mit Hilfe eines Doppelpromoters wurden folgende Stämme auf Lysin-Produktion untersucht:
ATCC 13032 lysCfbr ATCC13032 lysCfbr Peftu ddh ATCC13032 lysCfbr Peftu Psod ddh
Dazu wurden die Stämme auf CM-Platten (10,0 g/L D-glucose, 2,5 g/L NaCI, 2,0 g/L
Harnstoff, 10,0 g/L Bacto Pepton (Difco), 5,0 g/L Yeast Extract (Difco), 5,0 g/L Beef Extract (Difco), 22,0 g/L Agar (Difco), autoklaviert (20 min. 1210C)) für 2 Tage bei 300C angezogen. Anschließend wurden die Zellen von der Platte abgekratzt und in Saline resuspendiert. Für die Hauptkultur wurden 10 ml Medium I und 0,5 g autoklaviertes
CaCO3 (Riedel de Haen) in einem 100 ml Erlenmeyerkolben mit der Zellsuspension bis zu einer OD60O von 1 ,5 beimpft und für 40h auf einem vom Typ Infors AJ118 (Fa. Infors, Bottmingen, Schweiz) bei 220 upm inkubiert. Anschließend wurde die Konzentration des in das Medium ausgeschiedene Lysins bestimmt.
Medium I:
40g/l Saccharose 60g/l Melasse (auf 100% Zuckergehalt berechnet)
10g/l (NH4)2SO4
0.4g/l MgSO4 *7H2O
0.6g/l KH2PO4
0.3mg/l ThiaminΗCI 1 mg/l Biotin (aus einer 1 mg/ml steril filtrierten Stammlösung die mit NH4OH auf pH
8,0 eingestellt wurde)
2mg/l FeSO4
2mg/l MnSO4 mit NH4OH auf pH 7,8 eingestellt, autoklaviert (1210C, 20 min). zusäztlich wird Vitamin B12 (Hydroxycobalamin Sigma Chemicals) aus einer Stammlösung (200 μg/ml, steril filtriert) bis zu einer Endkonzentration von 100 μg/l zugegeben
Die Bestimmung der Aminosäurekonzentration erfolgte mittels Hochdruckflüssigkeitschromatographie nach Agilent auf einer Agilent 1100 Series LC System HPLC. Eine Vorsäulenderivatisierung mit Ortho-Pthalaldehyd erlaubt die Quantifizierung der gebildeten Aminosäuren, die Auftrennung des Aminosäuregemisch findet auf einer Hypersil AA-Säule (Agilent) statt. Das Ergebnis der Untersuchung ist in folgender Tabelle dargestellt

Claims

Patentansprüche
1. Mehrfachpromoter-enthaltende Expressionseinheit umfassend in 5'-3'-Richtung 5 ein Sequenzmodul der folgenden allgemeinen Formel I:
5'-Pr(-Ax-Px-)n-Ay-Py-3' (|)
worin
I O n für einen ganzzahligen Wert von 0 bis 10 steht,
Ax und Ay gleich oder verschieden sind und für eine chemische Bindung oder eine Linker-Nukleinsäuresequenz stehen;
P1, Px und Py für gleiche oder verschiedene Promotorsequenzen kodieren, welche wenigstens einen RNA-Polymerase-bindenden Abschnitt umfassen; und
15 wenigstens Py einen die Ribosomenbindung vermittelnden, 3'-terminalen
Sequenzabschnitt umfasst.
2. Expressionseinheit nach Anspruch 1 , wobei P1, Px und Py jeweils von gleichen oder verschiedenen eukaryotischen oder prokaryotischen Organismen abgeleitet 0 sind oder künstliche Promotorsequenzen sind.
3. Expressionseinheit nach Anspruch 2, wobei P1, Px und Py jeweils abgeleitet sind von einer zusammenhängenden Sequenz von 35 bis 500 Nukleotidresten, die im Genom des Organismus 5'-stromaufwärts von der kodierenden Sequenz für ein 5 Protein liegt.
4. Expressionseinheit nach Anspruch 2 oder 3, wobei der Organismus ein coryne- formes Bakterium ist.
0 5. Expressionseinheit nach einem der vorhergehenden Ansprüche, wobei P1, Px und Py unabhängig voneinander ausgewählt sind unter Promotorsequenzen für die kodierende Sequenz eines Proteins mit hoher Abundanz in einem Organismus.
5 6. Expressionseinheit nach einem der vorhergehenden Ansprüche, wobei P1, Px und Py unabhängig voneinander ausgewählt sind unter SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4.
7. Expressionseinheit nach einem der vorhergehenden Ansprüche, wobei die Promotoren ausgewählt sind unter starken, konstitutiven oder regulierbaren Promotoren.
8. Expressionskassette, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel II:
5'.Pi.(.Ax-Px-)n-Ay-Py-G-3' (II)
worin n, Ax1Ay1P1, Px und Py wie oben definiert sind und
G für wenigstens eine kodierende Nukleinsäuresequenz steht, welche mit der 5'- stromaufwärts gelegenen regulatorischen Sequenz funktionell verknüpft ist.
9. Expressionskassette nach Anspruch 8, wobei G ausgewählt ist unter a. Nukleinsäuren kodierend ein Protein aus den Biosyntheseweg von proteinogenen und nicht-proteinogenen Aminosäuren, b. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Nukleotiden und Nukleosiden, c. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von organischen Säuren, d. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Lipi- den und Fettsäuren, e. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Dio- len, f. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Kohlenhydraten, g. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von a- romatische Verbindungen, h. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Vitaminen, i. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Co- faktoren und j. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von En- zymen. k. Nukleinsäuren kodierend ein Protein aus dem Zentralstoffwechsel.
10. Expressionskassette nach Anspruch 9a), wobei die Nukleinsäuren für Proteine aus dem Biosyntheseweg von Aminosäuren, ausgewählt unter Aspartatkinase, Aspartat-Semialdehyd-Dehydrogenase, Diaminopimelat-Dehydrogenase, Diami- nopimelat-Decarboxylase, Dihydrodipicolinate-Synthetase, Dihydrodipicolinate- Reduktase, Glycerinaldehyd-3-Phosphat-Dehydrogenase, 3-Phosphoglycerat- Kinase, Pyruvat-Carboxylase, Triosephosphat-Isomerase, Transkriptioneller Regulator LuxR, Transkriptioneller Regulator LysR1 , Transkriptioneller Regulator LysR2, Malat-Quinon-Oxidoreduktase, Glucose-6-Phosphat-Deydrogenase, 6-
Phosphogluconat-Dehydrognease, Transketolase, Transaldolase, Homoserin-O- Acetyltransferase, Cystahionin-gamma-Synthase, Cystahionin-beta-Lyase, Se- rin-Hydroxymethyltransferase, O-Acetylhomoserin-Sulfhydrylase, Methylen- Tetrahydrofolat-Reduktase, Phosphoserin-Aminotransferase, Phosphoserin- Phosphatase, Serin-Acetyl-Transferase, Homoserin-Dehydrogenase, Homose- rin-Kinase, Threonin-Synthase, Threonin-Exporter-Carrier, Threonin- Dehydratase, Pyruvat-Oxidase, Lysin-Exporter, Biotin-Ligase, Cystein-Synthasel, Cystein-Synthase II, Coenzym B12-abhängige Methionin-Synthase, Coenzym B12-unabhängige Methionin-Synthase-Aktivität, Sulfatadenyltransferase Unter- einheit 1 und 2, Phosphoadenosin Phosphosulfat Reduktase, Ferredoxin-sulfit- reductase, Ferredoxin NADP Reduktase, 3-Phosphoglycerat Dehydrogenase, RXA00655 Regulator, RXN2910-Regulator, Arginyl-t-RNA-Synthetase, Phosphoenolpyruvat-Carboxylase, Threonin Efflux-Protein, Serinhydroxy- methyltransferase, Fruktose-1 ,6-bisphosphatase, Protein der Sulfat-Reduktion RXA077, Protein der Sulfat-Reduktion RXA248, Protein der Sulfat-Reduktion
RXA247, Protein OpcA, 1 -Phosphofruktokinase, 6-Phosphofruktokinase, Tetra- hydropicolinat-Succinylase, Succinyl-aminoketopimelat-Aminotransferase, Suc- cinyl-Diaminopimelat-Desuccinylase, Diaminopimelat-Epimerase, 6-
Phosphogluconat-Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglyce- rat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase, und Malat-Enzym, kodieren.
11. Vektor, umfassend wenigstens eine Expressionskassette nach einem der Ansprüche 8 bis 10.
12. Genetisch veränderter Mikroorganismus, transformiert mit wenigstens einem Vektor nach Anspruch 11 , oder enthaltend wenigstens eine Expressionskassette nach einem der Ansprüche 8 bis 10.
13. Genetisch veränderter Mikroorganismus nach Anspruch 12, abgeleitet von cory- neformen Bakterien.
14. Genetisch veränderter Mikroorganismus nach Anspruch 13, abgeleitet von Bakterien der Gattung Corynebacterum oder Brevibacterium.
15. Genetisch veränderter Mikroorganismus nach einem der Ansprüche 12 bis 14, enthaltend wenigstens eine Expressionskassette in integrierter Form.
16. Verfahren zur Herstellung eines biosynthetischen Produkts, wobei man einen genetisch veränderten Mikroorganismus nach einem der Ansprüche 12 bis 15 kultiviert und das gewünschte Produkt aus der Kultur isoliert.
17. Verfahren nach Anspruch 16, wobei das biosynthetische Produkt ausgewählt ist unter organischen Säuren, Proteinen, Nukleotiden und Nukleosiden, sowohl pro- teinogenen als auch nicht-proteinogenen Aminosäuren, Lipiden und Fettsäuren,
Diolen, Kohlenhydraten, aromatischen Verbindungen, Vitaminen und Cofaktoren, Enzymen und Proteinen.
18. Verwendung einer Expressionseinheit nach einem der Ansprüche 1 bis 7 zur Regulation einer Produkt-Biosynthese.
EP05850322A 2004-12-22 2005-12-21 Mehrfachpromotoren und deren verwendung zur genexpression Withdrawn EP1831374A1 (de)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PL07123772T PL1908841T3 (pl) 2004-12-22 2005-12-21 Promotory wielokrotne i ich zastosowanie do ekspresji genów
DK07123772.1T DK1908841T3 (da) 2004-12-22 2005-12-21 Flerdobbelte promotorer og deres anvendelse til genekspression
EP07123772A EP1908841B1 (de) 2004-12-22 2005-12-21 Mehrfachpromotoren und deren Verwendung zur Genexpression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102004061846A DE102004061846A1 (de) 2004-12-22 2004-12-22 Mehrfachpromotoren
PCT/EP2005/013809 WO2006069711A1 (de) 2004-12-22 2005-12-21 Mehrfachpromotoren und deren verwendung zur genexpression

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP07123772A Division EP1908841B1 (de) 2004-12-22 2005-12-21 Mehrfachpromotoren und deren Verwendung zur Genexpression

Publications (1)

Publication Number Publication Date
EP1831374A1 true EP1831374A1 (de) 2007-09-12

Family

ID=36052084

Family Applications (2)

Application Number Title Priority Date Filing Date
EP05850322A Withdrawn EP1831374A1 (de) 2004-12-22 2005-12-21 Mehrfachpromotoren und deren verwendung zur genexpression
EP07123772A Revoked EP1908841B1 (de) 2004-12-22 2005-12-21 Mehrfachpromotoren und deren Verwendung zur Genexpression

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP07123772A Revoked EP1908841B1 (de) 2004-12-22 2005-12-21 Mehrfachpromotoren und deren Verwendung zur Genexpression

Country Status (17)

Country Link
US (1) US7968699B2 (de)
EP (2) EP1831374A1 (de)
JP (2) JP2008523834A (de)
KR (1) KR101155461B1 (de)
CN (2) CN101087883A (de)
AT (1) ATE542906T1 (de)
AU (1) AU2005321577A1 (de)
BR (2) BRPI0519165A2 (de)
CA (1) CA2591311A1 (de)
DE (1) DE102004061846A1 (de)
DK (1) DK1908841T3 (de)
ES (1) ES2380000T3 (de)
MX (1) MX2007007392A (de)
PL (1) PL1908841T3 (de)
RU (1) RU2007127792A (de)
WO (1) WO2006069711A1 (de)
ZA (1) ZA200704451B (de)

Families Citing this family (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2008204442B2 (en) * 2007-01-12 2013-03-14 Intrexon Actobiotics Nv Lactococcus promoters and uses thereof
CN101646687A (zh) * 2007-02-19 2010-02-10 赢创德固赛有限责任公司 通过过表达戊糖磷酸途径的酶在棒状细菌中生产甲硫氨酸的方法
WO2008101857A2 (en) 2007-02-19 2008-08-28 Evonik Degussa Gmbh Coryneform bacteria with formate-thf-synthetase and/or glycine cleavage activity
GB0715416D0 (en) * 2007-08-07 2007-09-19 Phico Therapeutics Ltd Modified bacteriophage
PL2235194T3 (pl) 2008-01-23 2011-12-30 Basf Se Sposób fermentacyjnego wytwarzania 1,5- diaminopentanu
US8647642B2 (en) 2008-09-18 2014-02-11 Aviex Technologies, Llc Live bacterial vaccines resistant to carbon dioxide (CO2), acidic PH and/or osmolarity for viral infection prophylaxis or treatment
DE102009030342A1 (de) 2009-06-25 2010-12-30 Evonik Degussa Gmbh Verfahren zur fermentativen Herstellung von organisch chemischen Verbindungen
CN102753682A (zh) 2009-12-17 2012-10-24 巴斯夫欧洲公司 用于生产尸胺的方法和重组微生物
DE102010003419B4 (de) 2010-03-30 2019-09-12 Evonik Degussa Gmbh Verfahren zur fermentativen Herstellung von L-Ornithin
US9745608B2 (en) 2011-02-22 2017-08-29 Basf Se Processes and recombinant microorganisms for the production of cadaverine
DE102011006716A1 (de) 2011-04-04 2012-10-04 Evonik Degussa Gmbh Mikroorganismus und Verfahren zur fermentativen Herstellung einer organisch-chemischen Verbindung
DE102011118019A1 (de) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Varianten des Promotors des für die Glyzerinaldehyd-3-phosphat-Dehydrogenase kodierenden gap-Gens
US9347048B2 (en) 2012-04-27 2016-05-24 Evonik Technochemie Gmbh Feedback-resistant alpha-isopropylmalate synthases
US20150353940A1 (en) * 2013-08-05 2015-12-10 Absci, Llc Vectors for use in an inducible coexpression system
EP2762571A1 (de) 2013-01-30 2014-08-06 Evonik Industries AG Mikroorganismus und Verfahren zur fermentativen Herstellung von Aminosäuren
ES2623161T3 (es) 2013-06-03 2017-07-10 Evonik Degussa Gmbh Procedimiento para la preparación de L-valina utilizando corinebacterias recombinantes que contienen el operón ilvBN inducible por propionato
JP2016523088A (ja) * 2013-06-26 2016-08-08 フィロジカ リミテッドPhylogica Limited ペプチドの細胞輸送をモニタリングする方法
CN104845923B (zh) * 2014-02-14 2018-03-23 中国科学院微生物研究所 生产l‑组氨酸的方法及其专用重组菌
CN105779445B (zh) * 2014-12-22 2018-09-28 中国科学院大连化学物理研究所 果糖-1,6-二磷酸醛缩酶启动子和终止子及其应用
CN105779447B (zh) * 2014-12-22 2018-09-14 中国科学院大连化学物理研究所 3-磷酸甘油醛脱氢酶启动子和终止子及其应用
CN105779446B (zh) * 2014-12-22 2018-09-14 中国科学院大连化学物理研究所 3-磷酸甘油酸激酶启动子和终止子及其应用
US10676723B2 (en) 2015-05-11 2020-06-09 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
BR112018011503A2 (pt) 2015-12-07 2018-12-04 Zymergen Inc promotores da corynebacterium glutamicum
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US10544390B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a bacterial hemoglobin library and uses thereof
EP3478845A4 (de) 2016-06-30 2019-07-31 Zymergen, Inc. Verfahren zur erzeugung einer glucose-permease-bibliothek und verwendungen davon
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11136586B2 (en) * 2016-12-30 2021-10-05 Ntxbio, Llc Cell-free expression system having novel inorganic polyphosphate-based energy regeneration
KR20200026881A (ko) 2017-06-07 2020-03-11 지머젠 인코포레이티드 코리네박테리움 글루타미컴으로부터의 프로모터 및 보조 유전자 발현을 조절하는 데 이의 용도
CN109142578B (zh) * 2018-09-12 2021-08-10 中国人民解放军军事科学院军事医学研究院 检测生物细胞中两种基因对目标代谢物调控关系的方法
JP7498598B2 (ja) * 2020-05-29 2024-06-12 花王株式会社 新規プロモーター
CN115322990B (zh) * 2021-05-10 2024-09-20 中国科学院天津工业生物技术研究所 具有启动子活性的多核苷酸及其在生产目标化合物中的用途
KR102604399B1 (ko) 2021-07-21 2023-11-21 성균관대학교산학협력단 코리네박테리움 글루타미쿰의 모듈화 클로닝용 벡터 및 이의 용도
KR102632294B1 (ko) 2021-08-27 2024-02-01 성균관대학교산학협력단 코리네박테리움 글루타미쿰의 모듈화 클로닝을 위한 프로모터 라이브러리 및 터미네이터 라이브러리, 및 이의 용도
CN114717237B (zh) * 2022-06-10 2022-08-19 北京中科伊品生物科技有限公司 一种ep6启动子与其相关生物材料及应用

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5835197A (ja) 1981-08-26 1983-03-01 Kyowa Hakko Kogyo Co Ltd プラスミドpcg2
US4601893A (en) 1984-02-08 1986-07-22 Pfizer Inc. Laminate device for controlled and prolonged release of substances to an ambient environment and method of use
GB2165546B (en) 1984-08-21 1989-05-17 Asahi Chemical Ind A plasmid containing a gene for tetracycline resistance and dna fragments derived therefrom
DE4027453A1 (de) 1990-08-30 1992-03-05 Degussa Neue plasmide aus corynebacterium glutamicum und davon abgeleitete plasmidvektoren
DE4440118C1 (de) 1994-11-11 1995-11-09 Forschungszentrum Juelich Gmbh Die Genexpression in coryneformen Bakterien regulierende DNA
JPH10229891A (ja) 1997-02-20 1998-09-02 Mitsubishi Rayon Co Ltd マロン酸誘導体の製造法
JP4623825B2 (ja) * 1999-12-16 2011-02-02 協和発酵バイオ株式会社 新規ポリヌクレオチド
DE10046870A1 (de) 2000-09-20 2002-03-28 Basf Ag Verfahren zur Veränderung des Genoms von Corynebakterien
US7141388B2 (en) * 2000-11-15 2006-11-28 Archer-Daniels-Midland Company Nucleotide sequences for transcriptional regulation in corynebacterium glutamicum
CN1140628C (zh) * 2001-11-02 2004-03-03 武汉大学 人白细胞白介素-12重组昆虫病毒株及其制备方法
DE10154180A1 (de) * 2001-11-05 2003-05-15 Basf Ag gene die für genetische Stabilitäts-, genexpressions-und Faltungsproteine codieren
DE10359594A1 (de) 2003-12-18 2005-07-28 Basf Ag PEF-TU-Expressionseinheiten
DE10359660A1 (de) * 2003-12-18 2005-07-28 Basf Ag Psod-Expressionseinheiten
DE10359595A1 (de) * 2003-12-18 2005-07-28 Basf Ag Pgro-Expressionseinheiten
DE102004035065A1 (de) 2004-07-20 2006-02-16 Basf Ag P-ET-TS-Expressionseinheiten

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006069711A1 *

Also Published As

Publication number Publication date
JP2008523834A (ja) 2008-07-10
WO2006069711A1 (de) 2006-07-06
ATE542906T1 (de) 2012-02-15
EP1908841B1 (de) 2012-01-25
MX2007007392A (es) 2007-07-16
US20080268502A1 (en) 2008-10-30
DK1908841T3 (da) 2012-05-14
AU2005321577A1 (en) 2006-07-06
KR101155461B1 (ko) 2012-09-07
ES2380000T3 (es) 2012-05-07
BRPI0520842A2 (pt) 2012-07-03
CN101230345B (zh) 2013-03-20
JP2008212157A (ja) 2008-09-18
CN101087883A (zh) 2007-12-12
RU2007127792A (ru) 2009-01-27
ZA200704451B (en) 2009-05-27
DE102004061846A1 (de) 2006-07-13
KR20070092745A (ko) 2007-09-13
US7968699B2 (en) 2011-06-28
CN101230345A (zh) 2008-07-30
PL1908841T3 (pl) 2012-07-31
CA2591311A1 (en) 2006-07-06
JP4763017B2 (ja) 2011-08-31
EP1908841A1 (de) 2008-04-09
BRPI0519165A2 (pt) 2008-12-30

Similar Documents

Publication Publication Date Title
EP1908841B1 (de) Mehrfachpromotoren und deren Verwendung zur Genexpression
EP1908842B1 (de) PEF-TU Expressionseinheiten
EP1697526B1 (de) Psod-expressionseinheiten
EP1942198B1 (de) Pef-ts expressionseinheiten bei corynebacterium glutamicum
EP1921150B1 (de) Pgro-Expressionseinheiten
DE102004035070A1 (de) P-180-Expressionseinheiten
DE102004035069A1 (de) P19-Expressionseinheiten
DE102004035076A1 (de) P2-10-Expressionseinheiten
DE102004035074A1 (de) P1-34-Expressionseinheiten
DE102004035067A1 (de) P1-35-Expressionseinheiten

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070723

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK YU

17Q First examination report despatched

Effective date: 20071109

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BASF SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080520