EP1585813A1 - Verfahren zur herstellung von ketocarotinoiden durch kultivierung von genetisch veränderten organismen - Google Patents
Verfahren zur herstellung von ketocarotinoiden durch kultivierung von genetisch veränderten organismenInfo
- Publication number
- EP1585813A1 EP1585813A1 EP03789415A EP03789415A EP1585813A1 EP 1585813 A1 EP1585813 A1 EP 1585813A1 EP 03789415 A EP03789415 A EP 03789415A EP 03789415 A EP03789415 A EP 03789415A EP 1585813 A1 EP1585813 A1 EP 1585813A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- sequence
- ketolase
- amino acid
- sequence seq
- genetically modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/179—Colouring agents, e.g. pigmenting or dyeing agents
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L31/00—Edible extracts or preparations of fungi; Preparation or treatment thereof
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L31/00—Edible extracts or preparations of fungi; Preparation or treatment thereof
- A23L31/10—Yeasts or derivatives thereof
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/105—Plant extracts, their artificial duplicates or their derivatives
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
- A23L5/40—Colouring or decolouring of foods
- A23L5/42—Addition of dyes or pigments, e.g. in combination with optical brighteners
- A23L5/43—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives
- A23L5/44—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives using carotenoids or xanthophylls
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/04—Plant cells or tissues
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/30—Fuel from waste, e.g. synthetic alcohol or diesel
Definitions
- the present invention relates to a process for the preparation of ketocarotenoids by cultivating genetically modified organisms which have a modified ketolase activity compared to the wild type, the genetically modified organisms, and their use as food and feed and for the production of ketocarotenoid extracts.
- Ketocarotenoids occur mainly in bacteria, few fungi and as secondary carotenoids in green algae.
- 4-monoketo derivative of ß-carotene the 4-monoketo derivative of ß-carotene
- the corresponding symmetrical diketo compound canthaxanthin is also formed.
- astaxanthin 3,3'-hydroxy-4,4'-keto-ß-carotene
- ketocarotenoids and especially astaxanthin are used as pigmenting aids in animal nutrition, especially in trout, salmon and shrimp farming.
- Natural ketocarotenoids such as natural astaxanthin
- ketolase genes of the crfl / l / type were obtained from the bacteria Agrobacterium aurantia-cum (EP 735 137, Accession NO: D58420), Paracoccus marcusii (Accession NO: Y15112) and as a cDNA from Haematococcus (Haematococcus pluvialis Flotow em. Wille and Haematoccus pluvialis, NIES-144 (EP 725137, WO 98/18910 and Lotan et al, FEBS Letters 1995, 364, 125-128, Accession NO: X86782 and D45881)) cloned and functionally identified.
- ketolase genes on the basis of amino acid homologies, such as, for example, nucleic acids encoding a ketolase from Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422), Synechocystis sp. Strain PC6803 (Accession NO: NP_442491), Bradyrhizobium sp. (Accession NO: AF218415), Nostoc sp. PCC 7120 (Kaneko et al, DNA Res. 2001, 8 (5), 205-213; Accession NO: AP003592, BAB74888) and Brevundimonas aurantiaca (WO 02079395).
- ketolases can insert a keto group in position 4 with ß-carotene.
- the crtO gene codes for a monoketolase which forms echinenon as the end product from ß-carotene.
- the crtW gene family which also includes bkt from Haematococcus, codes for a diketolase that converts ß-carotene to canthaxanthin. This reaction appears to be the first modification step towards astaxanthin, which is followed by hydroxylation at position 3. The same reaction sequence then also applies to the second ionon ring (9). There is also enzymatic evidence that 3-hydroxy-ß-carotene derivatives are difficult to ketolate at position 4.
- EP 735 137 describes the production of xanthophylls in microorganisms, such as, for example, E. coli by introducing ketolase genes (crtW) from Agrobacterium aurantiacum or Alcaligenes sp. PC-1 in microorganisms. From EP 725 137, WO 98/18910, Kajiwara et al. (Plant Mol. Biol. 1995, 29, 343-352) and Hirschberg et al. (FEBS Letters 1995, 364, 125-128) it is known to introduce astaxanthin by introducing ketolase genes from Haematococcus pluvialis (crtW, crtO or bkt ) in £ coli.
- ketolase genes crtW
- WO 98/18910 and Hirschberg et al. describe the synthesis of ketocarotenoids in nectaries of tobacco flowers by introducing the ketolase gene from Haematococcus pluvialis (crtO) into tobacco.
- WO 01/20011 describes a DNA construct for the production of ketocarotenoids, in particular astaxanthin, in seeds of oilseed plants such as oilseed rape, sunflower, soybean and mustard using a seed-specific promoter and a ketolase from Haematococcus pluvialis.
- the invention was therefore based on the object of providing a process for the preparation of ketocarotenoids by cultivating genetically modified organisms, or of making available further genetically modified organisms which produce ketocarotenoids which have the disadvantages of the prior art described above of technology to a lesser extent or no longer.
- ketocarotenoids has been found by cultivating genetically modified organisms which have an altered ketolase activity compared to the wild type and the altered ketolase activity is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the organisms according to the invention are preferably naturally able, as starting organisms, to produce carotenoids such as, for example, ⁇ -carotene or zeaxanthin, or can be changed by genetic modification, such as For example, re-regulation of metabolic pathways or complementation are enabled to produce carotenoids such as, for example, ⁇ -carotene or zeaxanthin.
- ketocarotenoids such as astaxanthin or canthaxanthin.
- These organisms such as, for example, Haematococcus pluvialis, Paracoccus marcusii, Xanthophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonis sp., Neochloris wimmeri.Protosiphon botryoides, Scotiellopsis oocystiformis, Scenedesmuselaispusilliensis, Scenedesmuselaisofusoliensis, Scenedesmuselaistrusoliensis, stenosis muscle zoofuolusis Blakeslea already show ketolase activity as a starting or wild-type organism.
- organisms are therefore used as the starting organisms which already have ketase activity as a wild type or starting organism.
- the genetic modification causes an increase in ketolase activity compared to the wild type or parent organism.
- Ketolase activity means the enzyme activity of a ketolase.
- a ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted ⁇ -ionone ring of carotenoids.
- a ketolase is understood to be a protein which has the enzymatic activity to convert ⁇ -carotene into canthaxanthin.
- ketolase activity means the amount of ⁇ -carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.
- the ketolase activity is higher than that of the wild type, the amount of ⁇ -carotene converted or the amount of canthaxanthin formed is increased by the protein ketolase in comparison to the wild type.
- This increase in ketolase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ketolase activity of the wild type.
- wild type is understood to mean the corresponding starting organism.
- organism can be understood to mean the starting organism (wild type) or a genetically modified organism according to the invention or both.
- wild type is used for increasing or causing ketolase activity, for the increase in hydroxyiase activity described below, for the increase described below ⁇ -cyclase activity and the increase in the content of ketocarotenoids each understood a reference organism.
- This reference organism is preferably Haematococcus pluvialis for microorganisms which already have ketolase activity as a wild type.
- This reference organism is preferably Blakeslea for microorganisms which, as a wild type, have no ketolase activity.
- This reference organism is, for plants which already have a ketolase activity as a wild type, preferably Adonis aestivalis, Adonis flammeus or Adonis annuus, particularly preferably Adonis aestivalis.
- This reference organism is particularly preferred for plants which have no ketolase activity in petals as a wild type, preferably Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta or Tagetes campanulata, particularly preferably Tagetes erecta.
- ketolase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
- the ketolase activity in plant or microorganism material is determined using the method of Frazer et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997).
- the ketolase activity in plant or microorganism extracts is determined with the substrates ⁇ -carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate).
- Substrate / product ratios from the ketolase assays are determined by means of HPLC.
- the ketolase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms on translation and protein level or by increasing the gene expression of a nucleic acid encoding a ketolase compared to the wild type, for example by inducing the ketolase gene by activators or by introducing nucleic acids encoding a ketolase into the organism.
- Increasing the gene expression of a nucleic acid encoding a ketolase means, in this embodiment, the manipulation of the expression of the organisms' own endogenous ketolases. This can be achieved, for example, by changing the promoter DNA sequence for genes encoding ketolase. Such a change, which results in a changed or preferably increased expression rate of at least one endogenous ketolase gene, can be carried out by deleting or inserting DNA sequences.
- an increased expression of at least one endogenous ketolase gene can be achieved in that a regulator protein which is not found or modified in the wild-type organism interacts with the promoter of these genes.
- Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described for example in WO 96/06166.
- the ketolase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the gene expression of a nucleic acid encoding a ketolase is increased by introducing nucleic acids encoding ketolases into the organisms, the ketolases having the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the transgenic organisms according to the invention therefore have at least one further ketolase gene, coding for a ketolase, as compared to the wild type. holding the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- organisms are used as starting organisms which, as a wild type, have no ketolase activity.
- the genetic modification causes ketolase activity in the organisms.
- the genetically modified organism according to the invention thus has ketolase activity in comparison with the genetically unmodified wild type and is therefore preferably able to transgenically express a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the gene expression of a nucleic acid encoding a ketolase is caused analogously to the increase in gene expression of a nucleic acid described above.
- Encoding a ketolase preferably by introducing nucleic acids encoding ketolases, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has, in the starting organism.
- any nucleic acids encoding a ketolase containing the amino acid sequence SEQ can be used in both embodiments. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has to be used.
- nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.
- nucleic acids encoding a ketolase and the corresponding ketolases containing the amino acid sequence SEQ. ID. NO.2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2, which can be used advantageously in the inventive method, are, for example, sequences from
- Nostoc punctiforme PCC73102 ORF 38 nucleic acid: Acc.-No. NZ_AABC01000195, base pair 55.604 to 55.392 (SEQ ID NO: 1); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 2) (annotated as putative protein) or
- Nostoc punctiforme PCC73102 ORF 148 nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 3), protein: (SEQ ID NO: 4) (not annotated)
- Figure 1 also shows the nucleic acid sequences of ORF 38 and ORF 148 from Nostoc punctiforme.
- ketolase Nostoc punctiforme PCC73102 ORF 148 nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 3), protein: (SEQ ID NO: 4) or sequences derived from this sequence are particularly preferred.
- ketolases and ketolase genes that can be used in the method according to the invention can be obtained, for example, from different organisms whose genomic sequence is known by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences SEQ ID NO described above : 2 or SEQ ID NO: 4.
- ketolases and ketolase genes can furthermore be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID NO: 1 or SEQ ID NO: 3 from various organisms, the genomic sequence of which is not known, by hybridization techniques easy to find in a manner known per se.
- the hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.
- the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50_C) and those with high stringency (with 0.2X SSC at 50_C, preferably at 65_C) (20X SSC: 0, 3 M sodium citrate, 3 M sodium chloride, pH 7.0).
- the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.
- Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied.
- Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.
- 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or (iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or
- nucleic acids encoding a ketolase are introduced, containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which preferably has an identity of at least 50% at least 60%, preferably at least 65%, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, particularly preferably at least 98% at the amino acid level with the Sequence SEQ ID NO: 2 has.
- This can be a natural ketolase sequence that can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence that can be started from the sequence SEQ ID NO: 2 by artificial variation, for example by Substitution, insertion or deletion of amino acids has been modified.
- substitution is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by He, Ser by Thr.
- Deletion is the replacement of an amino acid with a direct link.
- Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.
- Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.
- Identity between two proteins means the identity of the amino acids over the respective total protein length, in particular the identity that is obtained by comparison using the Vector NTI Suite 7.1 software from Informax (USA) using the clustal method (Higgins DG, Sharp PM Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) is calculated using the following parameters:
- Gap opening penalty 10 Gap extension penalty 10
- a ketolase which has an identity of at least 42% at the amino acid level with the sequence SEQ ID NO: 2 is accordingly understood to be a ketolase which, when comparing its sequence with the sequence SEQ ID NO: 2, in particular according to the above program logarithm with the above Parameter set has an identity of at least 42%.
- the sequence of the ketolase from Nostoc punctiforme PCC73102 ORF 148 (SEQ ID NO: 4) with the sequence of the ketolase from Nostoc punctiforme PCC73102 ORF 38 (SEQ ID NO: 2) has an identity of 64 % on.
- Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
- codons are preferably used for this which are frequently used in accordance with the organism-specific "codon usage".
- the "codon usage” can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.
- a nucleic acid containing the sequence SEQ ID NO: 1 or SEQ ID NO: 3 is introduced into the organism.
- ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, such as, for example, by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
- the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897).
- the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
- the sequence of the kostolase from Nostoc punctiform PCC73102 ORF 38 points to the sequences of the ketolases used in the methods of the prior art an identity of 38% (Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), 38% (Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422) and 19 to 21% (Haematococcus pluvialis Flotow em.
- organisms are cultivated which, in addition to the increased ketolase activity, have an increased hydroxylase activity and / or ⁇ -cyclase activity compared to the wild type.
- Hydroxylase activity means the enzyme activity of a hydroxylase.
- a hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted ⁇ -ionone ring of carotenoids.
- a hydroxylase is understood to mean a protein which has the enzymatic activity to convert ⁇ -carotene into zeaxanthin or canthaxanthin into astaxanthin.
- hydroxylase activity is understood to mean the amount of ⁇ -carotene or canthaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.
- the amount of ⁇ -carotene or canthaxantine or the amount of zeaxanthin or astaxanthin formed is increased in a certain time by the protein hydroxylase compared to the wild type.
- This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the wild type.
- ⁇ -cyclase activity means the enzyme activity of a ⁇ -cyclase.
- a ß-cyclase is understood to mean a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a ß-ionone ring.
- a ⁇ -cyclase is understood to be a protein which has the enzymatic activity to convert ⁇ -carotene into ⁇ -carotene.
- ß-cyclase activity is understood to mean the amount of ⁇ -carotene converted or the amount of ß-carotene formed in a certain time by the protein ß-cyclase.
- the amount of lycopene or ⁇ -carotene converted or the amount of ⁇ -carotene formed from lycopene or the formed amount of ß-carotene from ⁇ -carotene increased.
- This increase in the ⁇ -cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ⁇ - Wild-type cyclase activity.
- hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
- the activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and ß-carotene with mono- and digalactosylglycerides are added to a certain amount of organism extract.
- the hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L; Biochim. Biophys. Acta 1391 ( 1998), 320-328):
- the in vitro assay is carried out in a volume of 0.250 ml.
- the mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP + oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta-carotene (emulsified in 0.1 mg Tween 80 emulsified), 0.05 mM one Mixture of mono- and digalactosylglycerides (1: 1), 1 unit of catalysis, 200 mono- and digalactosylglycerides (1: 1), 0.2 mg bovine serum albumin and organism extract in different volumes.
- the reaction mixture is incubated at 30 ° C for 2 hours.
- reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by means of HPLC.
- organic solvent such as acetone or chloroform / methanol (2: 1)
- determination of the ⁇ -cyclase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:
- the activity of the ⁇ -cyclase is according to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) /? determined in vitro. Potassium phosphate as a buffer (pH 7.6), lycopene as a substrate, paprika stromal protein, NADP +, NADPH and ATP are added to a certain amount of organism extract.
- the ⁇ -cyclase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):
- the in vitro assay is carried out in a volume of 250 ⁇ l volume.
- the mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 ⁇ g of chromoplastidic stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP.
- NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.
- the hydroxylase activity and / or ⁇ -cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids coding for a hydroxylase and / or for coding nucleic acids a ⁇ -cyclase, compared to the wild type.
- the increase in the gene expression of the nucleic acids encoding a hydroxylase and / or the increase in the gene expression of the nucleic acid encoding a ⁇ -cyclase, compared to the wild type, can also be carried out in various ways, for example by inducing the hydroxylase gene and / or ⁇ -cyclase Gene by activators or by introducing one or more hydroxylase gene copies and / or ⁇ -cyclase gene copies, ie by introducing at least one nucleic acid encoding a hydroxylase and / or at least one nucleic acid encoding a ⁇ -cyclase into the organism ,
- Increasing the gene expression of a nucleic acid encoding a hydroxylase and / or ⁇ -cyclase means, according to the invention, the manipulation of the expression of the organism's own endogenous hydroxylase and / or ⁇ -cyclase.
- an altered or increased expression of an endogenous hydroxylase and / or ⁇ -cyclase gene can be achieved in that a regulator protein which does not occur in the non-transformed organism interacts with the promoter of this gene.
- Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described for example in WO 96/06166.
- the gene expression of a nucleic acid encoding a hydroxylase is increased and / or the gene expression of a nucleic acid encoding a ⁇ -cyclase is increased by introducing at least one nucleic acid encoding a hydroxylase and / or by Introduction of at least one nucleic acid encoding a ⁇ -cyclase into the organism.
- any hydroxylase gene or each ⁇ -cyclase gene that is to say any nucleic acid which codes for a hydroxylase and any nucleic acid which codes for a ⁇ -cyclase, can be used for this purpose.
- genomic hydroxylase or. ⁇ -cyclase nucleic acid sequences from eukaryotic sources that contain introns are preferred in the event that the host organism is unable or cannot be enabled to express the corresponding hydroxylase or ⁇ -cyclase processed nucleic acid sequences, such as the corresponding cDNAs, to use.
- An example of a hydroxylase gene is a nucleic acid encoding a hydroxylase from Haematococcus pluvialis, accession AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 5, protein: SEQ ID NO: 6).
- ⁇ -cyclase gene is a nucleic acid encoding a ⁇ -cyclase from tomato (Accession X86452) (nucleic acid: SEQ ID NO: 7, protein: SEQ ID NO: 8).
- the preferred transgenic organisms according to the invention therefore have at least one further hydroxylase gene and / or ⁇ -cyclase gene compared to the wild type.
- the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase, or at least two endogenous nucleic acids encoding a hydroxylase and / or at least one exogenous nucleic acid encoding a ⁇ -cyclase, or at least two endogenous nucleic acids encoding one ⁇ -cyclase.
- nucleic acids encoding proteins are preferably used which contain the amino acid sequence SEQ ID NO: 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 6, and which have the enzymatic property of a hydroxylase.
- hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO: 6 easy to find.
- hydroxylases and hydroxylase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 5 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se.
- nucleic acids which encode proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 6 are introduced into organisms to increase the hydroxylase activity.
- Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
- codons which are frequently used in accordance with the organism-specific "codon usage” are preferably used for this. This "codon usage” can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.
- a nucleic acid containing the sequence SEQ is brought. ID. NO: 5, in the organism.
- nucleic acids encoding proteins are preferably used as the ⁇ -cyclase genes, containing the amino acid sequence SEQ ID NO: 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 8, and which have the enzymatic property of a ⁇ -cyclase.
- ⁇ -cyclases and ⁇ -cyclase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID NO: 8.
- ⁇ -cyclases and ⁇ -cyclase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 7 from various organisms, the genomic sequence of which is not known, by hybridization and PCR techniques in a manner known per se ,
- nucleic acids which encode proteins containing the amino acid sequence of the ⁇ -cyclase of the sequence SEQ are introduced into organisms to increase the ⁇ -cyclase activity. ID. NO: 8.
- Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code. Those codons which are frequently used in accordance with the organism-specific "codon usage” are preferably used for this. This "codon usage" can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.
- a nucleic acid containing the sequence SEQ is brought. ID. NO: 7 in the organism.
- All of the above-mentioned hydroxylase genes or ⁇ -cyclase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
- the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897).
- the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
- these genetically modified organisms can be produced, for example, by introducing individual nucleic acid constructs (expression cassettes) or by introducing multiple constructs which contain up to two or three of the activities described.
- organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular beta-amino acids.
- carotenoids in particular beta-amino acids.
- Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore capable of producing zeaxanthin as wild-type or starting organisms.
- Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.
- Both bacteria can be used as bacteria that are able to synthesize xanthophylls due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria. which are able to synthesize xanthophylls such as bacteria of the genus Erwinia, Agrobacterium, Flavobactenum, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.
- genes of the carotenoid biosynthesis of a carotenoid-producing organism such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria.
- which are able to synthesize xanthophylls such as bacteria of the genus Erwinia, Agrobacterium, Flavobactenum,
- Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobactenum sp. strain R1534, the Cyanobacterium synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.
- yeasts are Candida, Saccharomyces, Hansenula, Pichia or Phaffia. Particularly preferred yeasts are Xanthophyllomyces dendrorhous or Phaffia rhodozyma.
- Preferred mushrooms are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.
- Preferred algae are green algae, such as algae of the genus Haematococcus,
- Phaedactylum tricomatum Volvox or Dunaliella.
- Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil.
- Particularly preferred plants are plants selected from the Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Bras- families. sicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Astera- ceae, Liliaceae, Malicaceae, Malaceae
- Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes erhcta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus , Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentlana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracle , Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Laburnum, Lathyrus, Leontodon,
- the cultivation step of the genetically modified organisms is preferably followed by harvesting the organisms and, more preferably, additionally isolating ketocarotenoids from the organisms.
- the organisms are harvested in a manner known per se in accordance with the respective organism.
- Microorganisms such as bacteria, yeast, algae or fungi or plant cells, which are cultivated by fermentation in liquid nutrient media, can be separated off, for example, by centrifuging, decanting or filtering. Plants are grown on nutrient media in a manner known per se and harvested accordingly.
- the cultivation of the genetically modified microorganisms is preferably carried out in the presence of oxygen at a cultivation temperature of at least about 20 ° C, such as 20 ° C to 40 ° C, and a pH of about 6 to 9.
- this is preferably done first Culturing the microorganisms in the presence of oxygen and in a complex medium such as TB or LB medium at a cultivation temperature of about 20 ° C or more and a pH of about 6 to 9 until a sufficient cell density is reached.
- a complex medium such as TB or LB medium
- the use of an inducible promoter is preferred.
- the cultivation is continued after induction of the ketolase expression in the presence of oxygen, for example from 12 hours to 3 days.
- ketocarotenoids are isolated from the harvested biomass in a manner known per se, for example by extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as, for example, chromatography.
- further chemical or physical purification processes such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as, for example, chromatography.
- ketocarotenoids in the genetically modified plants according to the invention can preferably be produced specifically in various plant tissues, such as, for example, seeds, leaves, fruits, flowers, in particular in petals.
- Ketocarotenoids are isolated from the harvested petals in a manner known per se, for example by drying and subsequent extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as chromatography. Ketocarotenoids are isolated from the petals, for example, preferably using organic solvents such as acetone, hexane, ether or tert-methylbutyl ether.
- ketocarotenoids in particular from petals, are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).
- ketocarotenoids are preferably selected from the group of astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.
- ketocarotenoid is astaxanthin.
- ketocarotenoids are obtained in free form or as fatty acid esters.
- the ketocarotenoids are obtained in the process according to the invention in the form of their mono- or diesters with fatty acids.
- Some proven fatty acids are e.g. Myristic acid, palmitic acid, stearic acid, oleic acid, linolenic acid, and lauric acid (Kamata and Simpson (1987) Comp. Biochem. Physiol. Vol. 86B (3), 587-591).
- ketocarotenoids can be produced in the whole plant or, in a preferred embodiment, specifically in plant tissues which contain chromoplasts.
- plant tissues are, for example, roots, seeds, leaves, fruits, flowers and in particular nectaries and petals, which are also called petals.
- genetically modified plants are used which have the highest expression rate of a ketolase in flowers.
- the gene expression of the ketolase takes place under the control of a flower-specific promoter.
- the nucleic acids described above, as described in detail below are introduced into the plant in a nucleic acid construct functionally linked to a plant-specific promoter.
- genetically modified plants are used which have the highest expression rate of a ketolase in fruits.
- the gene expression of the ketolase takes place under the control of a fruit-specific promoter.
- the nucleic acids described above, as described in detail below are introduced into the plant in a nucleic acid construct functionally linked with a fruit-specific promoter.
- genetically modified plants are used which have the highest expression rate of a ketolase in seeds.
- the gene expression of the ketolase takes place under the control of a seed-specific promoter.
- the nucleic acids described above, as described in detail below are introduced into the plant in a nucleic acid construct functionally linked with a seed-specific promoter.
- the targeting in the chromium peaks is carried out by a functionally linked plastid transit peptide.
- the production of genetically modified plants with increased or caused ketolase activity is described as an example.
- the increase in further activities such as, for example, the hydroxylase activity and / or the ⁇ -cyclase activity, can be carried out analogously using nucleic acid sequences, coding for a hydroxylase or ⁇ -cyclase instead of Nucleic acid sequences encoding a ketolase take place.
- the transformation can take place individually or through multiple constructs.
- the transgenic plants are preferably produced by transforming the starting plants, using a nucleic acid construct which contains the nucleic acids described above, encoding a ketolase, which are functionally linked to one or more regulation signals which ensure transcription and translation in plants.
- nucleic acid constructs in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in plants, are also called expression cassettes below.
- the regulation signals preferably contain one or more promoters which ensure transcription and translation in plants.
- the expression cassettes contain regulatory signals, that is to say regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell.
- an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and, if appropriate, further regulatory elements which are operatively linked to the coding sequence in between for at least one of the genes described above.
- An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended in the expression of the coding sequence.
- nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.
- sequences which are preferred, but not limited to, for operative linking are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the cell nucleus, in oil bodies or other compartments and Translation amplifiers like the 5'-
- any promoter which can control the expression of foreign genes in plants is suitable as the promoter of the expression cassette.
- Constant promoter means those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development.
- a plant promoter or a plant virus-derived promoter is preferably used.
- Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140 : 281-288; Gardner et al. (1986) Plant Mol Biol 6: 221-228), the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benney et al.
- TPT triose-phosphate translocator
- Another suitable constitutive promoter is the pds promoter (Pecker et al. (1992) Proc. Natl. Acad. Be USA 89: 4962-4966) or the "Rubisco small subunit (SSU)" promoter (US 4,962,028), the LeguminB Promoter (GenBank Acc. No. X03677), the promoter of nopalin synthase from Agrobacterium, the TR double promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol 29: 637-649), the Ubiquitin 1 promoter (Christensen et al.
- the expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), by which the expression of the ketolase gene in the plant at a specific point in time can be controlled.
- a chemically inducible promoter such as the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), a salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP 0388 186) , a promoter inducible by tetracycline (Gatz et al.
- a promoter inducible by abscisic acid (EP 0335 528) or a promoter inducible by ethanol or cyclohexanone (WO 93/21334 ) can also be used.
- promoters that are induced by biotic or abiotic stress such as the pathogen-inducible promoter of the PRP1 gene (Ward et al.
- Pathogen-inducible promoters include those of genes that are induced as a result of a pathogen attack, such as genes of PR proteins, SAR proteins, b-1, 3-glucanase,
- wound inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al. (1996) Nat Biotech 14: 494-498), the wuni and wun2 gene (US 5,428,148 ), the winl and win2 genes (Stanford et al. (1989) Mol Gen Genet 215: 200-208), the systemin gene (McGurl et al. (1992) Science 225: 1570-1573), the WIP1 Gens (Rohmeier et al. (1993) Plant Mol Biol 22: 783-792; Ekelkamp et al. (1993) FEBS Letters 323: 73-76), the MPI gene (Corderok et al. (1994) The Plant J 6 (2): 141-150) and the like.
- suitable promoters are, for example, fruit-ripening-specific promoters, such as the fruit-ripening-specific promoter from tomato (WO 94/21794, EP 409625).
- Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent.
- promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of ketocarotenoids or their precursors takes place.
- promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems, seeds and roots and combinations thereof are preferred.
- Tuber-, storage root- or root-specific promoters are, for example, the patatin class I (B33) promoter or the potato cathepsin D inhibitor promoter.
- Leaf-specific promoters are, for example, the promoter of the cytosolic FBPase from potato (WO 97/05900), the SSU promoter (small subunit), the Rubisco (ribulose-1, 5-bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al. ( 1989) EM-BO J 8: 2445-2451).
- Flower-specific promoters are, for example, the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593), the AP3 promoter from Arabidopsis thaliana (see Example 5), the CHRC promoter (chromoplast -specific carotenoid- associated protein (CHRC) gene promoter from Cucumis sativus Acc.-No. AF099501, base pair 1 to 1532), the EPSP_Synthase promoter (5-enolpyruvylshikimate-3-phosphate synthase gene promoter from Petunia hybrida, Acc.-No.
- the phytoene synthase promoter WO 92/16635
- the promoter of the P-rr gene WO 98/22593
- the AP3 promoter from Arabidopsis thaliana see Example 5
- CHRC promoter chromoplast -specific carotenoid- associated protein (CHRC)
- the PDS promoter (Phytoene desaturase gene promoter from Solanum lycopersicum, Acc.-No. U46919, base pair 1 to 2078), the DFR-A promoter (dihydroflavonol 4-reductase gene A promoter from Petunia hybrida, Acc.-No. X79723, base pair 32 to 1902) or the FBP1 promoter (Floral Binding Protein 1 gene promoter from Petunia hybrida, Acc.-No. L10115, base pair 52 to 1069).
- the DFR-A promoter dihydroflavonol 4-reductase gene A promoter from Petunia hybrida, Acc.-No. X79723, base pair 32 to 1902
- the FBP1 promoter Floral Binding Protein 1 gene promoter from Petunia hybrida, Acc.-No. L10115, base pair 52 to 1069.
- Anther-specific promoters are, for example, the 5126-
- Seed-specific promoters are, for example, the ACP05 promoter (acyl carrier protein gene, W09218634), the promoters AtS1 and AtS3 from Arabidopsis (WO 9920775), the LeB4 promoter from Vicia faba (WO 9729200 and US 06403371), the napin Promoter from Brassica napus (US 5608152; EP 255378; US 5420034), the SBP promoter from Vicia faba (DE 9903432) or the corn promoters End1 and End2 (WO 0011177).
- ACP05 promoter acyl carrier protein gene, W09218634
- the promoters AtS1 and AtS3 from Arabidopsis WO 9920775
- the LeB4 promoter from Vicia faba WO 9729200 and US 06403371
- the napin Promoter from Brassica napus US 5608152; EP 255378; US 5420034
- SBP promoter from Vicia faba
- the present invention therefore relates in particular to a nucleic acid construct containing functionally linked a flower-specific or in particular a petal-specific promoter and a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO.2.
- An expression cassette is preferably produced by fusing a suitable promoter with a nucleic acid described above, encoding a ketolase, and preferably a nucleic acid inserted between promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ.
- nucleic acids encoding a plastid transit peptide ensure localization in plastids and in particular in chromoplasts.
- Expression cassettes the nucleic acid sequence of which codes for a ketolase fusion protein, can also be used, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide.
- Preferred transit peptides are preferred for the chromoplasts, which are cleaved enzymatically from the ketolase part after translocation of the ketolase into the chromoplasts.
- the transit peptide which is derived from the plastid Nicotiana tabacum transketolase or another transit peptide for example the transit peptide of the small subunit of the Rubisco (rbcS) or the ferredoxin NADP oxidoreductase and also the isopentenyl pyrophosphate isomerase-2
- another transit peptide for example the transit peptide of the small subunit of the Rubisco (rbcS) or the ferredoxin NADP oxidoreductase and also the isopentenyl pyrophosphate isomerase-2
- Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:
- a plastid transit peptide examples include the transit peptide of the plastid isopentenyl pyrophosphate isomerase-2 (IPP-2) from Arabisopsis thaliana and the transit peptide of the small subunit of the ribulose bisphosphate carboxylase (rbcS) from pea (Guerineau, F, Woolston, S Brooks, L, Mullineaux, P (1988) An expression cassette fortargeting foreign proteins into the chloroplasts. Nucl. Acids Res. 16: 11380).
- IPP-2 plastid isopentenyl pyrophosphate isomerase-2
- rbcS ribulose bisphosphate carboxylase
- nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.
- various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame.
- adapters or linkers can be attached to the fragments.
- the promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence.
- the linker has 1 to 10, mostly 1 to 8, preferably 2 to 6 restriction sites.
- the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges.
- the promoter can be native or homologous as well as foreign or heterologous to the host plant.
- the expression cassette preferably contains, in the 5'-3 'transcription direction, the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination. Different termination areas are interchangeable.
- Examples of a terminator are the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet.
- Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as, for example, transitions and transversions come into question, w ' tro mutagenesis, "primer repair", restriction or ligation can be used.
- Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH ⁇ (Gielen et al., EMBO J. 3 ( 1984), 835 ff) or functional equivalents.
- transformation The transfer of foreign genes into the genome of a plant is called transformation.
- Suitable methods for the transformation of plants are the protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called "particle bombardment” method, the electroporation, the incubation dry embryos in DNA-containing solution, microinjection and the above-described gene transfer mediated by Agrobacterium.
- the methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).
- the construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).
- Agrobacteria transformed with an expression plasmid can be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
- the fused expression cassette which expresses a ketolase is cloned into a vector, for example pBin19 or in particular pSUN5 and pSUN3, which is suitable for being transformed into Agrobacterium tumefaciens.
- Agrobacteria transformed with such a vector can then be used in a known manner for transforming plants, in particular cultivated plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
- transgenic plants can be regenerated in a known manner which contain a gene integrated into the expression cassette for the expression of a nucleic acid encoding a ketolase.
- an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulatory signals, for example sequences for replication or integration.
- Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).
- the expression cassettes can be cloned into suitable vectors which can be used for their propagation, for example in E. coli.
- suitable cloning vectors include pJIT117 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380), pBR332, pUC series, M13mp series and pACYC184.
- Binary vectors which can replicate both in £ coli and in agrobacteria are particularly suitable.
- nucleic acids described above coding for a ketolase or ⁇ -hydroxylase or ⁇ -cyclase, are preferably incorporated into expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for an enzyme according to the invention; and vectors comprising at least one of these expression constructs.
- Such constructs according to the invention preferably comprise a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the coding sequence.
- An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.
- sequences which can be linked operatively are targeting sequences and translation enhancers, enhancers, polyadenylation signals and the like.
- Other regulatory elements include selectable markers, amplification signals, origins of replication and the like.
- the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the expression of the genes increased or decreased.
- the gene construct can also have a simpler structure, ie no additional regulation signals are inserted in front of the structural gene and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased or decreased.
- the nucleic acid sequences can be contained in one or more copies in the gene construct.
- Examples of useful promoters in microorganisms are: cos, tac, trp, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal , trc, ara, SP6, lambda PR or in the lambda PL promoter, which are advantageously used in gram-negative bacteria; as well as the gram-positive promoters amy and SP02 or the yeast promoters ADC1, MFa, AC, P-60, CYC1, GAPDH.
- inducible promoters such as, for example, light and in particular temperature-inducible promoters, such as the P r P r promoter, is particularly preferred.
- the regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences and the protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is immediately expressed and / or overexpressed.
- the regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it.
- the regulatory elements can advantageously be amplified at the transcription level by using strong transcription signals such as promoters and / or "enhancers".
- an increase in translation is also possible, for example, by improving the stability of the mRNA.
- An expression cassette is produced by fusing a suitable promoter with the nucleic acid sequences described above, encoding a ketolase, ⁇ -hydroxylase or ⁇ -cyclase and a terminator or polyadenylation signal.
- Common recombination and cloning techniques are used, such as those described in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
- the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host.
- Vectors are well known to the person skilled in the art and can be found, for example, from "Cloning Vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).
- vectors are also understood to mean all other vectors known to the person skilled in the art, such as, for example, phages, viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally. The following may be mentioned as examples of suitable expression vectors:
- fusion expression vectors such as pGEX (Pharmacia Biotech Ine; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT 5 (Pharmacia, Piscataway, NJ) which glutathione-S-transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.
- GST glutathione-S-transferase
- Non-fusion protein expression vectors such as pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California ( 1990) 60-89) or pBluescript and pUC vectors.
- yeast expression vector for expression in the yeast S. cerevisiae such as pYepSed (Baldari et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA).
- Vectors and methods of constructing vectors suitable for use in other fungi such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge.
- Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al., (1983) Mol. Cell Biol .. 3: 2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170: 31-39).
- the expression constructs or vectors according to the invention can be used to produce genetically modified microorganisms which have been transformed, for example, with at least one vector according to the invention.
- recombinant constructs according to the invention described above are advantageously introduced and expressed in a suitable host system.
- Common cloning and transfection methods known to the person skilled in the art such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used here in order to extract the nucleic acids mentioned in the respective expression system. to bring pression.
- Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997.
- marker genes which are also contained in the vector or in the expression cassette.
- marker genes are genes for antibiotic resistance and for enzymes which catalyze a coloring reaction which stains the transformed cell. These can then be selected using automatic cell sorting.
- Microorganisms which have been successfully transformed with a vector and which carry an appropriate antibiotic resistance gene can be selected using appropriate antibiotic-containing media or culture media.
- Marker proteins that are presented on the cell surface can be used for selection by means of affinity chromatography.
- the combination of the host organisms and the vectors which match the organisms, such as plasmids, viruses or phages, such as, for example, plasmids with the RNA polymerase / promoter system, the phages 8 or other temperate phages or transposons and / or further advantageous regulatory ones Sequences form an expression system.
- the invention further relates to a method for producing genetically modified organisms, characterized in that a nucleic acid construct containing functionally linked a promoter and nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2, and optionally introduces a terminator into the genome of the starting organism or extrachromosomally into the starting organism.
- the invention further relates to the genetically modified organisms, the genetic modification being the activity of a ketolase
- ketolase activity increased after A or caused after B is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or one of this sequence sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the ketolase activity is increased or caused compared to the wild type, preferably by increasing or causing the gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the gene expression of a nucleic acid, coding for a ketolase is increased or caused by introducing nucleic acids, coding for a ketolase, into the plants and thus preferably for overexpression or transgenic expression of nucleic acids, coding for a ketolase , containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
- the invention further relates to a genetically modified organism containing at least one transgenic nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has. This is the case if the starting organism has no ketolase or an endogenous ketolase and a transgenic ketolase is overexpressed.
- the invention further relates to a genetically modified organism containing at least two endogenous nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has. This is the case if the starting organism has an endogenous ketolase and the endogenous ketolase is overexpressed.
- organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular ⁇ -carotene and / or zeaxanthin and / or neoxanthine and / or violaxanthin and / or to make lutein.
- Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore capable of producing zeaxanthin as wild-type or starting organisms.
- Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.
- Both bacteria can be used as bacteria that are able to synthesize xanthophylls due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria. which are able to synthesize xanthophylls such as bacteria of the genus Erwinia, Agrobacterium, Flavobactenum, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.
- genes of the carotenoid biosynthesis of a carotenoid-producing organism such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria.
- which are able to synthesize xanthophylls such as bacteria of the genus Erwinia, Agrobacterium, Flavobactenum,
- Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobactenum sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.
- yeasts are Candida, Saccharomyces, Hansenula, Pichia or Phaffia. Particularly preferred yeasts are Xanthophyllomyces dendrorhous or Phaffia rhodozyma.
- Preferred mushrooms are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.
- Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil.
- Particularly preferred plants are plants selected from the Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Bras- sicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthacee, Capania roleaeaceae, Gentianaceaeaea, Gentianaceaeaea , Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, llliaceae or Lamiaceae.
- Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes erhcta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus , Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentlana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracle , Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Laburnum, Lathyrus, Leontodon,
- Very particularly preferred genetically modified plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium or Tropaeolum, wherein the genetically modified plant contains at least one transgenic nucleic acid encoding a ketolase.
- the present invention further relates to the transgenic plants, their reproductive material and their plant cells, tissue or parts, in particular their fruits, seeds, flowers and petals.
- the genetically modified plants can be used to produce ketocarotenoids, in particular astaxanthin.
- Genetically modified organisms according to the invention in particular plants or parts of plants, such as in particular petals with an increased content of ketocarotenoids, in particular astaxanthin, which can be consumed by humans and animals can also be used, for example, directly or after processing known per se can be used as food or feed or as feed and food supplement.
- the genetically modified organisms can be used for the production of ketocarotenoid-containing extracts of the organisms and / or for the production of feed and food supplements.
- the genetically modified organisms have an increased ketocarotenoid content compared to the wild type.
- An increased ketocarotenoid content is generally understood to mean an increased total ketocarotenoid content.
- ketocarotenoids is also understood to mean, in particular, an altered content of the preferred ketocarotenoids without the total carotenoid content necessarily having to be increased.
- the genetically modified plants according to the invention have an increased astaxanthin content compared to the wild type.
- an increased content is also understood to mean a caused content of ketocarotenoids or astaxanthin.
- the invention further relates to the new ketolases and the new nucleic acids encoding them.
- the invention relates to ketolases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 2, with the proviso that the amino acid sequences SEQ ID NO: 2 is not included.
- the sequence SEQ ID NO: 2 is, as mentioned above, annotated as a putative protein in databases.
- the invention further relates to ketolases containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 4 has.
- the sequence SEQ ID NO: 4, as mentioned above, is not annotated in databases.
- the invention further relates to nucleic acids encoding a protein described above, with the proviso that the nucleic acid does not contain the sequences SEQ ID NO: 1 or 3.
- a protein containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 2 and has the property of a ketolase, has a property as a ketolase.
- the invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO.2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 2 and has the property of a ketolase as a ketolase.
- a protein containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 65%, preferably at least 70%, preferably at least 75%, particularly preferably at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95%
- Amino acid level with the sequence SEQ. ID. NO. 4 and has the property of a ketolase has a property as a ketolase.
- the invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 65%, preferably at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90% , more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 4 and has the property of a ketolase as a ketolase.
- ketocarotenoids in particular astaxanthin.
- the invention is illustrated by the following examples, but is not limited to these:
- Example 1 Amplification of cDNA encoding the entire primary sequence of the kostolases from Nostoc punctiform PCC73102 ORF 38, contig 501 (SEQ ID NO: 1) and ORF 148, contig 502 (SEQ ID NO: 3)
- Nostoc punctiforme cells were digested with lysozyme (2 mg / ml) and the genomic DNA isolated using the GenElute Plant genomic DNA kit (Sigma) according to the manufacturer's instructions.
- ORF148 (762 bp) was amplified from the genomic DNA of Nostoc punctiforme using the primers 148-Start (SEQ ID NO: 9; 5 'ATG ATC CAG TTA GAA CAA CCA C -3') and 148-End ( SEQ ID NO: 10; 5 'CTA TTT TGC TTT GTA AAT TTC TGG -3') at an annealing temperature of 60 ° C over 30 cycles.
- PCR fragments were subcloned into the vector pMON 38201 (Borokov, A.Y. and Rivkin, M.L. (1997) Xcml containing vector for direct cloning of per produets. BioTech. 22, 812-814).
- the transformants were grown in 50 ml cultures with LB medium at 28 ° C. in the dark for 16 to 48 hours.
- the carotenoids were extracted with methanol, shaken out against 50% ether / petroleum ether and the extracts obtained were separated by HPLC (HypurityC18 column, eluent: acetonitrile / methanol / 2-propanol 85: 10: 5, temperature 32 ° C.).
- HPLC HydropurityC18 column, eluent: acetonitrile / methanol / 2-propanol 85: 10: 5, temperature 32 ° C.
- the spectra were recorded on-line using a diode array detector and the carotenoids were identified on the basis of their absorption maximum a and in comparison with standards.
- ketocarotenoids echinenone and canthaxanthin could be detected in both extracts (in controls without pPQE32-38 and pPQE32-148, however, only ß-carotene was found no ketocarotenoids found).
- the proportion of canthaxanthine (diketo compound) formed in the total carotenoid content was 81% in the complementation with pPQE32-148 and in the complementation with pPQE32-38 it was 40%.
- the proportion of echinenone (monoketo compound) was about 4% in both complementations.
- pPQE32-38 (Fig. 3C) and pPQE32-148 (Fig. 3D) were transformed into the zeaxanthin-forming £ coli transform ande JM101 / pACCAR25 ⁇ crtX (Misawa, N., Satomi, Y., Kondo, K., Yokoyama, A., Kajiwara, S., Saito, T. Ohtani, T. & Miki, W. (1995) Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene düster and astaxanthin biosynthetic pathway proposed at the gene level. J. Bacteriol. 22, 6575-6584).
- the transformants were grown, the carotenoid extraction and the HPLC separation were carried out as described under 3.1 above. While only the starting substrates zeaxanthin and ß-carotene, 85 and 5% of the total carotenoid content, respectively, could be detected in the extract obtained from the complementation with pPQE32-38, mainly the ketocarotenoids echinenone, canthaxanthin and Astaxanthin can be detected. Astaxanthin accounts for 50% of the total carotenoid content. The intermediates in the synthesis of astaxanthine echinenone and canthaxanthin represent 12% and 8% of the total carotenoid. The proportion of ß-carotene is about 30%.
- Figure 3 shows the HPLC separation of the carotenoids from complementation in E. coli with a ⁇ -carotene background co-transformed with pPQE32-38 (A) or pPQE32-148 (B) or in E. coli with a zeaxanthin background co-transformed with pPQE32 -38 (C) or pPQE32-148 (D).
- the indicated carotenoids were identified by cooking chromatography with reference substances and via their spectra as:
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Polymers & Plastics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Food Science & Technology (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Animal Husbandry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen, die im Vergleich zum Wildtyp eine veränderte Ketolase-Aktivität aufweisen, die genetisch veränderten Organismen, sowie deren Verwendung als Nahrungs- und Futtermittel und zur Herstellung von Ketocarotinoidextrakten.
Description
Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen
Beschreibung
Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen, die im Vergleich zum Wildtyp eine veränderte Ketolase-Aktivität aufweisen, die genetisch veränderten Organismen, sowie deren Verwendung als Nahrungs- und Futtermittel und zur Herstellung von Ketocarotinoidextrakten.
Ketocarotinoide treten hauptsächlich bei Bakterien, wenigen Pilzen und als Sekundärcarotinoide bei Grünalgen auf. Neben Echinenon, dem 4-Monoketo Derivat des ß-Carotins wird auch die entsprechende symmetrische Diketo Verbindung Canthaxanthin gebildet. Daneben sind von den o.g. Organismengruppen einige wenige Spezies bekannt, in denen Astaxanthin (= 3,3'-Hydroxy- 4,4'-keto-ß-carotin) als Endprodukt der Biosynthese (zusammen mit geringen Mengen entsprechender Intermediate) zu finden ist ( Goodwin, T.W. (1980) The Biochemistry of the Carote- noids, Vol. 1: Plants, 2nd edn. Chapman & Hall, New York.; Johnson, E.A. & An G.-H. (1991) Astaxanthin from microbial sources, Critical Rev. Biotechnol. 11, 297-326.; 3. Lorenz, R.T. & Cysewski, G.R. (2000) Commercial potentiai for Haematococcus microalgae as a natural source of astaxanthin. Trend Biotechn. 18, 160-167).
Aufgrund ihrer farbgebenden Eigenschaften werden die Ketocarotinoide und insbesondere Astaxanthin als Pigmentierhilfsstoffe in der Tierernährung, insbesondere in der Forellen-, Lachsund Shrimpszucht verwendet.
Die Herstellung von Astaxanthin erfolgt heutzutage größtenteils durch chemische Syntheseverfahren. Natürliche Ketocarotinoide, wie beispielsweise natürliches Astaxanthin, werden heutzutage in biotechnologischen Verfahren in kleinen Mengen durch Kultivierung von Algen, beispielsweise Haematococcus pluvialis oder durch Fermentation von gentechnologisch optimier- ten Mikroorganismen und anschließender Isolierung gewonnen.
Ein wirtschaftliches biotechnologisches Verfahren zur Herstellung von natürlichen Ketocarotinoiden ist daher von großer Bedeutung.
Spezifische Ketolase Gene des crfl/l/Typs wurden aus den Bakterien Agrobacterium aurantia- cum (EP 735 137, Accession NO: D58420), Paracoccus marcusii (Accession NO: Y15112) und als cDNA aus Haematococcus (Haematococcus pluvialis Flotow em. Wille und Haematoccus pluvialis, NIES-144 (EP 725137, WO 98/18910 und Lotan et al, FEBS Letters 1995, 364, 125- 128, Accession NO: X86782 und D45881)) kloniert und funktioneil identifiziert.
Daneben existieren noch ORFs aus anderen Organismen, die auf Grund von Aminosäure Homologien als Ketolase Gene bezeichnet werden, wie beispielsweise Nukleinsäuren kodierend eine Ketolase aus aus Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422), Synechocystis sp. Strain PC6803 (Accession NO: NP_442491), Bradyrhizobium sp. (Accession NO: AF218415), Nostoc sp. PCC 7120 (Kaneko et al, DNA Res. 2001 , 8(5), 205 - 213; Accession NO: AP003592, BAB74888) und Brevundimonas aurantiaca (WO 02079395).
Biochemisch sind lediglich die Ketolase aus A. aurantiacum und Alcaligenes spec. charakterisiert worden (Fräser P.D., Shimada H. & Misawa N.(1998) Enzymic confirmation of reactions involved in routes to astaxanthin formation, elucidated using a direct Substrate in vitro assay. Eur. J. Biochem. 252, 229-236.). Es gibt noch einen weiteren Typ von ß-Carotin Ketolase Genen, crtO aus dem Cyanobacterium Synechocystis, das keine Ähnlichkeit mit crtW aufweist und mit den bakteriellen Desaturasen verwandt ist (Fernandez-Gonzalez, B., Sandmann, G. & Vio- que, A (1997) A new type of asymmetrically acting ß-carotene ketolase is required for the syn- thesis of echinenone in the cyanobacterium Synechocystis sp. PCC 6803. J. Biol. Chem. 272, 9728-9733.)
Alle bekannten Ketolasen können bei ß-Carotin in Position 4 eine Ketogruppe einfügen. Das crtO Gen kodiert für eine Monoketolase, die Echinenon als Endprodukt aus ß-Carotin bildet. Die crtW Genfamilie, zu der auch bkt aus Haematococcus gehört, kodiert für eine Diketolase, die ß- Carotin bis zu Canthaxanthin umsetzt. Diese Reaktion scheint der erste Modifikationsschritt in Richtung Astaxanthin zu sein, dem sich eine Hydroxylierung an Position 3 anschließt. Die gleiche Reaktionssequenz gilt dann auch für den zweiten lonon Ring (9). Es gibt auch enzymatische Hinweise, dass 3-Hydroxy-ß-carotin Derivate nur schlecht an Position 4 ketoliert werden können. Es hat sich ebenfalls gezeigt, dass nur bestimmte bakterielle Hydroxylasen, wie die von Erwinia uredovora ( Breitenbach, J., Misawa, N., Kajiwara, S. & Sandmann, G. (1996) Expression in Escherichia coli and properties of the carotene ketolase from Haematococcus pluvialis. FEMS Microbiol. Lett. 140, 241-246) oder A. aurantiacum in der Lage sind ketolierte Intermediate umzusetzen. Die strukturell unterschiedlichen Hydroxylasen der Cyanobacterien können dies nicht (Albrecht, M., Steiger, S. & Sandmann, G. (2001) Expression of a ketolase gene mediates the synthesis of canthaxanthin in Synechococcus leading to resistance against pigment photo- degradation and UV-B sensitivity of photosynthesis. Photochem. Photobiol. 73, 551-555.). Es erfolgt keine Kooperation dieses Typs von Hydroxylase mit einer Ketolase, und man erhält keine substantiellen Mengen an Astaxanthin.
EP 735 137 beschreibt die Herstellung von Xanthophyllen in Mikroorganismen, wie beispielsweise E. coli durch Einbringen von Ketolase-Genen (crtW) aus Agrobacterium aurantiacum oder Alcaligenes sp. PC-1 in Mikroorganismen.
Aus EP 725 137, WO 98/18910, Kajiwara et al. (Plant Mol. Biol. 1995, 29, 343-352) und Hirschberg et al.(FEBS Letters 1995, 364, 125-128) ist es bekannt, Astaxanthin durch Einbringen von Ketolase-Genen aus Haematococcus pluvialis (crtW, crtO oder bkt) in £ coli herzustellen.
Hirschberg et al.(FEBS Letters 1997, 404, 129-134) beschreiben die Hersteilung von Astaxanthin in Synechococcus durch Einbringen von Ketolase-Genen (crtO) aus Haematococcus pluvialis. Sandmann et al. (Photochemistry and Photobiology 2001 , 73(5), 551-55) beschreiben ein analoges Verfahren, das jedoch zur Herstellung von Canthaxanthin führt und nur Spuren Astaxanthin liefert.
WO 98/18910 und Hirschberg et al. (Nature Biotechnology 2000, 18(8), 888-892) beschreiben die Synthese von Ketocarotinoiden in Nektarien von Tabakblüten durch Einbringen des Ketola- se-Gens aus Haematococcus pluvialis (crtO) in Tabak.
WO 01/20011 beschreibt ein DNA Konstrukt zur Produktion von Ketocarotinoiden, insbesondere Astaxanthin, in Samen von Ölsaatpflanzen wie Raps, Sonnenblume, Sojabohne und Senf unter Verwendung eines Samen-spezifischen Promotors und einer Ketolase aus Haematococcus pluvialis.
Alle im Stand der Technik beschriebenen Verfahren zur Herstellung von Ketocarotinoiden und insbesondere die beschriebenen Verfahren zur Herstellung von Astaxanthin weisen den Nachteil auf, daß die transgenen Organismen nur geringe Mengen an Astaxanthin liefern.
Der Erfindung lag daher die Aufgabe zugrunde, ein Verfahren zur Herstellung von Ketocarotinoi- den durch Kultivierung von genetisch veränderten Organismen zur Verfügung zu stellen, bzw. weitere genetisch veränderte Organismen, die Ketocarotinoide herstellen, zur Verfügung zu stellen, die die vorstehend beschriebenen Nachteile des Standes der Technik in geringerem Maße oder nicht mehr aufweisen.
Demgemäß wurde ein Verfahren zur Herstellung von Ketocarotinoiden gefunden, indem man genetisch veränderte Organismen kultiviert, die im Vergleich zum Wildtyp eine veränderte Keto- lase-Aktivität aufweisen und die veränderte Ketolase-Aktivität durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
Die erfindungsgemäßen Organismen wie beispielsweise Mikroorganismen oder Pflanzen sind vorzugsweise als Ausgangsorganismen natürlicherweise in der Lage, Carotinoide wie beispielsweise ß-Carotin oder Zeaxanthin herzustellen, oder können durch genetische Veränderung, wie
beispielsweise Umregulierung von Stoffwechselwegen oder Komplementierung in die Lage versetzt werden, Carotinoide wie beispielsweise ß-Carotin oder Zeaxanthin herzustellen.
Einige Organismen sind als Ausgangs- oder Wildtyporganismen bereits in der Lage, Ketocaroti- noidewie beispielsweise Astaxanthin oder Canthaxanthin herzustellen. Diese Organismen, wie beispielsweise Haematococcus pluvialis, Paracoccus marcusii, Xanthophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonis sp., Neochloris wimmeri.Protosiphon botryoides, Scotiellopsis oocystiformis, Scenedesmus vacuolatus, Chlorela zofingiensis, Ankistrodesmus braunii, Euglena sanguinea, Bacillus atrophaeus, Blakeslea wei- sen bereits als Ausgangs- oder Wildtyporganismus eine Ketolase-Aktivitat auf.
In einer Ausführungsform des erfindungsgemäßen Verfahrens werden daher als Ausgangsorganismen Organismen verwendet, die bereits als Wildtyp oder Ausgangsorganismus eine Keto- laseaktivität aufweisen. In dieser Ausführungsform bewirkt die genetische Veränderung eine Erhöhung der Ketolase-Aktivitat im Vergleich zum Wildtyp oder Ausgangsorganismus.
Unter Ketolase-Aktivitat wird die Enzymaktivität einer Ketolase verstanden.
Unter einer Ketolase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, am, gegebenenfalls substituierten, ß-lonon-Ring von Carotinoiden eine Keto-Gruppe einzuführen.
Insbesondere wird unter einer Ketolase ein Protein verstanden, das die enzymatische Aktivität aufweist, ß-Carotin in Canthaxanthin umzuwandeln.
Dementsprechend wird unter Ketolase-Aktivitat die in einer bestimmten Zeit durch das Protein Ketolase umgesetzte Menge ß-Carotin bzw. gebildete Menge Canthaxanthin verstanden.
Bei einer erhöhten Ketolase-Aktivitat gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Ketolase die umgesetzte Menge ß-Carotin bzw. die gebildete Menge Canthaxanthin erhöht.
Vorzugsweise beträgt diese Erhöhung der Ketolase-Aktivitat mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der Ketolase-Aktivitat des Wildtyps.
Unter dem Begriff "Wildtyp" wird erfindungsgemäß der entsprechende Ausgangsorganismus verstanden.
Je nach Zusammenhang kann unter dem Begriff "Organismus" der Ausgangsorganismus (Wildtyp) oder ein erfindungsgemäßer, genetisch veränderter Organismus oder beides verstanden werden.
Vorzugsweise und insbesondere in Fällen, in denen der Organismus oder der Wildtyp nicht eindeutig zugeordnet werden kann, wird unter "Wildtyp" für die Erhöhung oder Verursachung der Ketolase-Aktivitat, für die nachstehend beschriebene Erhöhung der Hydroxyiase-Aktivität, für die nachstehend beschriebene Erhöhung der ß-Cyclase-Aktivität und die Erhöhung des Gehalts an Ketocarotinoiden jeweils ein Referenzorganismus verstanden.
Dieser Referenzorganimus ist für Mikroorganismen, die bereits als Wildtyp eine Ketolase Aktivität aufweisen, vorzugsweise Haematococcus pluvialis.
Dieser Referenzorganismus ist für Mikroorganismen, die als Wildtyp keine Ketolase Aktivität aufweisen, vorzugsweise Blakeslea.
Dieser Referenzorganismus ist für Pflanzen, die bereits als Wildtyp eine Ketolase-Aktivitat aufweisen, vorzugsweise Adonis aestivalis, Adonis flammeus oder Adonis annuus, besonders bevorzugt Adonis aestivalis.
Dieser Referenzorganismus ist für Pflanzen, die als Wildtyp keine Ketolase-Aktivitat in Blütenblätter aufweisen, vorzugsweise Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta oder Tagetes campanulata, besonders bevorzugt Tagetes erecta.
Die Bestimmung der Ketolase-Aktivitat in erfindungsgemäßen genetisch veränderten Organismen und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Bestimmung der Ketolase-Aktivitat in Pflanzen- oder Mikroorganismenmaterial erfolgt in Anlehnung an die Methode von Frazer et al., (J. Biol. Chem. 272(10): 6128-6135, 1997). Die Ketolase-Aktivitat in pflanzlichen oder Mikroorganismus-Extrakten wird mit den Substraten ß- Carotin und Canthaxanthin in Gegenwart von Lipid (Sojalecithin) und Detergens (Natriumcholat) bestimmt. Substrat/Produkt-Verhältnisse aus den Ketolase-Assays werden mittels HPLC ermittelt.
Die Erhöhung der Ketolase-Aktivitat kann durch verschiedene Wege erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Translations- und Protein-
ebene oder durch Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, gegenüber dem Wildtyp, beispielsweise durch Induzierung des Ketolase-Gens durch Aktivatoren oder durch Einbringen von Nukleinsäuren, kodierend eine Ketolase, in den Organismus.
Unter Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, wird erfindungsgemäß in dieser Ausführungsform auch die Manipulation der Expression der Organismen eigenen endogenen Ketolasen verstanden. Dies kann beispielsweise durch Veränderung der Promotor DNA-Sequenz für Ketolase kodierende Gene erreicht werden. Eine solche Veränderung, die eine veränderte oder vorzugsweise erhöhte Expressionsrate mindestens eines endo- genen Ketolase Gens zur Folge hat, kann durch Deletion oder Insertion von DNA Sequenzen erfolgen.
Es ist wie vorstehend beschrieben möglich, die Expression mindestens einer endogenen Ketolase durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere physiolo- gische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.
Des weiteren kann eine erhöhte Expression mindestens eines endogenen Ketolase-Gens dadurch erzielt werden, dass ein im Wildtyporganismus nicht vorkommendes oder modifiziertes Regulatorprotein mit dem Promotor dieser Gene in Wechselwirkung tritt.
Solch ein Regulator kann ein chimäres Protein darstellen, welches aus einer DNA-Bindedomäne und einer Transkriptionsaktivator-Domäne besteht, wie beispielsweise in WO 96/06166 beschrieben.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Ketolase-Aktivitat gegenüber dem Wildtyp durch die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In einer weiter bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, durch Einbringen von Nukleinsäuren, die Ketolasen kodieren, in die Organismen, wobei die Ketolasen die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleite- te Sequenz enthalten, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In den erfindungsgemäßen transgenen Organismen liegt also in dieser Ausführungsform gegenüber dem Wildtyp mindestens ein weiteres Ketolase-Gen vor, kodierend eine Ketolase, ent-
haltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In dieser Ausführungsform weist der erfindungsgemäße genetisch veränderte Organismus dementsprechend mindestens eine exogene (=heterologe) Nukleinsäure, kodierend eine Ketolase, auf oder mindestens zwei endogene Nukleinsäuren, kodierend eine Ketolase, auf, wobei die Ketolasen die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz enthalten, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In einer anderen, bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens werden als Ausgangsorganismen Organismen verwendet, die als Wildtyp keine Ketolaseaktivität aufweisen.
In dieser bevorzugten Ausführungsform verursacht die genetische Veränderung die Ketolase- Aktivitat in den Organismen. Der erfindungsgemäße genetisch veränderte Organismus weist somit in dieser bevorzugten Ausführungsform im Vergleich zum genetisch nicht veränderten Wildtyp eine Ketolase-Aktivitat auf und ist somit vorzugsweise in der Lage, transgen eine Ketolase zu exprimieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In dieser bevorzugten Ausführungsform erfolgt die Verursachung der Genexpression einer Nuk- leinsäure, kodierend eine Ketolase, analog zu der vorstehend beschriebenen Erhöhung der Genexpression einer Nukleinsäure.kodierend eine Ketolase, vorzugsweise durch Einbringen von Nukleinsäuren, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, in den Ausgangsorganismus.
Dazu kann in beiden Ausführungsformen prinzipiell jede Nukleinsäuren, die eine Ketolase kodiert, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, verwendet werden.
Die Verwendung der erfindungsgemäßen Nukleinsäuren, kodierend eine Ketolase, führt im erfindungsgemäßen Verfahren überraschenderweise zu einer höheren Ausbeute an Ketocaroti-
noiden, insbesondere an Astaxanthin als bei der Verwendung der im Stand der Technik verwendeten Ketolase-Gene.
Alle in der Beschreibung erwähnten Nukleinsäuren können beispielsweise eine RNA-, DNA- oder cDNA-Sequenz sein.
Bei genomischen Ketolase-Sequenzen aus eukaryotischen Quellen, die lntrons enthalten, sind für den Fall, dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Ketolase zu exprimieren, bevorzugt bereits prozessierte Nuklein- säuresequenzen wie die entsprechenden cDNAs zu verwenden.
Beispiele für Nukleinsäuren, kodierend eine Ketolase, und die entsprechenden Ketolasen, enthaltend die Aminosäuresequenz SEQ. ID. NO.2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindes- tens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, die im erfindungsgemäßen Verfahren vorteilhaft verwendet werden können, sind beispielsweise Sequenzen aus
Nostoc punctiforme PCC73102 ORF 38, Nukleinsäure: Acc.-No. NZ_AABC01000195, Basenpaar 55,604 bis 55,392 (SEQ ID NO: 1); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 2) (als putatives Protein annotiert) oder
Nostoc punctiforme PCC73102 ORF 148, Nukleinsäure: Acc.-No. NZ_AABC01000196, Basenpaar 140,571 bis 139,810 (SEQ ID NO: 3), Protein: (SEQ ID NO: 4) (nicht annotiert)
oder von diesen Sequenzen abgeleitete Ketolasesequenzen.
Abbildung 1 zeigt zusätzlich die Nukleinsäuresequenzen von ORF 38 und ORF 148 aus Nostoc punctiforme.
Für die Herstellung von Astaxanthin ist insbesondere die Verwendung der Ketolase Nostoc punctiforme PCC73102 ORF 148, Nukleinsäure: Acc.-No. NZ_AABC01000196, Basenpaar 140,571 bis 139,810 (SEQ ID NO: 3), Protein: (SEQ ID NO: 4) oder von dieser Sequenz abgeleitete Sequenzen besonders bevorzugt.
Weitere natürliche Beispiele für Ketolasen und Ketolase-Gene, die im erfindungsgemäßen Verfahren verwendet werden können, lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, durch Identitätsvergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit den vorstehend beschriebenen Sequenzen SEQ ID NO: 2 oder SEQ ID NO: 4 leicht auffinden.
Weitere natürliche Beispiele für Ketolasen und Ketolase-Gene lassen sich weiterhin ausgehend von den vorstehend beschriebenen Nukleinsäuresequenzen, insbesondere ausgehend von den Sequenzen SEQ ID NO: 1 oder SEQ ID NO: 3 aus verschiedenen Organismen, deren genomi- sehe Sequenz nicht bekannt ist, durch Hybridisierungstechniken in an sich bekannter Weise leicht auffinden.
Die Hybridisierung kann unter moderaten (geringe Stringenz) oder vorzugsweise unter stringen- ten (hohe Stringenz) Bedingungen erfolgen.
Solche Hybridisierungsbedingungen sind beispielsweise bei Sambrook, J., Fritsch, E.F., Mania- tis, T., in: Molecular Cloning (A Laboratory Manual), 2. Auflage, Cold Spring Harbor Laboratory Press, 1989, Seiten 9.31-9.57 oder in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6 beschrieben.
Beispielhaft können die Bedingungen während des Waschschrittes ausgewählt sein aus dem Bereich von Bedingungen begrenzt von solchen mit geringer Stringenz (mit 2X SSC bei 50_C) und solchen mit hoher Stringenz (mit 0.2X SSC bei 50_C, bevorzugt bei 65_C) (20X SSC: 0,3 M Natriumeitrat, 3 M Natriumchlorid, pH 7.0).
Darüberhinaus kann die Temperatur während des Waschschrittes von moderaten Bedingungen bei Raumtemperatur, 22°C, bis zu stringenten Bedingungen bei 65°C angehoben werden.
Beide Parameter, Salzkonzentration und Temperatur, können gleichzeitig variiert werden, auch kann einer der beiden Parameter konstant gehalten und nur der andere variiert werden. Während der Hybridisierung können auch denaturierende Agenzien wie zum Beispiel Formamid oder SDS eingesetzt werden. In Gegenwart von 50 % Formamid wird die Hybridisierung bevorzugt bei 42°C ausgeführt.
Einige beispielhafte Bedingungen für Hybridisierung und Waschschritt sind infolge gegeben:
(1) Hybridiserungsbedingungen mit zum Beispiel
(i) 4X SSC bei 65°C, oder
ii) 6X SSC bei 45°C, oder
iii) 6X SSC bei 68°C, 100 mg/ml denaturierter Fischsperma-DNA, oder
(iv) 6X SSC, 0.5 % SDS, 100 mg/ml denaturierte, fragmentierte Lachssperma-DNA bei 68°C, oder
(v) 6XSSC, 0.5 % SDS, 100 mg/ml denaturierte, fragmentierte Lachssperma-DNA, 50 % Formamid bei 42°C, oder
(vi) 50 % Formamid, 4X SSC bei 42_C, oder
(vii) 50 % (vol/vol) Formamid, 0.1 % Rinderserumalbumin, 0.1 % Ficoll, 0.1 % Polyvinylpyrro- lidon, 50 mM Natriumphosphatpuffer pH 6.5, 750 mM NaCl, 75 mM Natriumeitrat bei 42°C, oder
(viii) 2X oder 4X SSC bei 50°C (moderate Bedingungen), oder
(ix) 30 bis 40 % Formamid, 2X oder 4X SSC bei 42° (moderate Bedingungen).
(2) Waschschritte für jeweils 10 Minuten mit zum Beispiel
(i) 0.015 M NaCI/0.0015 M Natriumcitrat/0.1 % SDS bei 50°C, oder
(ii) 0.1 X SSC bei 65°C, oder
(iii) 0.1 X SSC, 0.5 % SDS bei 68°C, oder
(iv) 0.1 X SSC, 0.5 % SDS, 50 % Formamid bei 42°C, oder
(v) 0.2X SSC, 0.1 % SDS bei 42°C, oder
(vi) 2X SSC bei 65°C (moderate Bedingungen).
In einer bevorzugten Ausführungsform der erfindungsgemäßen Verfahren bringt man Nukleinsäuren ein, die eine Ketolase kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 50%, vorzugsweise mindestens 60%, vorzugs- weise mindestens 65 %, vorzugsweise mindestens 70 %, bevorzugter mindestens 75 %, bevorzugter mindestens 80 %, bevorzugter mindestens 85 %, bevorzugter mindestens 90 %, bevorzugter mindestens 95 %, besonders bevorzugt mindestens 98 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 2 aufweist.
Dabei kann es sich um eine natürliche Ketolase-Sequenz handeln, die wie vorstehend beschrieben durch Identitätsvergleich der Sequenzen aus anderen Organismen gefunden werden kann oder um eine künstliche Ketolase-Sequenz, die ausgehend von der Sequenz SEQ ID NO: 2 durch künstliche Variation, beispielsweise durch Substitution, Insertion oder Deletion von Aminosäuren abgewandelt wurde.
Unter dem Begriff "Substitution" ist in der Beschreibung der Austausch einer oder mehrerer A- minosäuren durch eine oder mehrere Aminosäuren zu verstehen. Bevorzugt werden sog. kon- servative Austausche durchgeführt, bei denen die ersetzte Aminosäure eine ähnliche Eigenschaft hat wie die ursprüngliche Aminosäure, beispielsweise Austausch von Glu durch Asp, Gin durch Asn, Val durch lle, Leu durch He, Ser durch Thr.
Deletion ist das Ersetzen einer Aminosäure durch eine direkte Bindung. Bevorzugte Positionen für Deletionen sind die Termini des Polypeptides und die Verknüpfungen zwischen den einzelnen Proteindomänen.
Insertionen sind Einfügungen von Aminosäuren in die Polypeptidkette, wobei formal eine direkte Bindung durch ein oder mehrere Aminosäuren ersetzt wird.
Unter Identität zwischen zwei Proteinen wird die Identität der Aminosäuren über die jeweils gesamte Proteinlänge verstanden, insbesondere die Identität die durch Vergleich mit Hilfe der Vec- tor NTI Suite 7.1 Software der Firma Informax (USA) unter Anwendung der Clustal Methode (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr;5(2): 151-1) unter Einstellung folgender Parameter berechnet wird:
Multiple alignment parameter:
Gap opening penalty 10 Gap extension penalty 10
Gap Separation penalty ränge 8
Gap Separation penalty off
% identity for alignment delay 40
Residue specific gaps off Hydrophilic residue gap off
Transition weighing 0
Pairwise alignment parameter: FAST algorithm on
K-tuple size 1
Gap penalty 3 Window size 5
Number of best diagonals 5
Unter einer Ketolase, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 2 aufweist, wird dementsprechend eine Ketolase verstanden, die bei einem Vergleich seiner Sequenz mit der Sequenz SEQ ID NO: 2, insbesondere nach obigen Programmlogarithmus mit obigem Parametersatz eine Identität von mindestens 42 % aufweist.
Beispielsweise weist nach obigen Programm logarithmus mit obigem Parametersatz die Sequenz der Ketolase aus Nostoc punctiforme PCC73102 ORF 148 (SEQ ID NO: 4) mit der Se- quenz der Ketolase aus Nostoc punctiforme PCC73102 ORF 38 (SEQ ID NO: 2) eine Identität von 64% auf.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptid- sequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der Organismusspezifischen "codon usage" häufig verwendet werden. Die "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ ID NO: 1 oder SEQ ID NO: 3 in den Organismus ein.
Alle vorstehend erwähnten Ketolase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkonden- sation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, S. 896- 897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klo- nierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Die Sequenz der Ketolase aus Nostoc punctiforme PCC73102 ORF 38 (SEQ ID NO: 2) weist mit den Sequenzen der Ketolasen die in den Verfahren des Standes der Technik verwendet werden
eine Identität von 38% (Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), 38% (Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422) und 19 bis 21 % (Haematococcus pluvialis Flotow em. Wille und Haematoccus pluvialis, NIES-144 (EP 725137, WO 98/18910 und Lotan et al, FEBS Letters 1995, 364, 125-128, Accession NO: X86782 und D45881) auf.
In einer bevorzugten Ausführungsform werden Organismen kultiviert, die gegenüber dem Wildtyp zusätzlich zur erhöhten Ketolase-Aktivitat eine erhöhte Hydroxylase-Aktivität und/oder ß- Cyclase-Aktivität aufweisen.
Unter Hydroxylase-Aktivität wird die Enzymaktivität einer Hydroxylase verstanden.
Unter einer Hydroxylase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, am, gegebenenfalls substituierten, ß-lonon-Ring von Carotinoiden eine Hydroxy-Gruppe einzuführen.
Insbesondere wird unter einer Hydroxylase ein Protein verstanden, das die enzymatische Aktivität aufweist, ß-Carotin in Zeaxanthin oder Canthaxanthin in Astaxanthin umzuwandeln.
Dementsprechend wird unter Hydroxylase-Aktivität die in einer bestimmten Zeit durch das Pro- tein Hydroxylase umgesetzte Menge ß-Carotin oder Canthaxanthin bzw. gebildete Menge Zeaxanthin oder Astaxanthin verstanden.
Bei einer erhöhten Hydroxylase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Hydroxylase die umgesetzte Menge ß- Carotin oder Canthaxantin bzw. die gebildete Menge Zeaxanthin oder Astaxanthin erhöht.
Vorzugsweise beträgt diese Erhöhung der Hydroxylase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der Hydroxylase-Aktivität des Wildtyps.
Unter ß-Cyclase-Aktivität wird die Enzymaktivität einer ß-Cyclase verstanden.
Unter einer ß-Cyclase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, ei- nen endständigen, linearen Rest von Lycopin in einen ß-lonon-Ring zu überführen.
Insbesondere wird unter einer ß-Cyclase ein Protein verstanden, das die enzymatische Aktivität aufweist, γ-Carotin in ß-Carotin umzuwandeln.
Dementsprechend wird unter ß-Cyclase-Aktivität die in einer bestimmten Zeit durch das Protein ß-Cyclase umgesetzte Menge γ-Carotin bzw. gebildete Menge ß-Carotin verstanden.
Bei einer erhöhten ß-Cyclase -Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein ß-Cyclase die umgesetzte Menge an Lycopin bzw. γ-Carotin oder die gebildete Menge an γ-Carotin aus Lycopin bzw. die gebildete Menge an ß-Carotin aus γ-Carotin erhöht.
Vorzugsweise beträgt diese Erhöhung der ß-Cyclase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der ß-Cyclase-Aktivität des Wildtyps.
Die Bestimmung der Hydroxylase-Aktivität in erfindungsgemäßen genetisch veränderten Organismen und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Aktivität der Hydroxylase wird nach Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320- 328) in vitro bestimmt. Es wird zu einer bestimmten Menge an Organismusextrakt Ferredoxin, Ferredoxin-NADP Oxidoreductase, Katalase, NADPH sowie ß-Carotin mit Mono- und Digalakto- sylglyzeriden zugegeben.
Besonders bevorzugt erfolgt die Bestimmung der Hydroxylase-Aktivität unter folgenden Bedin- gungen nach Bouvier, Keller, d'Harlingue und Camara (Xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L; Biochim. Biophys. Acta 1391 (1998), 320-328):
Der in-vitro Assay wird in einem Volumen von 0.250 ml durchgeführt. Der Ansatz enthält 50 mM Kalium phosphat (pH 7.6), 0.025 mg Ferredoxin von Spinat, 0.5 Einheiten Ferredoxin-NADP+ Oxidoreduktase von Spinat, 0.25 mM NADPH, 0.010 mg beta-Carotin (in 0.1 mg Tween 80 e- mulgiert), 0.05 mM einer Mischung von Mono- und Digalaktosylglyzeriden (1 :1), 1 Einheit Katalyse, 200 Mono- und Digalaktosylglyzeriden (1 :1), 0.2 mg Rinderserumalbumin und Organismusextrakt in unterschiedlichem Volumen. Die Reaktionsmischung wird 2 Stunden bei 30°C inkubiert. Die Reaktionsprodukte werden mit organischem Lösungsmittel wie Aceton oder Chloroform/Methanol (2:1) extrahiert und mittels HPLC bestimmt.
Die Bestimmung der ß-Cyclase-Aktivität in erfindungsgemäßen genetisch veränderten Organismen und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Aktivität der ß-Cyclase wird nach Fräser und Sandmann (Biochem. Biophys. Res. Comm. 185(1) (1992) 9-15)/? vitro bestimmt. Es werden zu einer bestimmten Menge an Organismusextrakt Kaliumphosphat als Puffer (pH 7.6), Lycopin als Substrat, Stromaprotein von Paprika, NADP+, NADPH und ATP zugegeben.
Besonders bevorzugt erfolgt die Bestimmung der ß-Cyclase -Aktivität unter folgenden Bedingungen nach Bouvier, d'Harlingue und Camara (Molecular Analysis of carotenoid cyclae Inhibition; Arch. Biochem. Biophys. 346(1) (1997) 53-64):
Der in-vitro Assay wird in einem Volumen von 250 μl Volumen durchgeführt. Der Ansatz enthält 50 mM Kalium phosphat (pH 7.6),unterschiedliche Mengen an Organismusextrakt, 20 nM Lycopin, 250 μg an chromoplastidärem Stromaprotein aus Paprika, 0.2 mM NADP+, 0.2 mM NADPH und 1 mM ATP. NADP/NADPH und ATP werden in 10 ml Ethanol mit 1 mg Tween 80 unmittelbar vor der Zugabe zum Inkubationsmedium gelöst. Nach einer Reaktionszeit von 60 Minuten bei 30°C wird die Reaktion durch Zugabe von Chloroform/Methanol (2:1) beendet. Die in Chloro- form extrahierten Reaktionsprodukte werden mittels HPLC analysiert.
Ein alternativer Assay mit radioaktivem Substrat ist beschrieben in Fräser und Sandmann (Biochem. Biophys. Res. Comm. 185(1) (1992) 9-15).
Die Erhöhung der Hydroxylase-Aktivität und/oder ß-Cyclase-Aktivität kann durch verschiedene Wege erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Expressions- und Proteinebene oder durch Erhöhung der Genexpression von Nukleinsäuren, kodierend eine Hydroxylase, und/oder von Nukleinsäuren, kodierend eine ß-Cyclase, gegenüber dem Wildtyp.
Die Erhöhung der Genexpression der Nukleinsäuren, kodierend eine Hydroxylase, und/oder die Erhöhung der Genexpression der Nukleinsäure, kodierend eine ß-Cyclase, gegenüber dem Wildtyp kann ebenfalls durch verschiedene Wege erfolgen, beispielsweise durch Induzierung des Hydroxylase-Gens und/oder ß-Cyclase-Gens durch Aktivatoren oder durch Einbringen von einer oder mehrerer Hydroxylase-Genkopien und/oder ß-Cyclase-Genkopien, also durch Einbringen mindestens einer Nukleinsäure, kodierend eine Hydroxylase, und/oder mindestens einer Nukleinsäure, kodierend eine ß-Cyclase, in den Organismus.
Unter Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Hydroxylase und/oder ß- Cyclase, wird erfindungsgemäß auch die Manipulation der Expression der Organismus eigenen endogenen Hydroxylase und/oder ß-Cyclase verstanden.
Dies kann beispielsweise durch Veränderung der Promotor DNA-Sequenz für Hydroxylasen und/oder ß-Cyclasen kodierende Gene erreicht werden. Eine solche Veränderung, die eine erhöhte Expressionsrate des Gens zur Folge hat, kann beispielsweise durch Deletion oder Insertion von DNA Sequenzen erfolgen.
Es ist, wie vorstehend beschrieben, möglich, die Expression der endogenen Hydroxylase und/oder ß-Cyclase durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere physiologische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.
Des weiteren kann eine veränderte bzw. erhöhte Expression eines endogenen Hydroxylase- und/oder ß-Cyclase-Gens dadurch erzielt werden, dass ein im nicht transformierten Organismus nicht vorkommendes Regulator-Protein mit dem Promotor dieses Gens in Wechselwirkung tritt.
Solch ein Regulator kann ein chimäres Protein darstellen, welches aus einer DNA-Bindedomäne und einer Transkriptionsaktivator-Domäne besteht, wie beispielsweise in WO 96/06166 beschrieben.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Hydroxylase, und/oder die Erhöhung der Genexpression einer Nuklein- " säure, kodierend eine ß-Cyclase, durch Einbringen von mindestens einer Nukleinsäure, kodierend eine Hydroxylase, und/oder durch Einbringen von mindestens einer Nukleinsäure, kodierend eine ß-Cyclase, in den Organismus.
Dazu kann prinzipiell jedes Hydroxylase-Gen bzw. jedes ß-Cyclase-Gen, also jede Nukleinsäu- re, die eine Hydroxylase und jede Nukleinsäure, die eine ß-Cyclase kodiert, verwendet werden.
Bei genomischen Hydroxylase-bzw. ß-Cyclase-Nukleinsäure-Sequenzen aus eukaryotischen Quellen, die Introns enthalten, sind für den Fall, dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechende Hydroxylase bzw. ß-Cyclase zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen, wie die entsprechenden cDNAs, zu verwenden.
Ein Beispiel für ein Hydroxylase-Gen ist eine Nukleinsäure, kodierend eine Hydroxylase, aus Haematococcus pluvialis, Accession AX038729, WO 0061764); (Nukleinsäure: SEQ ID NO: 5, Protein: SEQ ID NO: 6).
Ein Beispiel für ein ß-Cyclase-Gen ist eine Nukleinsäure, kodierend eine ß-Cyclase aus Tomate (Accession X86452).(Nukleinsäure: SEQ ID NO: 7, Protein: SEQ ID NO: 8).
In den erfindungsgemäßen bevorzugten transgenen Organismen liegt also in dieser bevorzugten Ausführungsform gegenüber dem Wildtyp mindestens ein weiteres Hydroxylase-Gen und/oder ß-Cyclase-Gen vor.
In dieser bevorzugten Ausführungsform weist der genetisch veränderte Organismus beispielsweise mindestens eine exogene Nukleinsäure, kodierend eine Hydroxylase, oder mindestens zwei endogene Nukleinsäuren, kodierend eine Hydroxylase und/oder mindestens eine exogene Nukleinsäure, kodierend eine ß-Cyclase, oder mindestens zwei endogene Nukleinsäuren, kodierend eine ß-Cyclase, auf.
Bevorzugt verwendet man in vorstehend beschriebener bevorzugter Ausführungsform als Hydroxylase-Gene Nukleinsäuren, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70%, noch bevorzugter mindestens 90 %, am bevorzugtesten mindestens 95 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 6, und die die enzymatische Eigenschaft einer Hydroxylase aufweisen.
Weitere Beispiele für Hydroxylasen und Hydroxylase-Gene lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, wie vorstehend beschrieben durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ ID. NO: 6 leicht auffinden.
Weitere Beispiele für Hydroxylasen und Hydroxylase-Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ ID NO: 5 aus verschiedenen Organismen deren genomische Sequenz nicht bekannt ist, wie vorstehend beschrieben, durch Hybridisierungs- und PCR- Techniken in an sich bekannter Weise leicht auffinden.
In einer weiter besonders bevorzugten Ausführungsform werden zur Erhöhung der Hydroxylase- Aktivität Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der Hydroxylase der Sequenz SEQ ID NO: 6.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptid- sequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Kodons verwendet, die entsprechend des Organismusspezifischen "codon usage" häufig verwendet werden. Dieser "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO: 5, in den Organismus ein.
Bevorzugt verwendet man in vorstehend beschriebener bevorzugter Ausführungsform als ß- Cyclase-Gene Nukleinsäuren, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 8 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70 %, noch bevorzugter mindestens 90 %, am bevorzugtesten mindestens 95 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 8, und die die enzymatische Eigenschaft einer ß-Cyclase aufweisen.
Weitere Beispiele für ß-Cyclasen und ß-Cyclase-Gene lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, wie vorstehend beschrieben durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ ID NO: 8 leicht auffinden.
Weitere Beispiele für ß-Cyclasen und ß-Cyclase-Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ ID NO: 7 aus verschiedenen Organismen, deren genomische Sequenz nicht bekannt ist, durch Hybridisierungs- und PCR-Techniken in an sich bekannter Weise leicht auffinden.
In einer weiter besonders bevorzugten Ausführungsform werden zur Erhöhung der ß-Cyclase- Aktivität Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der ß-Cyclase der Sequenz SEQ. ID. NO: 8.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Poiypeptid- sequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Kodons verwendet, die entsprechend des Organismusspezifischen "codon usage" häufig verwendet werden. Dieser "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO: 7 in den Organismus ein.
Alle vorstehend erwähnten Hydroxylase-Gene oder ß-Cyclase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, Seite 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Besonders bevorzugt werden im erfindungsgemäßen Verfahren genetisch veränderte Organis- men mit folgende Kombinationen genetischer Veränderungen verwendet:
Genetisch veränderte Organismen, die im Vergleich zum Wildtyp eine erhöhte oder verursachte Ketolase-Aktivitat und eine erhöhte Hydroxylase-Aktivität aufweisen,
genetisch veränderte Organismen, die im Vergleich zum Wildtyp eine erhöhte oder verursachte Ketolase-Aktivitat und eine erhöhte ß-Cyclase-Aktivität aufweisen und
genetisch veränderte Organismen, die im Vergleich zum Wildtyp eine erhöhte oder verursachte Ketolase-Aktivitat und eine erhöhte Hydroxylase-Aktivität und eine erhöhte ß-Cyclase-Aktivität aufweisen.
Die Herstellung dieser genetisch veränderten Organismen kann, wie nachstehend beschrieben, beispielsweise durch Einbringen einzelner Nukleinsäurekonstrukte (Expressionskassetten) oder durch Einbringen von Mehrfachkonstrukten erfolgen, die bis zu zwei oder drei der beschriebenen Aktivitäten enthalten.
Unter Organismen werden erfindungsgemäß vorzugsweise Organismen verstanden, die als Wildtyp- oder Ausgangsorganismen natürlicherweise oder durch genetische Komplementierung und/oder Umregulierung der Stoffwechselwege in der Lage sind, Carotinoide, insbesondere ß-
Carotin und/oder Zeaxanthin und/oder Neoxanthin und/oder Violaxanthin und/oder Lutein herzustellen.
Weiter bevorzugte Organismen weisen als Wildtyp- oder Ausgangsorganismen bereits eine Hydroxylase-Aktivität auf und sind somit als Wildtyp- oder Ausgangsorganismen in der Lage, Zeaxanthin herzustellen.
Bevorzugte Organismen sind Pflanzen oder Mikroorganismen, wie beispielsweise Bakterien, Hefen, Algen oder Pilze.
Als Bakterien können sowohl Bakterien verwendet werden, die aufgrund des Einbringens von Genen der Carotinoidbiosynthese eines Carotinoid-produzierenden Organismus in der Lage sind, Xanthophylle zu synthetisieren, wie beispielsweise Bakterien der Gattung Escherichia, die beispielsweise crt-Gene aus Erwinia enthalten, als auch Bakterien, die von sich aus in der Lage sind, Xanthophylle zu synthetisieren wie beispielsweise Bakterien der Gattung Erwinia, Agrobacterium, Flavobactenum, Alcaligenes, Paracoccus, Nostoc oder Cyanobakterien der Gattung Synechocystis.
Bevorzugte Bakterien sind Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobactenum sp. strain R1534, das Cyanobacterium Sy- nechocystis sp. PCC6803, Paracoccus marcusii oder Paracoccus carotinifaciens.
Bevorzugte Hefen sind Candida, Saccharomyces, Hansenula, Pichia oder Phaffia. Besonders bevorzugte Hefen sind Xanthophyllomyces dendrorhous oder Phaffia rhodozyma.
Bevorzugte Pilze sind Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium oder weitere in Indian Chem. Engr. Section B. Vol. 37, No. 1 , 2 (1995) auf Seite 15, Tabelle 6 beschriebene Pilze.
Bevorzugte Algen sind Grünalgen, wie beispielsweise Algen der Gattung Haematococcus,
Phaedactylum tricomatum, Volvox oder Dunaliella. Besonders bevorzugte Algen sind Haematococcus puvialis oder Dunaliella bardawil.
Weitere brauchbare Mikroorganismen und deren Herstellung zur Durchführung des erfindungs- gemäßen Verfahrens sind beispielsweise aus der DE-A-199 16 140 bekannt, worauf hiermit Bezug genommen wird.
Besonders bevorzugte Pflanzen sind Pflanzen ausgewählt aus den Familien Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Bras-
sicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Ge- raniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Astera- ceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, llliaceae oder Lanπiaceae.
Ganz besonders bevorzugte Pflanzen sind ausgewählt aus der Gruppe der Pflanzengattungen Marigold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Di- morphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentlana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenia, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimu- lus, Narcissus, Oenothera, Osmanthus, Petunia, Phoiinia, Physalis, Phyteuma, Potentilla, Pyra- cantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola oder Zinnia, besonders bevorzugt ausgewählt aus der Gruppe der Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum oder Adonis.
Im erfindungsgemäßen Verfahren zur Herstellung von Ketocarotinoiden wird vorzugsweise dem Kultivierungsschritt der genetisch veränderten Organismen ein Ernten der Organismen und weiter bevorzugt zusätzlich ein Isolieren von Ketocarotinoiden aus den Organismen angeschlossen.
Das Ernten der Organismen erfolgt in an sich bekannter Weise dem jeweiligen Organismus entsprechend. Mikroorganismen, wie Bakterien, Hefen, Algen oder Pilze oder Pflanzenzellen, die durch Fermentation in flüßigen Nährmedien kultiviert werden, können beispielsweise durch Zentrifugieren, Dekantieren oder Filtrieren abgetrennt werden. Pflanzen werden in an sich bekannter Weise auf Nährböden gezogen und entsprechend geerntet.
Die Kultivierung der genetisch veränderten Mikroorganismen erfolgt bevorzugt in Gegenwart von Sauerstoff bei einer Kultivierungstemperatur von mindestens etwa20°C, wie z.B. 20°C bis 40 °C, und einem pH-Wert von etwa 6 bis 9. Bei genetisch veränderten Mikroorganismen erfolgt vorzugsweise zunächst die Kultivierung der Mikroorganismen in Gegenwart von Sauerstoff und in einem Komplexmedium, wie z.B. TB- oder LB- Medium bei einer Kultivierungstemperatur von etwa 20 °C oder mehr, und einem pH-Wert von etwa 6 bis 9, bis eine ausreichende Zelldichte erreicht ist. Um die Oxidationsreaktion besser steuern zu können, bevorzugt man die Verwendung eines induzierbaren Promotors. Die Kultivierung wird nach Induktion der Ketolaseexpressi- on in Gegenwart von Sauerstoff, z.B. 12 Stunden bis 3 Tage, fortgesetzt.
Die Isolierung der Ketocarotinoide aus der geernteten Biomasse erfolgt in an sich bekannter Weise, beispielsweise durch Extraktion und gegebenenfalls weiterer chemische oder physikalischer Reinigungsprozesse, wie beispielsweise Fällungsmethoden, Kristallographie, thermische Trennverfahren, wie Rektifizierverfahren oder physikalische Trennverfahren, wie beispielsweise Chromatographie.
Wie nachstehend erwähnt, können die Ketocarotinoide in den erfindungsgemäßen, genetisch veränderten Pflanzen vorzugsweise in verschiedenen Pflanzengeweben, wie beispielsweise Samen, Blätter, Früchte, Blüten, insbesondere in Blütenblättern spezifisch hergestellt werden.
Die Isolierung von Ketocarotinoiden aus den geernteten Blütenblättern erfolgt in an sich bekannter Weise, beispielsweise durch Trocknung und anschließender Extraktion und gegebenenfalls weiterer chemischer oder physikalischer Reinigungsprozesse, wie beispielsweise Fällungsme- thoden, Kristallographie, thermische Trennverfahren, wie Rektifizierverfahren oder physikalische Trennverfahren, wie beispielsweise Chromatographie. Die Isolierung von Ketocarotinoiden aus den Blütenblättern erfolgt beispielsweise bevorzugt durch organische Lösungsmittel wie Aceton, Hexan, Ether oder tert-Methylbutylether.
Weitere Isolierverfahren von Ketocarotinoiden, insbesondere aus Blütenblättern, sind beispielsweise in Egger und Kleinig (Phytochemistry (1967) 6, 437-440) und Egger (Phytochemistry (1965) 4, 609-618) beschrieben.
Vorzugsweise sind die Ketocarotinoide ausgewählt aus der Gruppe Astaxanthin, Canthaxanthin, Echinenon, 3-Hydroxyechinenon, 3'-Hydroxyechinenon, Adonirubin und Adonixanthin.
Ein besonders bevorzugtes Ketocarotinoid ist Astaxanthin.
Je nach verwendetem Organismus fallen die Ketocarotinoide in freier Form oder als Fettsäure- ester an.
In Blütenblättern von Pflanzen fallen die Ketocarotinide im erfindungsgemäßen Verfahren in Form ihrer Mono- oder Diester mit Fettsäuren an. Einige nachgewiesene Fettsäuren sind z.B. Myristinsäure, Palmitinsäure, Stearinsäure, Ölsäure, Linolensäure, und Laurinsäure (Kamata und Simpson (1987) Comp. Biochem. Physiol. Vol. 86B(3), 587-591).
Die Herstellung der Ketocarotinoide kann in der ganzen Pflanze oder in einer bevorzugten Ausführungsform spezifisch in Pflanzengeweben, die Chromoplasten enthalten, erfolgen. Bevorzug-
te Pflanzengewebe sind beispielsweise Wurzeln, Samen, Blätter, Früchte, Blüten und insbesondere Nektarien und Blütenblätter, die auch Petalen bezeichnet werden.
In einer besonderes bevorzugten Ausführungsform der erfindungsgemäßen Verfahrens verwen- det man genetisch veränderte Pflanzen, die in Blüten die höchste Expressionsrate einer Ketolase aufweisen.
Vorzugsweise wird dies dadurch erreicht, dass die Genexpression der Ketolase unter Kontrolle eines blütenspezifischen Promotors erfolgt. Beispielsweise werden dazu die vorstehend be- schriebenen Nukleinsäuren, wie nachstehend ausführlich beschrieben, in einem Nukleinsäure- konstrukt funktionell verknüpft mit einem biütenspezifischen Promotor in die Pflanze eingebracht.
In einer weiteren, besonderes bevorzugten Ausführungsform der erfindungsgemäßen Verfah- rens verwendet man genetisch veränderte Pflanzen, die in Früchten die höchste Expressionsrate einer Ketolase aufweisen.
Vorzugsweise wird dies dadurch erreicht, dass die Genexpression der Ketolase unter Kontrolle eines fruchtspezifischen Promotors erfolgt. Beispielsweise werden dazu die vorstehend be- schriebenen Nukleinsäuren, wie nachstehend ausführlich beschrieben, in einem Nukleinsäure- konstrukt funktionell verknüpft mit einem fruchtspezifischen Promotor in die Pflanze eingebracht.
In einer weiteren, besonderes bevorzugten, Ausführungsform der erfindungsgemäßen Verfahrens verwendet man genetisch veränderte Pflanzen, die in Samen die höchste Expressionsrate einer Ketolase aufweisen.
Vorzugsweise wird dies dadurch erreicht, dass die Genexpression der Ketolase unter Kontrolle eines samenspezifischen Promotors erfolgt. Beispielsweise werden dazu die vorstehend beschriebenen Nukleinsäuren, wie nachstehend ausführlich beschrieben, in einem Nukleinsäure- konstrukt funktionell verknüpft mit einem samenspezifischen Promotor in die Pflanze eingebracht.
Das Targeting in die Chromplasten erfolgt durch ein funktionell verknüpftes plastidäres Transit- peptid.
Im folgenden wird exemplarisch die Herstellung genetisch veränderter Pflanzen mit erhöhter oder verursachter Ketolase-Aktivitat beschrieben. Die Erhöhung weiterer Aktivitäten, wie beispielsweise der Hydroxylase-Aktivität und/oder der ß-Cyclase-Aktivität kann analog unter Verwendung von Nukleinsäuresequenzen, kodierend eine Hydroxylase bzw. ß-Cyclase anstelle von
Nukleinsäuresequenzen, kodierend eine Ketolase, erfolgen. Die Transformation kann bei den Kombinationen von genetischen Veränderungen einzeln oder durch Mehrfachkonstrukte erfolgen.
Die Herstellung der transgenen Pflanzen erfolgt vorzugsweise durch Transformation der Ausgangspflanzen, mit einem Nukleinsäurekonstrukt, das die vorstehend beschriebenen Nukleinsäuren, kodierend eine Ketolase enthält, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Pflanzen gewährleisten.
Diese Nukleinsäurekonstrukte, in denen die kodierende Nukleinsäuresequenz mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Pflanzen gewährleisten, werden im folgenden auch Expressionskassetten genannt.
Vorzugsweise enthalten die Regulationssignale einen oder mehrere Promotoren, die die Transkription und Translation in Pflanzen gewährleisten.
Die Expressionskassetten beinhalten Regulationssignale, also regulative Nukleinsäuresequenzen, welche die Expression der kodierenden Sequenz in der Wirtszelle steuern. Gemäß einer bevorzugten Ausführungsform umfasst eine Expressionskassette stromaufwärts, d.h. am 5'- Ende der kodierenden Sequenz, einen Promotor und stromabwärts, d.h. am 3'-Ende, ein Polya- denylierungssignal und gegebenenfalls weitere regulatorische Elemente, welche mit der dazwischenliegenden kodierenden Sequenz für mindestens eines der vorstehend beschriebenen Gene operativ verknüpft sind. Unter einer operativen Verknüpfung versteht man die sequenzielle Anordnung von Promotor, kodierender Sequenz, Terminator und ggf. weiterer regulativer Ele- mente derart, das jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann.
Im folgenden werden beispielhaft die bevorzugten Nukleinsäurekonstrukte, Expressionskassetten und Vektoren für Pflanzen und Verfahren zur Herstellung von transgenen Pflanzen, sowie die transgenen Pflanzen selbst beschrieben.
Die zur operativen Verknüpfung bevorzugten, aber nicht darauf beschränkten Sequenzen, sind Targeting-Sequenzen zur Gewährleistung der subzellulären Lokalisation im Apoplasten, in der Vakuole, in Piastiden, im Mitochondrium, im Endoplasmatischen Retikulum (ER), im Zellkern, in Ölkörperchen oder anderen Kompartimenten und Translationsverstärkern wie die 5'-
Führungssequenz aus dem Tabak-Mosaik- Virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693 -8711).
Als Promotor der Expressionskassette ist grundsätzlich jeder Promotor geeignet, der die Expression von Fremdgenen in Pflanzen steuern kann.
"Konstitutiver" Promotor meint solche Promotoren, die eine Expression in zahlreichen, bevorzugt allen, Geweben über einen größeren Zeitraum der Pflanzenentwicklung, bevorzugt zu allen Zeitpunkten der Pflanzenentwicklung, gewährleisten.
Vorzugsweise verwendet man insbesondere einen pflanzlichen Promotor oder einen Promotor, der einem Pflanzenvirus entstammt. Insbesondere bevorzugt ist der Promotor des 35S- Transkriptes des CaMV Blumenkohlmosaikvirus (Franck et al. (1980) Cell 21 :285-294; Odell et al. (1985) Nature 313:810-812; Shewmaker et al. (1985) Virology 140:281-288; Gardner et al. (1986) Plant Mol Biol 6:221-228), der 19S CaMV Promotor (US 5,352,605; WO 84/02913; Ben- fey et al. (1989) EMBO J 8:2195-2202), den Triose-Phosphat Translokator (TPT) Promotor aus Arabidopsis thaliana Acc.-No. AB006698 , Basenpaar 53242 bis 55281 ; das Gen beginnend ab bp 55282 ist mit "phosphate/triose-phosphate translocator" annotiert, oder den 34S Promoter aus Figwort mosaic virus Acc.-No. X16673, Basenpaar 1 bis 554.
Ein weiterer geeigneter konstitutiver Promotor ist der pds Promoter (Pecker et al. (1992) Proc. Natl. Acad. Sei USA 89: 4962-4966) oder der "Rubisco small subunit (SSU)"-Promotor (US 4,962,028), der LeguminB-Promotor (GenBank Acc.-Nr. X03677), der Promotor der Nopa- linsynthase aus Agrobacterium, der TR-Doppelpromotor, der OCS (Octopin Synthase) Promotor aus Agrobacterium, der Ubiquitin Promotor (Holtorf S et al. (1995) Plant Mol Biol 29:637-649), der Ubiquitin 1 Promotor (Christensen et al. (1992) Plant Mol Biol 18:675-689; Bruce et al. (1989) Proc Natl Acad Sei USA 86:9692-9696), der Smas Promotor, der Cinnamylalkoholde- hydrogenase-Promotor (US 5,683,439), die Promotoren der vakuolärer ATPase Untereinheiten oder der Promotor eines prolinreichen Proteins aus Weizen (WO 91/13991), der Pnit-Promoter (Y07648.L, Hillebrand et al. (1998), Plant. Mol. Biol. 36, 89-99, Hillebrand et al. (1996), Gene, 170, 197-200) sowie weitere Promotoren von Genen, deren konstitutive Expression in Pflanzen dem Fachmann bekannt ist.
Die Expressionskassetten können auch einen chemisch induzierbaren Promotor enthalten (Ü- bersichtsartikel: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48:89-108), durch den die Expression des Ketolase-Gens in der Pflanze zu einem bestimmten Zeitpunkt gesteuert werden kann. Derartige Promotoren, wie z.B. der PRP1 Promotor (Ward et al. (1993) Plant Mol Biol 22:361-366), ein durch Salicylsäure induzierbarer Promotor (WO 95/19443), ein durch Benzolsulf onamid-induzierbarer Promotor (EP 0388 186), ein durch Tetrazyklin-induzierbarer Promotor (Gatz et al. (1992) Plant J 2:397-404), ein durch Abscisinsäure induzierbarer Promotor (EP 0335 528) bzw. ein durch Ethanol- oder Cyclohexanon-induzierbarer Promotor (WO 93/21334) können ebenfalls verwendet werden.
Ferner sind Promotoren bevorzugt, die durch biotischen oder abiotischen Stress induziert werden wie beispielsweise der pathogen-induzierbare Promotor des PRP1-Gens (Ward et al. (1993) Plant Mol Biol 22:361-366), der hitzeinduzierbare hsp70- oder hsp80-Promoter aus Tomate (US 5,187,267), der kälteinduzierbare alpha-Amylase Promoter aus der Kartoffel (WO 96/12814), der licht-induzierbare PPDK Promotor oder der verwundungsinduzierte pinll-Promoter (EP375091).
Pathogen-induzierbare Promotoren umfassen die von Genen, die infolge eines Pathogenbefalls induziert werden wie beispielsweise Gene von PR-Proteinen, SAR-Proteinen, b-1 ,3-Glucanase,
Chitinase usw. (beispielsweise Redolfi et al. (1983) Neth J Plant Pathol 89:245-254; Uknes, et al. (1992) The Plant Cell4:645-656; Van Loon (1985) Plant Mol Viral 4:111-116; Marineau et al.
(1987) Plant Mol Biol 9:335-342; Matton et al. (1987) Molecular Plant-Microbe Interactions
2:325-342; Somssich et al. (1986) Proc Natl Acad Sei USA 83:2427-2430; Somssich et al. (1988) Mol Gen Genetics 2:93-98; Chen et al. (1996) Plant J 10:955-966; Zhang and Sing
(1994) Proc Natl Acad Sei USA 91:2507-2511; Warner, et al. (1993) Plant J 3:191-201; Siebertz et al. (1989) Plant Cell 1:961-968(1989).
Umfasst sind auch verwundungsinduzierbare Promotoren wie der des pinll-Gens (Ryan (1990) Ann Rev Phytopath 28:425-449; Duan et al. (1996) Nat Biotech 14:494-498), des wuni und wun2-Gens (US 5,428,148), des winl- und win2-Gens (Stanford et al. (1989) Mol Gen Genet 215:200-208), des Systemin-Gens (McGurl et al. (1992) Science 225:1570-1573), des WIP1- Gens (Rohmeier et al. (1993) Plant Mol Biol 22:783-792; Ekelkamp et al. (1993) FEBS Letters 323:73-76), des MPI-Gens (Corderok et al. (1994) The Plant J 6(2):141-150) und dergleichen.
Weitere geeignete Promotoren sind beispielsweise fruchtreifung-spezifische Promotoren, wie beispielsweise der fruchtreifung-spezifische Promotor aus Tomate (WO 94/21794, EP 409625). Entwicklungsabhängige Promotoren schließt zum Teil die gewebespezifischen Promotoren ein, da die Ausbildung einzelner Gewebe naturgemäß entwicklungsabhängig erfolgt.
Weiterhin sind insbesondere solche Promotoren bevorzugt, die die Expression in Geweben oder Pflanzenteilen sicherstellen, in denen beispielsweise die Biosynthese von Ketocarotinoiden bzw. dessen Vorstufen stattfindet. Bevorzugt sind beispielsweise Promotoren mit Spezifitäten für die Antheren, Ovarien, Petalen, Sepalen, Blüten, Blätter, Stengel, Samen und Wurzeln und Kombi- nationen hieraus.
Knollen-, Speicherwurzel- oder Wurzel-spezifische Promotoren sind beispielsweise der Patatin- Promotor Klasse I (B33) oder der Promotor des Cathepsin D Inhibitors aus Kartoffel.
Blattspezifische Promotoren sind beispielsweise der Promotor der cytosolischen FBPase aus Kartoffel (WO 97/05900), der SSU Promotor (small subunit) der Rubisco (Ribulose-1 ,5- bisphosphatcarboxylase) oder der ST-LSI Promotor aus Kartoffel (Stockhaus et al. (1989) EM- BO J 8:2445-2451).
Blütenspezifische Promotoren sind beispielsweise der Phytoen-Synthase Promotor (WO 92/16635) oder der Promotor des P-rr Gens (WO 98/22593), der AP3 Promoter aus Arabi- dopsis thaliana (siehe Beispiel 5), der CHRC-Promoter (Chromoplast-specific carotenoid- associated protein (CHRC) gene promoter aus Cucumis sativus Acc.-No. AF099501, Basenpaar 1 bis 1532), der EPSP_Synthase Promotor (5-enolpyruvylshikimate-3-phosphate synthase gene Promoter aus Petunia hybrida, Acc.-No. M37029, Basenpaar 1 bis 1788), der PDS Promotor (Phytoene desaturase gene promoter aus Solanum lycopersicum, Acc.-No. U46919, Basenpaar 1 bis 2078), der DFR-A Promotor (Dihydroflavonol 4-reductase gene A promoter aus Petunia hybrida, Acc.-No. X79723, Basenpaar 32 bis 1902) oder der FBP1 Promotor (Floral Binding Protein 1 gene promoter aus Petunia hybrida, Acc.-No. L10115, Basenpaar 52 bis 1069).
Antheren-spezifische Promotoren sind beispielsweise der 5126-
Promotor (US 5,689,049, US 5,689,051), der glob-l Promotor oder der g-Zein Promotor.
Samen-spezifische Promotoren sind beispielsweise der ACP05-Promotor (Acyl-carrier-Protein Gen, W09218634), die Promotoren AtS1 und AtS3 von Arabidopsis (WO 9920775), der LeB4- Promotor von Vicia faba (WO 9729200 und US 06403371), der Napin-Promotor von Brassica napus (US 5608152; EP 255378; US 5420034),der SBP-Promotor von Vicia faba (DE 9903432) oder die Maispromotoren End1 und End2 (WO 0011177).
Weitere zur Expression in Pflanzen geeignete Promotoren sind beschrieben in Rogers et al. (1987) Meth in Enzymol 153:253-277; Schardl et al. (1987) Gene 61:1-11 und Berger et al. (1989) Proc Natl Acad Sei USA 86:8402-8406).
Besonders bevorzugt im erfindungsgemäßen Verfahren sind konstitutive, samenspezifische, fruchtspezifische, blütenspezifische und insbesondere blütenblattspezifische Promotoren.
Die vorliegende Erfindung betrifft daher insbesondere ein Nukleinsäurekonstrukt, enthaltend funktionell verknüpft einen blütenspezifischen oder insbesondere einen blütenblattspezifischen Promotor und eine Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO.2 aufweist.
Die Herstellung einer Expressionskassette erfolgt vorzugsweise durch Fusion eines geeigneten Promotors mit einer vorstehend beschriebenen Nukleinsäure, kodierend eine Ketolase, und vorzugsweise einer zwischen Promotor und Nukleinsäure-Sequenz inserierten Nukleinsäure, die für ein plastidenspezifisches Transitpeptid kodiert, sowie einem Polyadenylierungssignal nach gängigen Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in TJ. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987), beschrieben sind.
Die vorzugsweise insertierte Nukleinsäuren, kodierend ein plastidäres Transitpeptid, gewährleisten die Lokalisation in Piastiden und insbesondere in Chromoplasten.
Es können auch Expressionskassetten verwendet werden, deren Nukleinsäure-Sequenz für ein Ketolase-Fusionsprotein kodiert, wobei ein Teil des Fusionsproteins ein Transitpeptid ist, das die Translokation des Polypeptides steuert. Bevorzugt sind für die Chromoplasten spezifische Transitpeptide, welche nach Translokation der Ketolase in die Chromoplasten vom Ketolase- Teil enzymatisch abgespalten werden.
Insbesondere bevorzugt ist das Transitpeptid, das von der plastidären Nicotiana tabacum Transketolase oder einem anderen Transitpeptid (z.B. dem Transitpeptid der kleinen Untereinheit der Rubisco (rbcS) oder der Ferredoxin NADP Oxidoreduktase als auch der Isopentenylpy- rophosphat lsomerase-2) oder dessen funktionellem Äquivalent abgeleitet ist.
Besonders bevorzugt sind Nukleinsäure-Sequenzen von drei Kassetten des Plastiden- Transitpeptids der plastidären Transketolase aus Tabak in drei Leserastern als Kpnl/BamHI Fragmente mit einem ATG-Codon in der Ncol Schnittstelle:
pTP09
KpnLGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTG TCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGCGATTCGTGCCT- CAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGATCC BamHI
pTP10
KpnLGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTG TCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACI I I I I CCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGCGATTCGTGCCT- CAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTGGATCC_BamHI
pTP11
KpnLGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTG TCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT-
CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG-
TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGCGATTCGTGCCT-
CAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGGATCC_BamHI
Weitere Beispiele für ein plastidäres Transitpeptid sind das Transitpeptid der plastidären Isopen- tenyl-pyrophosphat lsomerase-2 (IPP-2) aus Arabisopsis thaliana und das Transitpeptid der kleinen Untereinheit der Ribulosebisphosphat Carboxylase (rbcS) aus Erbse (Guerineau, F, Woolston, S, Brooks, L, Mullineaux, P (1988) An expression cassette fortargeting foreign prote- ins into the chloroplasts. Nucl. Acids Res. 16: 11380).
Die erfindungsgemäßen Nukleinsäuren können synthetisch hergestellt oder natürlich gewonnen sein oder eine Mischung aus synthetischen und natürlichen Nukleinsäure-Bestandteilen enthalten, sowie aus verschiedenen heterologen Genabschnitten verschiedener Organismen bestehen.
Bevorzugt sind, wie vorstehend beschrieben, synthetische Nukleotid-Sequenzen mit Kodons, die von Pflanzen bevorzugt werden. Diese von Pflanzen bevorzugten Kodons können aus Kodons mit der höchsten Proteinhäufigkeit bestimmt werden, die in den meisten interessanten Pflanzenspezies exprimiert werden.
Bei der Präparation einer Expressionskassette können verschiedene DNA-Fragmente manipuliert werden, um eine Nukleotid-Sequenz zu erhalten, die zweckmäßigerweise in der korrekten Richtung liest und die mit einem korrekten Leseraster ausgestattet ist. Für die Verbindung der DNA-Fragmente miteinander können an die Fragmente Adaptoren oder Linker angesetzt wer- den.
Zweckmäßigerweise können die Promotor- und die Terminator-Regionen in Transkriptionsrichtung mit einem Linker oder Polylinker, der eine oder mehrere Restriktionsstellen für die Insertion dieser Sequenz enthält, versehen werden. In der Regel hat der Linker 1 bis 10, meistens 1 bis 8,
vorzugsweise 2 bis 6 Restriktionsstellen. Im allgemeinen hat der Linker innerhalb der regulatorischen Bereiche eine Größe von weniger als 100 bp, häufig weniger als 60 bp, mindestens jedoch 5 bp. Der Promotor kann sowohl nativ bzw. homolog als auch fremdartig bzw. heterolog zur Wirtspflanze sein. Die Expressionskassette beinhaltet vorzugsweise in der 5'-3'- Transkriptionsrichtung den Promotor, eine kodierende Nukleinsäuresequenz oder ein Nuklein- säurekonstrukt und eine Region für die transkriptionale Termination. Verschiedene Terminati- onsbereiche sind gegeneinander beliebig austauschbar.
Beispiele für einen Terminator sind der 35S-Terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), der nos Terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982;1 (6):561-73) oder der ocs Terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers, M, van Montagu, M, Schell, J (1984) The complete sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAchδ. EMBO J. 3: 835-846).
Ferner können Manipulationen, die passende Restriktionsschnittstellen bereitstellen oder die überflüssige DNA oder Restriktionsschnittstellen entfernen, eingesetzt werden. Wo Insertionen, Deletionen oder Substitutionen wie z.B. Transitionen und Transversionen in Frage kommen, können in w'tro-Mutagenese, "primer-repair", Restriktion oder Ligation verwendet werden.
Bei geeigneten Manipulationen, wie z.B. Restriktion, "chewing-back" oder Auffüllen von Überhängen für "bluntends", können komplementäre Enden der Fragmente für die Ligation zur Verfügung gestellt werden.
Bevorzugte Polyadenylierungssignale sind pflanzliche Polyadenylierungssignale, vorzugsweise solche, die im wesentlichen T-DNA-Poiyadenylierungssignale aus Agrobacterium tumefaciens, insbesondere des Gens 3 der T-DNA (Octopin Synthase) des Ti-Plasmids pTiACHδ entsprechen (Gielen et al., EMBO J. 3 (1984), 835 ff) oder funktionelle Äquivalente.
Die Übertragung von Fremdgenen in das Genom einer Pflanze wird als Transformation bezeichnet.
Dazu können an sich bekannte Methoden zur Transformation und Regeneration von Pflanzen aus Pflanzengeweben oder Pflanzenzellen zur transienten oder stabilen Transformation genutzt werden.
Geeignete Methoden zur Transformation von Pflanzen sind die Protoplastentransformation durch Polyethylenglykol-induzierte DNA-Aufnahme, das biolistische Verfahren mit der Genkanone - die sogenannte "particle bombardment" Methode, die Elektroporation, die Inkubation tro-
ckener Embryonen in DNA-haltiger Lösung, die Mikroinjektion und der, vorstehend beschriebene, durch Agrobacterium vermittelte Gentransfer. Die genannten Verfahren sind beispielsweise in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1 , Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press (1993), 128-143 sowie in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225) beschrieben.
Vorzugsweise wird das zu exprimierende Konstrukt in einen Vektor kloniert, der geeignet ist, Agrobacterium tumefaciens zu transformieren, beispielsweise pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) oder besonders bevorzugt pSUN2, pSUN3, pSUN4 oder pSUN5 (WO 02/00900).
Mit einem Expressionsplasmid transformierte Agrobakterien können in bekannter Weise zur Transformation von Pflanzen verwendet werden, z.B. indem verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden.
Zur bevorzugten Herstellung von genetisch veränderten Pflanzen, im folgenden auch transgene Pflanzen bezeichnet, wird die fusionierte Expressionskassette, die eine Ketolase exprimiert, in einen Vektor, beispielsweise pBin19 oder insbesondere pSUN5 und pSUN3 kloniert, der geeignet ist, in Agrobacterium tumefaciens transformiert zu werden. Mit einem solchen Vektor trans- formierte Agrobakterien können dann in bekannter Weise zur Transformation von Pflanzen, insbesondere von Kulturpflanzen verwendet werden, indem beispielsweise verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden.
Die Transformation von Pflanzen durch Agrobakterien ist unter anderem bekannt aus F.F. Whi- te, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1 , Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press, 1993, S. 15-38. Aus den transformierten Zellen der verwundeten Blätter bzw. Blattstücke können in bekannter Weise transgene Pflanzen regeneriert werden, die ein in die Expressionskassette integriertes Gen für die Expression einer Nukleinsäure, kodierend eine Ketolase, enthalten.
Zur Transformation einer Wirtspflanze mit einer für eine Ketolase kodierenden Nukleinsäure wird eine Expressionskassette als Insertion in einen rekombinanten Vektor eingebaut, dessen Vektor-DNA zusätzliche funktioneile Regulationssignale, beispielsweise Sequenzen für Replika- tion oder Integration enthält. Geeignete Vektoren sind unter anderem in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Kap. 6/7, S. 71-119 (1993) beschrieben.
Unter Verwendung der oben zitierten Rekombinations- und Klonierungstechniken können die Expressionskassetten in geeignete Vektoren kloniert werden, die ihre Vermehrung, beispiels-
weise in E. coli, ermöglichen. Geeignete Klonierungsvektoren sind u.a. pJlT117 (Guerineau et al. (1988) Nucl. Acids Res.16 :11380), pBR332, pUC-Serien, M13mp-Serien und pACYC184. Besonders geeignet sind binäre Vektoren, die sowohl in £ coli als auch in Agrobakterien replizieren können.
Im folgenden wird die Herstellung der erfindungsgemäßen gentisch veränderten Mikroorganismen näher beschrieben:
Die vorstehend beschriebenen Nukleinsäuren, kodierend eine Ketolase oder ß-Hydroxylase oder ß-Cyclase sind vorzugsweise in Expressionskonstrukte eingebaut, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen eine für ein erfindungsgemäßes Enzym kodierende Nukleinsäuresequenz; sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte.
Vorzugsweise umfassen solche erfindungsgemäßen Konstrukte 5'-strom aufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz. Unter einer "operativen Verknüpfung" versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulati- ver Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie Translationsverstärker, Enhancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen.
Zusätzlich zu den artifiziellen Regulationssequenzen kann die natürliche Regulationssequenz vor dem eigentlichen Strukturgen noch vorhanden sein. Durch genetische Veränderung kann diese natürliche Regulation gegebenenfalls ausgeschaltet und die Expression der Gene erhöht oder erniedrigt werden. Das Genkonstrukt kann aber auch einfacher aufgebaut sein, das heißt es werden keine zusätzlichen Regulationssignale vor das Strukturgen insertiert und der natürliche Promotor mit seiner Regulation wird nicht entfernt. Statt dessen wird die natürliche Regulationssequenz so mutiert, dass keine Regulation mehr erfolgt und die Genexpression gesteigert oder verringert wird. Die Nukleinsäuresequenzen können in einer oder mehreren Kopien im Genkonstrukt enthalten sein.
Beispiele für brauchbare Promotoren in Mikroorganismen sind: cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, lambda-PR- oder im lambda-PL- Promotor, die vorteilhafterweise in gram-negativen Bakterien Anwendung finden; sowie die
gram-positiven Promotoren amy und SP02 oder die Hefepromotoren ADC1 , MFa , AC, P-60, CYC1, GAPDH. Besonders bevorzugt ist die Verwendung induzierbarer Promotoren, wie z.B. licht- und insbesondere temperaturinduzierbarer Promotoren, wie der PrPrPromotor.
Prinzipiell können alle natürlichen Promotoren mit ihren Regulationssequenzen verwendet werden. Darüber hinaus können auch synthetische Promotoren vorteilhaft verwendet werden.
Die genannten regulatorischen Sequenzen sollen die gezielte Expression der Nukleinsäuresequenzen und die Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorga- nismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Expression positiv beeinflussen und dadurch erhöhen oder erniedrigen. So kann eine Verstärkung der regulato- rischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit den vorstehend beschriebenen Nukleinsäuresequenzen, kodierend eine Ketolase, ß- Hydroxylase oder ß-Cyclase sowie einem Terminator- oder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus vorteilhafterweise in einen wirtsspezifischen Vektor insertiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amster- dam-New York-Oxford, 1985) entnommen werden. Unter Vektoren sind außer Plasmiden auch alle anderen dem Fachmann bekannte Vektoren, wie beispielsweise Phagen, Viren, wie SV40, CMV, Baculovirus und Adenovirus, Transposons, IS-Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA zu verstehen. Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden.
Als Beispiele für geeignete Expressionsvektoren können genannt werden:
Übliche Fusionsexpressionsvektoren, wie pGEX (Pharmacia Biotech Ine; Smith, D.B. und Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) und pRIT 5 (Pharmacia, Piscataway, NJ), bei denen GIutathion-S-Transferase (GST), Maltose E-bindendes Protein bzw. Protein A an das rekombinante Zielprotein fusioniert wird.
Nicht-Fusionsprotein-Expressionsvektoren wie pTrc (Amann et al., (1988) Gene 69:301-315) und pET 11d (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Aca- demic Press, San Diego, Kalifornien (1990) 60-89) oder pBluescript und pUC- Vektoren.
Hefe-Expressionsvektor zur Expression in der Hefe S. cerevisiae , wie pYepSed (Baldari et al., (1987) Embo J. 6:229-234), pMFa (Kurjan und Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123) sowie pYES2 (Invitrogen Corporation, San Diego, CA).
Vektoren und Verfahren zur Konstruktion von Vektoren, die sich zur Verwendung in anderen Pilzen, wie filamentösen Pilzen, eignen, umfassen diejenigen, die eingehend beschrieben sind in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector develop- ment for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Hrsg., S. 1-28, Cambridge University Press: Cambridge.
Baculovirus-Vektoren, die zur Expression von Proteinen in gezüchteten Insektenzellen (bspw. Sf9-Zellen) verfügbar sind, umfassen die pAc-Reihe (Smith et al., (1983) Mol. Cell Biol.. 3:2156- 2165) und die pVL-Reihe (Lucklow und Summers (1989) Virology 170:31-39).
Weitere geeignete Expressionssysteme für prokaryontische und eukaryotische Zellen sind in Kapitel 16 und 17 von Sambrook, J., Fritsch, E.F. und Maniatis, T., Molecular cloning: A Laboratory Manual, 2. Auflage, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 beschrieben.
Mit Hilfe der erfindungsgemäßen Expressionskonstrukte bzw. Vektoren sind genetisch veränderte Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem erfindungsgemäßen Vektor transformiert sind.
Vorteilhafterweise werden die oben beschriebenen erfindungsgemäßen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfektion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Ex-
pression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F. Ausubel et al., Hrsg., Wiley Interscience, New York 1997, beschrieben.
Die Selektion erfolgreich transformierter Organismen kann durch Markergene erfolgen, die e- benfalls im Vektor oder in der Expressionskassette enthalten sind. Beispiele für solche Markergene sind Gene für Antibiotikaresistenz und für Enzyme, die eine farbgebende Reaktion katalysieren, die ein Anfärben der transformierten Zelle bewirkt. Diese können dann mittels automatischer Zellsortierung selektiert werden.
Erfolgreich mit einem Vektor transformierte Mikroorganismen, die ein entsprechendes Antibioti- karesistenzgen (z.B. G418 oder Hygromycin) tragen, lassen sich durch entsprechende Antibioti- ka-enthaltende Medien oder Nährböden selektieren. Markerproteine, die an der Zelloberfläche präsentiert werden, können zur Selektion mittels Affinitätschromatographie genutzt werden.
Die Kombination aus den Wirtsorganismen und den zu den Organismen passenden Vektoren, wie Plasmide, Viren oder Phagen, wie beispielsweise Plasmide mit dem RNA- Polymerase/Promoter-System, die Phagen 8 oder andere temperente Phagen oder Transpo- sons und/oder weiteren vorteilhaften regulatorischen Sequenzen bildet ein Expressionssystem.
Die Erfindung betrifft ferner ein Verfahren zur Herstellung von genetisch veränderten Organismen, dadurch gekennzeichnet, das man ein Nukleinsäurekonstrukt, enthaltend funktionell verknüpft einen Promotor und Nukleinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Amino- säureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, und gegebenenfalls einen Terminator in das Genom des Ausgangsorganismus oder extrachromosomal in den Ausgangsorganismus einführt.
Die Erfindung betrifft ferner die genetisch veränderten Organismen, wobei die genetische Ver- änderung die Aktivität einer Ketolase
A für den Fall, dass der Wildtyporganismus bereits eine Ketolase-Aktivitat aufweist, gegenüber dem Wildtyp erhöht und
B für den Fall, dass der Wildtyporganismus keine Ketolase-Aktivitätaufweist, gegenüber dem Wildtyp verursacht
und die nach A erhöhte oder nach B verursachte Ketolase-Aktivitat durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz
durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
Wie vorstehend ausgeführt erfolgt die Erhöhung oder Verursachung der Ketolase-Aktivitat ge- genüber dem Wildtyp vorzugsweise durch eine Erhöhung oder Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In einer weiter bevorzugten Ausführungsform erfolgt, wie vorstehend ausgeführt, die Erhöhung oder Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, durch Einbringen von Nukleinsäuren, kodierend eine Ketolase, in die Pflanzen und damit vorzugsweise durch Überexpression oder transgene Expression von Nukleinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
Die Erfindung betrifft ferner einen genetisch veränderten Organismus, enthaltend mindestens eine transgene Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist. Dies ist der Fall, wenn der Ausgangsorganismus keine Ketolase oder eine endogen Ketolase aufweist und eine transgene Ketolase überexpri- miert wird.
Die Erfindung betrifft ferner einen genetisch veränderten Organismus, enthaltend mindestens zwei endogene Nukleinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist. Dies ist der Fall, wenn der Ausgangsorganismus eine endogen Ketolase aufweist und die endogene Ketolase überexprimiert wird.
Besonders bevorzugte, genetisch veränderte Organismen weisen, wie vorstehend erwähnt, zusätzlich eine erhöhte Hydroxlase-Aktivität und/oder ß-Cyclase-Aktivität gegenüber einem Wildtyporganismus auf. Weiter bevorzugte Ausführungsformen sind vorstehend im erfindungsgemäßen Verfahren beschrieben.
Unter Organismen werden erfindungsgemäß vorzugsweise Organismen verstanden, die als Wildtyp- oder Ausgangsorganismen natürlicherweise oder durch genetische Komplementierung und/oder Umregulierung der Stoffwechselwege in der Lage sind, Carotinoide, insbesondere ß- Carotin und/oder Zeaxanthin und/oder Neoxanthin und/oder Violaxanthin und/oder Lutein herzu- stellen.
Weiter bevorzugte Organismen weisen als Wildtyp- oder Ausgangsorganismen bereits eine Hydroxylase-Aktivität auf und sind somit als Wildtyp- oder Ausgangsorganismen in der Lage, Zeaxanthin herzustellen.
Bevorzugte Organismen sind Pflanzen oder Mikroorganismen, wie beispielsweise Bakterien, Hefen, Algen oder Pilze.
Als Bakterien können sowohl Bakterien verwendet werden, die aufgrund des Einbringens von Genen der Carotinoidbiosynthese eines Carotinoid-produzierenden Organismus in der Lage sind, Xanthophylle zu synthetisieren, wie beispielsweise Bakterien der Gattung Escherichia, die beispielsweise crt-Gene aus Erwinia enthalten, als auch Bakterien, die von sich aus in der Lage sind, Xanthophylle zu synthetisieren wie beispielsweise Bakterien der Gattung Erwinia, Agrobacterium, Flavobactenum, Alcaligenes, Paracoccus, Nostoc oder Cyanobakterien der Gattung Synechocystis.
Bevorzugte Bakterien sind Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobactenum sp. strain R1534, das Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii oder Paracoccus carotinifaciens.
Bevorzugte Hefen sind Candida, Saccharomyces, Hansenula, Pichia oder Phaffia. Besonders bevorzugte Hefen sind Xanthophyllomyces dendrorhous oder Phaffia rhodozyma.
Bevorzugte Pilze sind Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium oder weitere in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) auf Seite 15, Tabelle 6 beschriebene Pilze.
Bevorzugte Algen sind Grünalgen, wie beispielsweise Algen der Gattung Haematococcus, Phaedactylum tricornatum, Volvox oder Dunaliella. Besonders bevorzugte Algen sind Haemato- coccus puvialis oder Dunaliella bardawil.
Weitere brauchbare Mikroorganismen und deren Herstellung zur Durchführung des erfindungsgemäßen Verfahrens sind beispielsweise aus der DE-A-199 16 140 bekannt, worauf hiermit Bezug genommen wird.
Besonders bevorzugte Pflanzen sind Pflanzen ausgewählt aus den Familien Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Bras- sicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Ge- raniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Astera- ceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, llliaceae oder Lamiaceae.
Ganz besonders bevorzugte Pflanzen sind ausgewählt aus der Gruppe der Pflanzengattungen Marigold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Di- morphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentlana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenia, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimu- lus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyra- cantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola oder Zinnia, besonders bevorzugt ausgewählt aus der Gruppe der Pflanzengattungen Ma- rigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum oder Adonis.
Ganz besonders bevorzugte genetisch veränderte Pflanzen sind ausgewählt aus den Pf lanzen- gattungen Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium oder Tropaeolum, wobei die genetisch veränderte Pflanze mindestens eine transgene Nukleinsäure, kodierend eine Ketolase, enthält.
Die transgenen Pflanzen, deren Vermehrungsgut, sowie deren Pflanzenzellen, -gewebe oder - teile, insbesondere deren Früchte, Samen, Blüten und Blütenblätter sind ein weiterer Gegenstand der vorliegenden Erfindung.
Die genetisch veränderten Pflanzen können, wie vorstehend beschrieben, zur Herstellung von Ketocarotinoiden, insbesondere Astaxanthin verwendet werden.
Von Menschen und Tieren verzehrbare erfindungsgemäße, genetisch veränderte Organismen, insbesondere Pflanzen oder Pflanzenteile, wie insbesondere Blütenblätter mit erhöhtem Gehalt an Ketocarotinoiden, insbesondere Astaxanthin können auch beispielsweise direkt oder nach
an sich bekannter Prozessierung als Nahrungsmittel oder Futtermittel oder als Futter- und Nah- rungsergänzungsmittel verwendet werden.
Ferner können die genetisch veränderten Organismen zur Herstellung von Ketocarotinoid- haltigen Extrakten der Organismen und/oder zur Herstellung von Futter- und Nahrungsergän- zungsmitteln verwendet werden.
Die genetisch veränderten Organismen weisen im Vergleich zum Wildtyp einen erhöhten Gehalt an Ketocarotinoiden auf.
Unter einem erhöhten Gehalt an Ketocarotinoiden wird in der Regel ein erhöhter Gehalt an Ge- samt-Ketocarotinoid verstanden.
Unter einem erhöhten Gehalt an Ketocarotinoiden wird aber auch insbesondere ein veränderter Gehalt der bevorzugten Ketocarotinoide verstanden, ohne dass zwangsläufig der Gesamt- Carotinoidgehalt erhöht sein muss.
In einer besonders bevorzugten Ausführungsform weisen die erfindungsgemäßen, genetisch veränderten Pflanzen im Vergleich zum Wildtyp einen erhöhten Gehalt an Astaxanthin auf.
Unter einem erhöhten Gehalt wird in diesem Fall auch ein verursachter Gehalt an Ketocarotinoiden, bzw. Astaxanthin verstanden.
Die Erfindung betrifft ferner die neuen Ketolasen sowie die neuen Nukleinsäuren, die diese kodieren.
Insbesondere betrifft die Erfindung Ketolasen, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 2 nicht enthalten ist. Die Sequenz SEQ ID NO: 2 ist, wie vorstehend erwähnt, als putatives Protein in Datenbanken annotiert.
Ferner betrifft die Erfindung Ketolasen, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz
SEQ. ID. NO. 4 aufweist. Die Sequenz SEQ ID NO: 4 ist, wie vorstehend erwähnt, in Datenbanken nicht annotiert.
Die Erfindung betrifft ferner Nukleinsäuren, kodierend ein vorstehend beschriebenes Protein, mit der Maßgabe, dass die Nukleinsäure nicht die Sequenzen SEQ ID NO: 1 oder 3 enthält.
Überraschenderweise wurde gefunden, dass ein Protein enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise min- destens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 und die Eigenschaft einer Ketolase aufweist, eine Eigenschaft als Ketolase aufweist.
Die Erfindung betrifft daher auch die Verwendung eines Proteins, enthaltend die Aminosäurese- quenz SEQ. ID. NO.2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
Ferner wurde überraschenderweise gefunden, dass ein Protein enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 65%, vorzugsweise mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, be- vorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf
Aminosäureebene mit der Sequenz SEQ. ID. NO. 4 und die Eigenschaft einer Ketolase aufweist, eine Egenschaft als Ketolase aufweist.
Die Erfindung betrifft daher auch die Verwendung eines Proteins, enthaltend die Aminosäurese- quenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 65%, vorzugsweise mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95%auf A- minosäureebene mit der Sequenz SEQ. ID. NO. 4 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
Im Vergleich zu den Verfahren des Standes der Technik, liefert das erfindungsgemäße Verfahren eine höhere Menge an Ketocarotinoide, insbesondere Astaxanthin.
Die Erfindung wird durch die nun folgenden Beispiele erläutert, ist aber nicht auf diese beschränkt:
Beispiel 1 : Amplifikation von cDNA, die die gesamte Primärsequenz der Ketolasen aus Nostoc punctiforme PCC73102 ORF 38, contig 501 (SEQ ID NO: 1) und ORF 148, contig 502 (SEQ ID NO: 3) kodiert
Zellen von Nostoc punctiforme wurden mit Lysozym (2 mg/ml) aufgeschlossen und die genomi- sehe DNA mit Hilfe des GenElute Plant genomic DNA kit (Sigma) nach Angaben des Herstellers isoliert.
Dann erfolgte die Amplifikation von ORF148 (762 bp) aus der genomischen DNA von Nostoc punctiforme mit Hilfe der Primer 148-Start (SEQ ID NO: 9; 5' ATG ATC CAG TTA GAA CAA CCA C -3') und 148-End ( SEQ ID NO: 10; 5' CTA TTT TGC TTT GTA AAT TTC TGG -3') bei einer AnnaelingTemperatur von 60°C über 30 Zyklen.
Zur Amplifizierung von ORF38 (789 bp) wurden die Primer 38-Start (SEQ ID NO: 11 ; 5' ATG AAT TTT TGT GAT AAA CCA GTT AG -3') und 38-End (SEQ ID NO: 12; 5' ACG AAT TGG TTA CTG AAT TGT TG -3') verwendet.
Die PCR Fragmente wurden in den mit Xcm\ geschnittenen Vektor pMON 38201 (Borokov, A.Y. and Rivkin, M.l. (1997) Xcml containing vectorfor direct cloning of per produets. BioTech.22, 812-814) subkloniert.
Zur Selektion positiver Klone wurde nach der Transformation der Ligationsprodukte in XI1 blue MRF1 ' ein blau-weiss screening durchgeführt. Die isolierte Plasmid-DNA wurde mit H/ndlll geschnitten, um zu überprüfen ob das PCR Amplifikat in den T-Überhangvektor kloniert wurde. Die Sequenzierung der ausgewählten Klone zeigte, dass die Orientierung von ORF148 in pMONT- 148, bzw. ORF38 in pMONT-38, entgegen der vektoriellen Leserichtung ist. Das Herausschneiden des Inserts durch Hindill war möglich, da der T-Überhang Vektor neben der Hindlll Schnittstelle im Polylinker noch eine zweite besitzt, die beim Einfügen des Polylinkers entstanden ist.
Beispiel 2 Herstellung von Expressionsvektoren zur Expression der Nostoc punctiforme PCC73102 Ketolasen ORF148 und ORF38 in Wirtsorganismen.
Nach Restriktionsverdau von pMONT148 bzw. pMONT38 mit H/πdlll wurden die erhaltenen DNA-Inserts in einen ebenfalls Hind W verdauten und dephosphorylierten pPQE32 Vektor (Qia-
gen, Hilden; modifiziert wie in (Verdoes, J., Krubasik, P., Sandmann, G. & van Ooyen, M. (1999) Isolation and f unctional characterisation of a novel type of carotenoid biosynthetic gene from Xanthophyllomyces dendrorhous. Molec. Gen. Genet. 262, 453-461) beschrieben kloniert.
Die nach Transformation in XL1 MRF1 ' erhaltenen Klone wurden mit Hilfe einer check PCR unter Verwendung von Primer QEF (5' CCC TTT CCT CTT CTC -3') und 148-end bzw. 38-end überprüft. Die Sequenzierungen der entsprechenden Klone zeigte, dass ORF148 und ORF38 in frame in den pPQE32 Vektor kloniert wurden. Die so erhaltenen Plasmide sind in Abbildung 2B und 2C dargestellt. Abbildung 2 zeigt die Konstruktion von pPQE32-ORF 148 (B.) und pPQE32- ORF 38 (C.) ausgehend von pPQE32 (A.).
Beispiel 3
Expression der Nostoc punctiforme PCC73102 Ketolasen ORF148 und ORF38 in ß-Carotin und Zeaxanthin produzierenden £ coli Stämme und Analyse des Carotinoidprofils
3.1. Expression der Nostoc punctiforme PCC73102 Ketolasen ORF148 und ORF38 in ß-Carotin produzierenden £ coli Stämme
Zur funktioneilen Charakterisierung der durch ORF148 und ORF38 gebildeten Genprodukte wurden die Konstrukte pPQE32-148 und pPQE32-38 in die ß-Carotin bildende E.coli Transfor- mande JM101 /pACCAR16ΔcrtX [Misawa, N., Satomi, Y., Kondo, K., Yokoyama, A., Kajiwara, S., Saito, T. Ohtani, T. & Miki, W. (1995) Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene düster and astaxanthin biosynthetic pathway proposed at the gene level. J. Bacteriol. 22, 6575-6584) transformiert.
Die Anzucht der Transformanden erfolgte in 50 ml Kulturen mit LB Medium bei 28°C im Dunkeln für 16 bis 48 Stunden. Die Carotinoide wurden mit Methanol extrahiert, gegen 50% E- ther/Petrolether ausgeschüttelt und die erhaltenen Extrakte über HPLC (Säule HypurityC18, Laufmittel: Acetonitril/Methanol/2-Propanol 85:10:5, Temperatur 32°C) aufgetrennt. Die Spektren wurden mittels eines Dioden-Array Detektors on-line aufgezeichnet und die Carotinoide anhand ihrere Absorptionsmaxim a sowie im Vergleich mit Standards identifiziert.
Wie in Abbildung 3Afür pPQE32-38 und 3B für pPQE32-148 gezeigt, konnten neben dem Ausgangssubstrat ß-Carotin in beiden Extrakten die Ketocarotinoide Echinenon und Canthaxanthin detektiert werden (in Kontrollen ohne pPQE32-38 bzw. pPQE32-148 war nur ß-Carotin aber keine Ketocarotinoide zu finden).
Der Anteil des gebildeten Canthaxanthins (Diketo-Verbindung) am Gesamtcarotinoidgehalt betrug in der Komplementierung mit pPQE32-148 81%, in der Komplementierung mit pPQE32-38
lag er bei 40%. Der Anteil an Echinenon (Monoketo- Verbindung) lag in beiden Komplementierungen bei etwa 4%.
3.2. Expression der Nostoc punctiforme PCC73102 Ketolasen ORF148 und ORF38 in Zea- xanthin produzierenden £ coli Stämme
Um zu untersuchen in wie weit die durch ORF148 und ORF38 kodierten Ketolasen in der Lage sind das Ketocarotinoid Astaxanthin zu synthetisieren, wurden pPQE32-38 (Abb. 3C) und pPQE32-148 (Abb. 3D) in die Zeaxanthin bildende £ coli Transform ande JM101/pACCAR25ΔcrtX (Misawa, N., Satomi, Y., Kondo, K., Yokoyama, A., Kajiwara, S., Saito, T. Ohtani, T. & Miki, W. (1995) Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene düster and astaxanthin biosynthetic pathway proposed at the gene level. J. Bacteriol. 22, 6575-6584)transformiert.
Die Anzucht der Transformanden, die Carotinoidextraktion und die HPLC Trennung erfolgte wie oben unter 3.1 beschrieben. Während in dem aus der Komplementierung mit pPQE32-38 erhaltenen Extrakt nur die Ausgangssubstrate Zeaxanthin und ß-Carotin, 85 bzw. 5% des Gesamtca- rotinoidgehalts, nachgewiesen werden konnten, konnten in der Komplementierung mit pPQE32- 148 hauptsächlich die Ketocarotinoide Echinenon, Canthaxanthin und Astaxanthin detektiert werden. Der Anteil von Astaxanthin am Gesamtcarotinoidgehalt beträgt 50%. Die Intermediate der Astaxanthinsynthese Echinenon und Canthaxanthin stellen 12% bzw. 8% des Gesamtcaro- tinoids dar. Der Anteil an ß-Carotin beträgt etwa 30%.
Abbildung 3 zeigt die HPLC Trennung der Carotinoide aus Komplementierung in E. coli mit ei- nem ß-Carotin Hintergrund kotransformiert mit pPQE32-38 (A) oder pPQE32-148 (B) bzw. in E. coli mit einem Zeaxanthin Hintergrund kotransformiert mit pPQE32-38 (C) oder pPQE32-148 (D).
Die angegebenen Carotinoide wurden durch Kochromatographie mit Vergleichssubstanzen und über ihre Spektren identifiziert als:
1 Canthaxanthin,
2 Echinenon,
3 ß-Carotin,
4 Zeaxanthin, 5 Astaxanthin,
6 ß-Cryptoxanthin,
7 Neurosporin.
1', 3', 4' und 5' bezeichnen die entsprechenden eis Isomere.
Claims
1. Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen, die im Vergleich zum Wildtyp eine veränderte Ketolase-Aktivitat aufwei- sen, und die veränderte Ketolase-Aktivitat durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
2. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass man Organismen verwendet, die als Wildtyp bereits eine Ketolase-Aktivitat aufweisen, und die genetische Veränderung eine Erhöhung der Ketolase-Aktivitat im Vergleich zum Wildtyp bewirkt.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass man zur Erhöhung der Ketola- se-Aktivität die Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die
Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, gegenüber dem Wildtyp erhöht.
4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression Nukleinsäuren in den Organismus einbringt, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von" mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
5. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass man Organismen verwendet, die als Wildtyp keine Ketolase-Aktivitat aufweisen und die genetische Veränderung eine Ketolase-Aktivitat im Vergleich zum Wildtyp verursacht.
6. Verfahren nach Anspruch 5, dadurch gekennzeichnet, dass man genetisch veränderte Organismen verwendet, die transgen eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Amino- säureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, exprimieren.
7. Verfahren nach Anspruch 5 oder 6, dadurch gekennzeichnet, dass man zur Verursachung der Genexpression Nukleinsäuren in die Organismen einbringt, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
8. Verfahren nach Anspruch 5 oder 7, dadurch gekennzeichnet, dass man Nukleinsäuren, enthaltend die Sequenz SEQ. ID. NO. 1 einbringt.
9. Verfahren nach einem der Ansprüche 1 bis 8, dadurch gekennzeichnet, dass die Organismen zusätzlich gegenüber dem Wildtyp eine erhöhte Aktivität mindestens einer der Aktivitä- ten, ausgewählt aus der Gruppe Hydroxylase-Aktivität und ß-Cyclase-Aktivität, aufweisen.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass man zur zusätzlichen Erhöhung mindestens einer der Aktivitäten, die Genexpression mindestens einer Nukleinsäure ausgewählt aus der Gruppe Nukleinsäuren, kodierend eine Hydroxylase, und Nukleinsäuren, kodierend eine ß-Cyclase, gegenüber dem Wildtyp erhöht.
11. Verfahren nach Anspruch 10, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression mindestens eine Nukleinsäure ausgewählt aus der Gruppe, Nukleinsäuren kodierend eine Hydroxylase und Nukleinsäuren kodierend eine ß-Cyclase in den Organismus einbringt.
12. Verfahren nach Anspruch 11, dadurch gekennzeichnet, dass man als Nukleinsäure, kodierend eine Hydroxylase, Nukleinsäuren einbringt, die eine Hydroxylase kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 6 aufweist.
13. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass man Nukleinsäuren, enthaltend die Sequenz SEQ ID NO: 5 einbringt.
14. Verfahren nach Anspruch 11, dadurch gekennzeichnet, dass man als Nukleinsäure, kodierend eine ß-Cyclase, Nukleinsäuren einbringt, die eine ß-Cyclase kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 8 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 8 aufweist.
15. Verfahren nach Anspruch 14, dadurch gekennzeichnet, dass man Nukleinsäuren, enthaltend die Sequenz SEQ ID NO: 7 einbringt.
16. Verfahren nach einem der Ansprüche 1 bis 15, dadurch gekennzeichnet, dass man nach dem Kultivieren die genetisch veränderten Organismen erntet und anschließend die Ketocarotinoide aus den Organismen isoliert.
17. Verfahren nach einem der Ansprüche 1 bis 16, dadurch gekennzeichnet daß man als Organismus einen Organismus verwendet, der als Ausgangsorganismus natürlicherweise o- der durch genetische Komplementierung oder Umregulierung von Stoffwecheselwegen in der Lage ist, Carotinoide herzustellen.
18. Verfahren nach einem der Ansprüche 1 bis 17, dadurch gekennzeichnet, daß man als Organismen Mikroorganismen oder Pflanzen verwendet.
19. Verfahren nach Anspruch 18, dadurch gekennzeichnet, daß man als Mikroorganismen Bakterien, Hefen, Algen oder Pilze verwendet.
20. Verfahren nach Anspruch 19, dadurchgekennzeichnet, daß die Mikroorganismen ausgwählt sind aus der Gruppe Escherichia, Erwinia, Agrobacterium, Flavobactenum, Alcaligenes, Paracoccus, Nostoc, Cyanobakterien der Gattung Synechocystis, Candida, Saccharomyces, Hansenula, Phaffia, Pichia, Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phy- comyces, Fusarium, Haematococcus, Phaedactylum tricornatum, Volvox oder Dunaliella.
21. Verfahren nach Anspruch 18, dadurch gekennzeichnet, daß man als Organismus Pflanzen verwendet.
22. Verfahren nach Anspruch 21 , dadurch gekennzeichnet, dass man als Pflanze eine Pflanze, ausgewählt aus den Familien Ranunculaceae, Berberidaceae, Papaveraceae, Cannaba- ceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryilidaceae, Po- aceae, Orchidaceae, Malvaceae, liliaceae oder Lamiaceae verwendet.
23. Verfahren nach Anspruch 22, dadurch gekennzeichnet, dass man als Pflanze eine Pflanze, ausgewählt aus den Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Cam- panula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbi- ta, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, For- sythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Labumum, Lathyrus, Leontodon, Lilium, Li- num, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola oder i Zinnia verwendet.
24. Verfahren nach einem der Ansprüche 1 bis 23, dadurch gekennzeichnet, dass die Ketocarotinoide ausgewählt sind aus der Gruppe Astaxanthin, Canthaxanthin, Echinenon, 3-Hydroxyechinenon, 3'-Hydroxyechinenon, Adonirubin und Adonixanthin.
25. Genetisch veränderter Organismus, wobei die genetische Veränderung die Aktivität einer Ketolase
A für den Fall, dass der Wildtyporganismus bereits eine Ketolase-Aktivitat aufweist, gegen- über dem Wildtyp erhöht und
B für den Fall, dass der Wildtyporganismus keine Ketolase-Aktivitätaufweist, gegenüber dem Wildtyp verursacht
und die nach A erhöhte oder nach B verursachte Ketolase-Aktivitat durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
26. Genetisch veränderter Organismus nach Anspruch 25, dadurch gekennzeichnet, dass die Erhöhung oder Verursachung der Ketolase-Aktivitat durch eine Erhöhung oder Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die A- minosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Inser- tion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens
42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, gegenüber dem Wildtyp bewirkt wird.
27. Genetisch veränderter Organismuse nach Anspruch 26, dadurch gekennzeichnet, dass man zur Erhöhung oder Verursachung der Genexpression Nukleinsäuren in den Organismus einbringt, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
28. Genetisch veränderter Organismus, enthaltend mindestens eine transgene Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete
Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
29. Genetisch veränderter Organismus, enthaltend mindestens zwei endogene Nukleinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO.2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
30. Genetisch veränderter Organismus nach einem der Ansprüche 25 bis 29, dadurch gekennzeichnet, dass die genetische Veränderung zusätzlich mindestens eine der Aktivitäten, ausgewählt aus der Gruppe Hydroxlase-Aktivität und ß-Cyclase-Aktivität gegenüber dem Wild- typp erhöht.
31. Genetisch veränderter Organismus nach einem der Ansprüche 25 bis 30, dadurch gekennzeichnet daß er als Ausgangsorganismus natürlicherweise oder durch genetische Komplementierung in der Lage ist, Carotinoide herzustellen.
32. Genetisch veränderter Organismus nach einem der Ansprüche 25 bis 31 , ausgewählt aus der Gruppe Mikroorganismen oder Pflanzen.
33. Genetisch veränderter Mikroorganismus nach Anspruch 32, dadurch gekennzeichnet, daß die Mikroorganismen ausgewählt sind aus der Gruppe Bakterien, Hefen, Algen oder Pilze.
34. Genetisch veränderter Mikroorganismus nach Anspruch 33, dadurch gekennzeichnet, daß die Mikroorganismen ausgwählt sind aus der Gruppe Escherichia, Erwinia, Agrobacterium, Flavobactenum, Alcaligenes, Paracoccus, Nostoc, Cyanobakterien der Gattung Synechocystis, Candida, Saccharomyces, Hansenula, Pichia, Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium, Haematococcus, Phaedactylum tricorna- turn, Volvoxoύex Dunaliella.
35. Genetisch veränderte Pflanze nach Anspruch 32, dadurch gekennzeichnet, dass die Pflanzen ausgewählt sind aus den Familien Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitaceae, Pri- mulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amarylli- daceae, Poaceae, Orchidaceae, Malvaceae, liliaceae oder Lamiaceae verwendet.
36. Genetisch veränderte Pflanze nach Anspruch 35, dadurch gekennzeichnet, dass Pflanzen ausgewählt sind aus den Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, A- cacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Esch- scholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Labumum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimuius, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, U- lex, Viola oder Zinnia verwendet.
37. Verwendung der genetisch veränderten Organismen nach einem der Ansprüche 25 bis 36 als Futter- oder Nahrungsmittel.
38. Verwendung der genetisch veränderten Organismen nach einem der Ansprüche 25 bis 36 zur Herstellung von Ketocarotinoid-haltigen Extrakten oder zur Herstellung von Futter- und Nahrungsergänzungsmittel.
39. Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO.2 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO. 2 nicht ent- halten ist.
40. Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 4 aufweist.
41. Nukleinsäure, kodierend ein Protein gemäß 39 oder 40, mit der Maßgabe, dass die Sequenz SEQ ID NO: 1 und SEQ ID NO: 3 nicht enthalten sind.
42. Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
43. Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 65 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 4 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10300649 | 2003-01-09 | ||
| DE10300649A DE10300649A1 (de) | 2003-01-09 | 2003-01-09 | Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen |
| PCT/EP2003/014876 WO2004063366A1 (de) | 2003-01-09 | 2003-12-24 | Verfahren zur herstellung von ketocarotinoiden durch kultivierung von genetisch veränderten organismen |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1585813A1 true EP1585813A1 (de) | 2005-10-19 |
Family
ID=32519809
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03789415A Withdrawn EP1585813A1 (de) | 2003-01-09 | 2003-12-24 | Verfahren zur herstellung von ketocarotinoiden durch kultivierung von genetisch veränderten organismen |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US20060053513A1 (de) |
| EP (1) | EP1585813A1 (de) |
| JP (1) | JP2006512914A (de) |
| KR (1) | KR20050095604A (de) |
| CN (3) | CN1735686A (de) |
| AU (1) | AU2003294001A1 (de) |
| CA (1) | CA2512151A1 (de) |
| DE (1) | DE10300649A1 (de) |
| MX (1) | MXPA05007372A (de) |
| NO (1) | NO20053206L (de) |
| RU (1) | RU2005125263A (de) |
| WO (1) | WO2004063366A1 (de) |
| ZA (1) | ZA200506324B (de) |
Families Citing this family (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE484198T1 (de) * | 2002-08-20 | 2010-10-15 | Sungene Gmbh & Co Kgaa | Verwendung von astaxanthinhaltigen pflanzen oder pflanzenteilen der gattung tagetes als futtermittel |
| KR20050092739A (ko) * | 2003-01-09 | 2005-09-22 | 바스프 악티엔게젤샤프트 | 유전자 변형된 블라케슬레아 속 유기체를 이용한카로티노이드 또는 그의 전구체의 생산 방법, 이 방법에의해 생산된 카로티노이드 또는 그의 전구체, 및 이들의용도 |
| DE102004007622A1 (de) * | 2004-02-17 | 2005-08-25 | Sungene Gmbh & Co. Kgaa | Verfahren zur Herstellung von Ketocarotinoiden in genetisch veränderten, nicht-humanen Organismen |
| CN103589650A (zh) | 2005-03-18 | 2014-02-19 | 米克罗比亚公司 | 产油酵母和真菌中类胡萝卜素的产生 |
| WO2008042338A2 (en) | 2006-09-28 | 2008-04-10 | Microbia, Inc. | Production of carotenoids in oleaginous yeast and fungi |
| JP5706056B2 (ja) * | 2006-10-17 | 2015-04-22 | Jx日鉱日石エネルギー株式会社 | サケ類の肉色改善方法 |
| ES2330602B1 (es) * | 2008-03-19 | 2010-09-30 | Vitatene, S.A | Metodo de produccion de fitoeno y/o fitoflueno, o mezclas de carotenoides con alto contenido en los mismos. |
| JP5762691B2 (ja) | 2010-03-15 | 2015-08-12 | Jx日鉱日石エネルギー株式会社 | 発酵によるアスタキサンチン製造方法 |
| JP2012158569A (ja) * | 2011-02-02 | 2012-08-23 | Jx Nippon Oil & Energy Corp | 皮膚外用剤 |
| CN105308180A (zh) * | 2012-12-20 | 2016-02-03 | 帝斯曼知识产权资产管理有限公司 | 胡萝卜素羟化酶及其用于产生类胡萝卜素的用途 |
| JP2017515512A (ja) * | 2014-05-16 | 2017-06-15 | アカデミア シニカAcademia Sinica | アスタキサンチンを生産するための組換えポリヌクレオチド配列及びその使用 |
| CN104531538A (zh) * | 2014-11-17 | 2015-04-22 | 嘉必优生物工程(武汉)有限公司 | 三孢布拉霉突变株及其应用 |
| CN105154466B (zh) * | 2015-08-12 | 2018-10-30 | 河北大学 | 一种双基因共表达重组载体及其构建方法和在三孢布拉霉中的应用 |
| CN108118007A (zh) * | 2016-11-30 | 2018-06-05 | 上海医药工业研究院 | 一种基因工程菌生产β-胡萝卜素的方法及其基因工程菌 |
| US11560583B2 (en) | 2017-06-01 | 2023-01-24 | Knipbio, Inc. | Heterologous carotenoid production in microorganisms |
| EP3794017A4 (de) | 2018-05-17 | 2022-03-09 | Lumen Bioscience, Inc. | Orale arthrospira-platensis-impfstoffabgabeplattform |
| US12252513B2 (en) | 2018-07-16 | 2025-03-18 | Lumen Bioscience, Inc. | Thermostable phycobiliproteins produced from recombinant arthrospira |
| CA3143735A1 (en) | 2019-07-03 | 2021-01-07 | Lumen Bioscience, Inc. | Arthrospira platensis non-parenteral therapeutic delivery platform |
| CN110283854B (zh) * | 2019-08-08 | 2021-07-16 | 内蒙古金达威药业有限公司 | 一种发酵培养基及其应用和利用三孢布拉霉菌发酵制备番茄红素的方法 |
| CN112226479A (zh) * | 2020-11-06 | 2021-01-15 | 江西邦泰绿色生物合成生态产业园发展有限公司 | 一种多酶联合使用提高万寿菊叶黄素提取率的方法 |
| CN114686378B (zh) * | 2020-12-28 | 2024-04-05 | 嘉必优生物技术(武汉)股份有限公司 | 一种三孢布拉氏霉全合成培养基及其应用、三孢布拉氏霉生产类胡萝卜素的方法 |
| CN116441057B (zh) * | 2023-05-09 | 2025-09-12 | 昆明理工大学 | 一种铜锌硫化矿浮选分离的组合抑制剂及应用 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1203818A3 (de) * | 1993-12-27 | 2002-06-12 | Kirin Beer Kabushiki Kaisha | DNA-Kette zur Synthese von Xanthophyllen, und Prozess zur Herstellung von Xanthophyllen |
| US6429356B1 (en) * | 1996-08-09 | 2002-08-06 | Calgene Llc | Methods for producing carotenoid compounds, and specialty oils in plant seeds |
| EP1185682A4 (de) * | 1998-05-22 | 2002-08-21 | Univ Maryland | Gene, die für carotenoid-ketolase kodieren, und ihre genprodukte, herstellung von ketocarotenoiden und verfahren zur modifikation von carotenoiden mittels dieser gene. |
| US6984523B2 (en) * | 2001-08-02 | 2006-01-10 | E.I. Du Pont De Nemours And Company | Carotenoid ketolase gene |
| US7223909B2 (en) * | 2002-03-21 | 2007-05-29 | Ball Horticultural | 4-ketocarotenoids in flower petals |
| DE10238978A1 (de) * | 2002-08-20 | 2004-03-04 | Sungene Gmbh & Co. Kgaa | Verfahren zur Herstellung von Ketocarotinoiden in Früchten von Pflanzen |
| ATE484198T1 (de) * | 2002-08-20 | 2010-10-15 | Sungene Gmbh & Co Kgaa | Verwendung von astaxanthinhaltigen pflanzen oder pflanzenteilen der gattung tagetes als futtermittel |
-
2003
- 2003-01-09 DE DE10300649A patent/DE10300649A1/de not_active Withdrawn
- 2003-12-24 CN CNA2003801084841A patent/CN1735686A/zh active Pending
- 2003-12-24 MX MXPA05007372A patent/MXPA05007372A/es not_active Application Discontinuation
- 2003-12-24 JP JP2004566030A patent/JP2006512914A/ja active Pending
- 2003-12-24 KR KR1020057012804A patent/KR20050095604A/ko not_active Withdrawn
- 2003-12-24 WO PCT/EP2003/014876 patent/WO2004063366A1/de not_active Ceased
- 2003-12-24 US US10/541,513 patent/US20060053513A1/en not_active Abandoned
- 2003-12-24 CA CA002512151A patent/CA2512151A1/en not_active Abandoned
- 2003-12-24 EP EP03789415A patent/EP1585813A1/de not_active Withdrawn
- 2003-12-24 AU AU2003294001A patent/AU2003294001A1/en not_active Abandoned
- 2003-12-24 RU RU2005125263/13A patent/RU2005125263A/ru not_active Application Discontinuation
-
2004
- 2004-01-09 CN CNA2004800063791A patent/CN1759173A/zh active Pending
- 2004-01-09 CN CNA2004800063804A patent/CN1759174A/zh active Pending
-
2005
- 2005-06-30 NO NO20053206A patent/NO20053206L/no not_active Application Discontinuation
- 2005-08-08 ZA ZA200506324A patent/ZA200506324B/en unknown
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2004063366A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2005125263A (ru) | 2006-01-10 |
| US20060053513A1 (en) | 2006-03-09 |
| MXPA05007372A (es) | 2005-09-12 |
| CN1735686A (zh) | 2006-02-15 |
| ZA200506324B (en) | 2006-11-29 |
| CN1759173A (zh) | 2006-04-12 |
| KR20050095604A (ko) | 2005-09-29 |
| NO20053206D0 (no) | 2005-06-30 |
| JP2006512914A (ja) | 2006-04-20 |
| NO20053206L (no) | 2005-08-30 |
| AU2003294001A1 (en) | 2004-08-10 |
| CA2512151A1 (en) | 2004-07-29 |
| WO2004063366A1 (de) | 2004-07-29 |
| DE10300649A1 (de) | 2004-07-22 |
| CN1759174A (zh) | 2006-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1585813A1 (de) | Verfahren zur herstellung von ketocarotinoiden durch kultivierung von genetisch veränderten organismen | |
| US7385123B2 (en) | Process for preparing ketocarotenoids in genetically modified organisms | |
| WO2005019467A1 (de) | Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten, nichthumanen organismen | |
| JP2007502605A6 (ja) | 遺伝子的に改変された非ヒト生物におけるケトカロテノイドの製造方法 | |
| DE10238980A1 (de) | Verfahren zur Herstellung von Ketocarotinoiden in Blütenblättern von Pflanzen | |
| WO2005019461A2 (de) | Ketolasen und verfaren zur herstellung von ketocarotinoiden | |
| EP1532256A1 (de) | VERFAHREN ZUR HERSTELLUNG VON &bgr;-CAROTINOIDEN | |
| DE10253112A1 (de) | Verfahren zur Herstellung von Ketocarotinoiden in genetisch veränderten Organismen | |
| DE10258971A1 (de) | Verwendung von astaxanthinhaltigen Pflanzen oder Pflanzenteilen der Gattung Tagetes als Futtermittel | |
| DE10238978A1 (de) | Verfahren zur Herstellung von Ketocarotinoiden in Früchten von Pflanzen | |
| EP1658372A2 (de) | Ketolasen und verfahren zur herstellung von ketocarotinoiden | |
| EP1658377A1 (de) | VERFAHREN ZUR HERSTELLUNG VON KETOCAROTINOIDEN IN GENETISCH VERÄNDERTEN, NICHTHUMANEN ORGANISMEN | |
| DE10238979A1 (de) | Verfahren zur Herstellung von Zeaxanthin und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten | |
| AU2004267196A1 (en) | Method for producing ketocarotinoids in genetically modified, non-human organisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20050809 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20061010 |