Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6816—Hybridisation assays characterised by the detection means

Definitions

• 60/031,809 filed July 29, 1996; 60/176,409, filed January 13, 2000; 60/192699, filed March 28, 2000; 60/200,161, filed April 26, 2000; 60/213,906, filed June 26, 2000; 60/224*631, filed August 11, 2000; 60/254,392, filed December 8, 2000; 60/254,418, filed December 8, 2000; -60/255,235, filed December 11, 2000; 60/255,236, filed December 11, 2000; 60/282,640, filed April 9, 2001; and 60/327,864, filed October 8, 2001 is also claimed, the disclosures are inco ⁇ orated by reference.
• Colloidal gold-protein probes have found wide applications in i ⁇ ununocytochemistry [S. Garzon and M. Bendayan, "Colloidal Gold Probe: An Overview of its Applications in Viral Cytochemistry,” in “Immuno-Gold Electron Microscopy,” Ed. A. D. Hyatt and B. T. Eaton, CrC Press, Ann Arbor, MI (1993); J. E. Beesley, Colloidal Gold: A New Perspective for Cytochemical marking," Oxford University Press, Oxford, (1989)]. These probes have been prepared by adsorbing the antibodies onto the gold surface from an aqueous solution under carefully defined conditions.
• the method comprises contacting a nucleic acid with a type of nanoparticles having oligonucleotides attached thereto (nanoparticle-oligonucleotide conjugates).
• the nucleic acid has at least two portions, and the oligonucleotides on each nanoparticle have a sequence complementary to the sequences of at least two portions of the nucleic acid.
• the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the nucleic acid.
• the hybridization of the oligonucleotides on the nanoparticles, with the nucleic acid results in a detectable change.
• the binding oligonucleotide is contacted with the second type of nanoparticle-oligonucleotide conjugates bound to the substrate under conditions effective to allow hybridization of the binding oligonucleotide to the oligonucleotides on the nanoparticles.
• a third type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to the sequence of a second portion of the binding oligonucleotide is contacted with the binding oligonucleotide bound to the substrate under conditions effective to allow hybridization of the binding oligonucleotide to the oligonucleotides on the nanoparticles.
• the detectable change produced by these hybridizations is observed.
• the method comprises contacting a nucleic acid with a substrate having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to a first portion of the sequence of the nucleic acid.
• the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the substrate with the nucleic acid.
• the nucleic acid bound to the substrate is contacted with liposomes having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to a portion of the sequence of the nucleic acid.
• This contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the liposomes with the nucleic acid.
• the method may further comprise contacting the first type of nanoparticle-oligonucleotide conjugates bound to the liposomes with a second type of nanoparticles having oligonucleotides attached thereto.
• the first type of nanoparticles have a second type of oligonucleotides attached thereto which have a sequence complementary to at least a portion of the sequence of the oligonucleotides on the second type of nanoparticles, and the oligonucleotides on the second type of nanoparticles having a sequence complementary to at least a portion of the sequence of the second type of oligonucleotides on the first type of nanoparticles.
• the oligonucleotides have a sequence complementary to a second portion of the sequence of said nucleic acid.
• the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with said nucleic acid.
• the substrate is contacted with silver stain to produce a detectable change, and the detectable change is observed.
• An aggregate probe comprising at least two types of nanoparticles having oligonucleotides attached thereto is provided.
• the nanoparticles of the aggregate probe are bound to each other as a result of the hybridization of some of the oligonucleotides attached to them, at least one of the types of nanoparticles of the aggregate probe having oligonucleotides attached thereto which have a hydrophobic group attached to the end not attached to the nanoparticles.
• the liposomes bound to the substrate are contacted with the aggregate probe under conditions effective to allow attachment of the oligonucleotides on the aggregate probe to the liposomes as a result of hydrophobic interactions, and a detectable change is observed.
• the kit comprises a container holding one type of nanoparticles having oligonucleotides attached thereto and one or more types of binding oligonucleotides.
• Each of the types of binding oligonucleotides has a sequence comprising at least two portions. The first portion is complementary to the sequence of the oligonucleotides on the nanoparticles, whereby the binding oligonucleotides are hybridized to the oligonucleotides on the nanoparticles in the container(s). The second portion is complementary to the sequence of a portion of the nucleic acid.
• the kit comprises a container holding an aggregate probe.
• the aggregate probe comprises at least two types of nanoparticles having oligonucleotides attached to them.
• the nanoparticles of the aggregate probe are bound to each other as a result of the hybridization of some of the oligonucleotides attached to each of them.
• At least one of the types of nanoparticles of the aggregate probe has oligonucleotides attached to it which have a sequence complementary to a portion of the sequence of a nucleic acid.
• the invention provides methods of making unique nanoparticle- oligonucleotide conjugates.
• the first such method comprises binding oligonucleotides to charged nanoparticles to produce stable nanoparticle- oligonucleotide conjugates.
• oligonucleotides having covalently bound thereto a moiety comprising a functional group which can bind to the nanoparticles are contacted with the nanoparticles in water for a time sufficient to allow at least some of the oligonucleotides to bind to the nanoparticles by means of the functional groups.
• at least one salt is added to the water to form a salt solution.
• the invention provides a method for detecting an analyte comprising contacting the analyte with a nanoparticle conjugate having oligonucleotides bound thereto. At least a portion of the oligonucleotides attached to the nanoparticles are bound, as a result of hybridization, to second oligonucleotides having bound thereto a specific binding complement of said analyte.
• the contacting takes place under conditions effective to allow specific binding interactions between the analyte and specific binding complement bound to the nanoparticle conjugate. A detectable change may be observed as a result of the specific binding interaction between the analyte and the probe.
• the method for detecting an analyte comprising providing an analyte having a first oligonucleotide bound thereto, and contacting the oligonucleotide bound to the analyte with a first type of nanoparticles having oligonucleotides bound thereto.
• the contacting occurs under conditions effective to allow hybridization between the oligonucleotides bound to the analyte with the oligonucleotides attached to the first type of nanoparticles to form a nanoparticle analyte conjugate.
• the method further comprising contacting the nanoparticle analyte conjugate with a second type of nanoparticle conjugate having oligonucleotides bound thereto.
• the method for detecting an analyte comprises providing a support having a oligonucleotides bound thereto and an analyte having an oligonucleotide bound thereto, the oligonucleotide bound to the analyte has a sequence that is complementary to the linker oligonucleotides bound to the support.
• the method further comprises contacting the oligonucleotides bound to the support with the olumbleucleotide bound to the analyte under conditions effective to allow hybridization between the oligonucleotides bound to the support and the oligonucleotides bound to the analytes.
• At least a portion of the oligonucleotides bound to the nanoparticle conjugate are bound, as a result of hybridization, to oligonucleotides having bound thereto a specific binding complement of said analyte.
• the analyte bound to the support is then contacted with the nanoparticle conjugate under conditions effective to allow specific binding interaction between the analyte bound to the support and the specific binding complement bound to the nanoparticle and detectable change is observed.
• the nanoparticles of the aggregate probe are bound to each other as a result of the hybridization of some of the oligonucleotides attached to them. At least one of the types of nanoparticles of the aggregate probe have some oligonucleotides attached thereto which are bound, as a result of hybridization, to second oligonucleotides having bound thereto a specific binding complement of said analyte.
• the contacting takes place under conditions effective to allow specific binding interactions between the analyte bound to the support and specific binding complement bound to the aggregate probe. Then, a detectable change is observed..
• the linker oligonucleotide bound to the support is then contacted with the oligonucleotide bound to the analyte under conditions effective to allow hybridization between the second portion of the linker oligonucleotide bound to the support and the oligonucleotide bound to the analyte.
• an aggregate probe comprising at least two types of nanoparticles having oligonucleotides bound thereto is provided. The nanoparticles of the aggregate probe are bound to each other as a result of the hybridization of some of the oligonucleotides attached to them.
• the invention also provides a method for detecting a nucleic acid comprising providing (i) a nucleic acid, (ii) one or more types of nanoparticles having oligonucleotides bound thereto, and (iii) a complex comprising streptavidin or avidin bound, by specific binding interaction, to two or more biotin molecules each having oligonucleotides bound thereto.
• the method for detecting a nucleic acid comprises contacting a first type of nanoparticle have oligonucleotides attached thereto with the nucleic acid.
• the sequence of the nucleic acid has at least two portions. At least some of the oligonucleotides attached to the nanoparticles have a sequence that is complementary to the first portion of the nucleic acid.
• the contacting occurs under conditions effective to allow hybridization between the oligonucleotides attached to the nanoparticle and the first portion of the nucleic acid.
• an oligonucleotide having a sbp member, e.g., biotin, bound thereto is provided.
• the sequence of the oligonucleotide bound to the sbp member has a sequence that is complementary to the second portion of the sequence of the nucleic acid.
• the oligonucleotide bound to the sbp member is then contacted to the nucleic acid bound to the first type of nanoparticle under conditions effective to allow hybridization between the oligonucleotide bound to the sbp member and the second portion of the nucleic acid. Then, a second type of nanoparticle conjugate having oligonucleotides bound thereto is provided.
• At least a portion of the oligonucleotides bound to the second type of nanoparticle are bound, as a result of hybridization, to oligonucleotides having bound thereto a specific binding complement of said analyte (e.g., streptavidin or avidin).
• a specific binding complement of said analyte e.g., streptavidin or avidin.
• the contacting takes place under conditions effective to allow specific binding interaction between the sbp member (e.g., biotin) bound to the first type of nanoparticle and the sbp complement (e.g., streptavidin or avidin) bound to the second type of nanoparticle.
• a detectable change may result.
• the invention provides another method of nanofabrication.
• This method comprises providing (a) at least two types of nanoparticles having oligonucleotides attached thereto; (b) at least one type of linking oligonucleotide having a selected sequence, the sequence of each type of linking oligonucleotide having at least two portions; and (c) a complex comprised of strepavidin or avidin bound to two or more biotin molecules, each having a first oligonucleotide bound thereto.
• the invention further provides yet another method of nanofabrication.
• the method comprises providing (a) at least one type of linking oligonucleotide having a selected sequence, the sequence of each type of linking oligonucleotide having at least two portions; (b) one or more types of nanoparticles having oligonucleotides attached thereto, the oligonucleotides on each type of nanoparticles having a sequence complementary to a first portion of the sequence of a linking oligonucleotide; (c) biotin having a first oligonucleotide bound thereto, the first oligonucleotide having a sequence complementary to a second portion of the sequence of the linking oligonucleotide; and (d) strepavidin or avidin.
• the selected nucleic acid and other nucleic acids are contacted with the nanoparticles under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles and the first oligonucleotides of the complex with the selected nucleic acid so that the nanoparticles and complex hybridized to the selected nucleic acid aggregate and precipitate.
• the invention further provides a method of separating a selected target nucleic acid having at least two portions from other nucleic acids.
• the method comprises providing (a) one or more types of nanoparticles having oligonucleotides attached thereto, the oligonucleotides on each of the types of nanoparticles having a sequence complementary to the sequence of the first portion of the selected nucleic acid; (b) biotin having a first oligonucleotide bound thereto, the first oligonucleotide having a sequence complementary to the sequence of the second portion of the selected nucleic acid; and (c) strepavidin or avidin.
• the method for detecting a nucleic acid having at least two portions comprises (a) contacting a nucleic acid with a substrate having oligonucleotides attached thereto, the oligonucleotides being located between a pair of electrodes, the oligonucleotides having a sequence complementary to a first portion of the sequence of said nucleic acid, the contacting taking place under conditions effective to allow hybridization of the oligonucleotides on the substrate with said nucleic acid; (b) contacting said nucleic acid bound to the substrate with a first type of labels such as nanoparticles, the labels being made of a material which can conduct electricity, the labels having one or more types of oligonucleotides attached thereto, at least one of the types of oligonucleotides having a sequence complementary to a second portion of the sequence of said nucleic acid, the contacting taking place under conditions effective to allow hybridization of the oligonucleotides on the labels with said
• a "type of oligonucleotides” refers to a plurality of oligonucleotide molecules having the same sequence.
• a "type of nanoparticles, conjugates, particles, latex microspheres, etc. having oligonucleotides attached thereto refers to a plurality of that item having the same type(s) of oligonucleotides attached to them.
• non-specific binding refers to the non-covalent binding between molecules that is relatively independent of specific surface structures. Non-specific binding may result from several factors including hydrophobic interactions between molecules.
• Figure 3 Schematic diagram of a variation of the system shown in Figure 2.
• the oligonucleotides on the two nanoparticles have sequences complementary to two different portions of the single-stranded DNA shown which are separated by a third portion which is not complementary to the oligonucleotides on the nanoparticles.
• an optional filler oligonucleotide which can be used to hybridize with the noncomplementary portion of the single-stranded DNA.
• FIG. 6 Cuvettes containing two types of gold colloids, each having a different oligonucleotide attached thereto and a linking double-stranded oligonucleotide with sticky ends complementary to the oligonucleotides attached to the nanoparticles (see Figure 4).
• Cuvette A at 80 ° C, which is above the Tm of the linking DNA; de-hybridized (thermally denatured). The color is dark red.
• Cuvette B after cooling to room temperature, which is below the Tm of the linking DNA; hybridization has taken place, and the nanoparticles have aggregated, but the aggregates have not precipitated. The color is pu ⁇ le.
• Cuvette C after several hours at room temperature, the aggregated nanoparticles have settled to the bottom of the cuvette. The solution is clear, and the precipitate is pinkish gray. Heating B or C will result in A.
• one nanoparticle has an oligonucleotide attached to it which is composed of all purines, and the other nanoparticle has an oligonucleotide attached to it which is composed of all pyrimidines.
• the third oligonucleotide for forming the triple-stranded connector (not attached to a nanoparticle) is composed of pyrimidines.
• Figures 13 A-B Schematic diagrams illustrating systems for detecting DNA (analyte DNA) using nanoparticles and a transparent substrate.
• Figure 19B is a graph of change in absorbance for the hybridized system referred to in Figure 19A as the temperature is increased (melted).
• Figure 29 Graph of fractional displacement of oligonucleotides by mercaptoethanol from nanoparticles (closed circles) or gold thin films (open squares) to which the oligonucleotides had been attached.
• Figure 30 Graph of surface coverages of recognition oligonucleotides on nanoparticles obtained for different ratios of recognition: diluent oligonucleotides used in the preparation of the nanoparticle-oligonucleotide conjugates.
• Figure 37 Schematic diagram illustrating system for forming aggregates (A) or layers (B) of nanoparticles (a and b) linked by a linking nucleic acid (3).
• Figure 38A UV-visible spectra of alternating layers of gold nanoparticles a and b (see Figure 37) hybridized to an oligonucleotide-functionalized glass microscope slide via the complementary linker 3.
• Figure 43 Schematic diagram for the synthesis and formulas for the steroid cyclic disulfide anchor group.
• Figure 49 Schematic representation of nanoparticle-oligonucleotide-receptor probes (IF) and applications in detecting a specific target in an array of substances immobilized on a smooth surface.
• the recognition receptor unit (specific binding complement to target) is designated A and the target, B.
• Figure 50 Schematic representation of (a) nanoparticle-oligonucleotide- receptor probe (II) showing that the oligonucleotide linked to the receptor (R) is complementary to the oligonucleotide bound to the nanoparticle and that the nanoparticle conjugate is bound by hybridization to the oligonucleotide bound to the receptor and (b) nanoparticle-oligonucleotide-receptor probe (II) showing that the oligonucleotide linked to the receptor (R) is bound, as a result of hybridization, to a first portion of the linking oligonucleotide and the oligonucleotides bound to the nanoparticle are bound, as a result of hybridization, to a second portion of the linking oligonucleotide.
• oligonucleotide-protein conjugate is shown bound to the oligonucleotide-nanoparticle conjugate; the actual number may be greater.
• Figure 51 Schematic representation of the application of a probe ( Figure 50(b), in (a) detecting a specific target, e.g., drug or protein, in an array of different drug or proteins immobilized on a glass surface and (b) detecting a specific target in a cell having an mixture of different molecules.
• the probe can also be used in a spot test where the analyte, e.g., protein or drug, has multiple binding sites.
• Figure 53 Photograph illustrating the nonspecific binding test (Example 27) of the inventive gold nanoparticle/oligonucleotide/streptavidin conjugate (left) a a commercial gold colloid/streptavidin conjugate (right).
• the commercial conjugate showed a gray spot, indicating that the conjugate sticks to the glass surface while the inventive conjugate showed no significant silver stain.
• Figure 56 Schematic diagram showing the preparation of a gold nanoparticle- oligonucleotide-streptavidin conjugate (Example 26) from (a) streptavidin bound to a single biotin linked to a oligonucleotide, the oligonucleotide bound to the biotin is further bound, as a result of hybridization, to a first portion of a linker oligonucleotide and (b) a gold nanoparticle having oligonucleotides bound thereto, the oligonucleotides bound to the nanoparticles have a sequence that is complementary to a second portion of the linker oligonucleotide.
• FIG 57 Transmission electron microscopy (TfiM) images (Example 28) showing (a) formation of aggregates upon heating a solution of streptavidin- oligonucleotide conjugate (1-STV), 13 nm gold particles (2-Au) and linker DNA (3) to 53 C and (b)particles within the aggregates retain their physical shape prior to and after annealing, show no particle fusion and further demonstrate stabilizing influence of the surface oligonucleotide layer.
• TfiM Transmission electron microscopy
• Figure 58 Melting curves (a) as a function of temperature (b) function of wavelength confirm that streptavidin-nanoparticle aggregates are formed by DNA hybridization interactions, not nonspecific interactions, and that the process is reversible. See Example 28.
• Figure 60 Illustration of ITO electrode setup as described in Example 29.
• Figure 61 The DNA sequences of the array capture strands, the oligonucleotide-functionalized nanoparticle labels, and the targets to be detected were designed to cohybridize in a three-component sandwhich assay.
• Figure 62 Microscope images of model DNA arrays functionalized with oligonucleotide sequences c (left) and d (right) and incubated with a solution of 50 nm diameter Au nanoparticles functionalized with sequence a (10 nM), 100 nm diameter Au nanoparticles functionalized with sequence b (3.5 nM), and oligonucleotide target(s) a'c' and/or b'd' (200 nM).
• 11 (A) Array and nanoparticles hybridized with both targets a'c' and b'd'.
• B Array and nanoparticles hybridized with only target b 'd'.
• C Array and nanoparticles hybridized with only target a'c'.
• Figure 65 Illustration of a slide was mounted on an inverted microscope equipped with a controlled temperature stage mount (BS60, Instec Inc., Boulder Co) and a miniature magnetic stirrer (Telemodul Mini, H+P Labortechnik, Kunststoff, Germany) as shown in Figure 65 A (top view) and S2B (side view). The assembly was subjected to a temperature ramp from 25 °C to 75 °C at a rate of 0.5°C/min with a 3 min hold at each temperature. Images were captured as described above, and analyzed using image processing software (Adobe Photoshop 5.0, Adobe Systems, San Jose, CA). See Example 31.
• Figure 68 Detection scheme illustrating (A) selective binding event between a capture oligonucleotide strand located between two electrodes and a target oligonucleotide in solution.
• the target oligonucleotide has contiguous recognition elements, which are complementary to the capture strand and a nanoparticle probe, respectively. Therefore, when the device with the pair of electrodes is immersed in a solution containing the appropriate probe and target, particles fill the gap. In principle, capacitance or conductivity measurements can be made to determine the number of particles and, therefore, target molecules that fill the gap.
• FIG 71 An FE-SEM image of the edge of a DNA spot after the nanoparticle assembly and silver deposition process.
• the substrate has been treated with a higher concentration of nanoparticles (10 nM), which includes nonspecific binding of nanoparticles on the area where there is no capture DNA strands (below arrow). Note that there is no significant silver deposition below the arrow, even though there is a fair amount of nonspecifically bound nanoparticles.
• Nanoparticles useful in the practice of the invention include metal (e.g., gold, silver, copper and platinum), semiconductor (e.g., CdSe, CdS, and CdS or CdSe coated with ZnS) and magnetic (e.g., ferromagnetite) colloidal materials.
• metal e.g., gold, silver, copper and platinum
• semiconductor e.g., CdSe, CdS, and CdS or CdSe coated with ZnS
• magnetic e.g., ferromagnetite
• Suitable nanoparticles are also commercially available from, e.g., Ted Pella, Inc. (gold), Amersham Co ⁇ oration (gold) and Nanoprobes, Inc. (gold).
• Gold nanoparticles are also presently preferred for use in nanofabrication for the same reasons given above and because of their stability, ease of imaging by electron microscopy, and well-characterized modification with thiol functionalities (see below).
• semiconductor nanoparticles are also preferred for use in nanofabrication because of their unique electronic and luminescent properties.
• the nanoparticles, the oligonucleotides or both are functionalized in order to attach the oligonucleotides to the nanoparticles.
• Such methods are known in the art. For instance, oligonucleotides functionalized with alkanethiols at their 3 '-termini or 5'-termini readily attach to gold nanoparticles. See Whitesides, Proceedings of the Robert A. Welch Foundation 39th Conference On Chemical Research Nanophase Chemistry, Houston, TX, pages 109-121 (1995). See also, Mucic et al. Chem.
• Oligonucleotides of defined sequences are used for a variety of pu ⁇ oses in the practice of the invention. Methods of making oligonucleotides of a predetermined sequence are well-known. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual (2nd ed. 1989) andF. Eckstein (ed.) Oligonucleotides and Analogues, 1st Ed. (Oxford University Press, New York, 1991). Solid-phase synthesis methods are preferred for both oligoribonucleotides nd oligodeoxyribonucleotides (the well-known methods of synthesizing DNA are also useful for synthesizing RNA). Oligoribonucleotides and oligodeoxyribonucleotides can also be prepared enzymatically.
• pylori Escherichia coli infections, Legionella infections, Mycoplasma infections, Salmonella infections
• sexually transmitted diseases e.g., gonorrhea
• inherited disorders e.g., cystic fibrosis, Duchene muscular dystrophy, phenylketonuria, sickle cell anemia
• cancers e.g., genes associated with the development of cancer
• the contacting of the nanoparticle-oligonucleotide conjugates with the nucleic acid takes place under conditions effective for hybridization of the oligonucleotides on the nanoparticles with the target sequence(s) of the nucleic acid.
• hybridization conditions are well known in the art and can readily be optimized for the particular system employed. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. 1989).
• Preferably stringent hybridization conditions are employed.
• the rate of hybridization can also be increased by warming the solution containing the nucleic acid to be detected and the nanoparticle-oligonucleotide conjugates to a temperature below the dissociation temperature (Tm) for the complex formed between the oligonucleotides on the nanoparticles and the target nucleic acid.
• rapid hybridization can be achieved by heating above the dissociation temperature (Tm) and allowing the solution to cool.
• the advantage of the system illustrated in Figure 2 is that it utilizes the base discrimination associated with a long target sequence and probe (eighteen base-pairs in the example illustrated in Figure 2), yet has the sensitivity characteristic of a short oligonucleotide probe (nine base-pairs in the example illustrated in Figure 2).
• Suitable substrates include transparent solid surfaces (e.g., glass, quartz, plastics and other polymers), opaque solid surface (e.g., white solid surfaces, such as TLC silica plates, filter paper, glass fiber filters, cellulose nitrate membranes, nylon membranes), and conducting solid surfaces (e.g., indium-tin-oxide (ITO)).
• transparent solid surfaces e.g., glass, quartz, plastics and other polymers
• opaque solid surface e.g., white solid surfaces, such as TLC silica plates, filter paper, glass fiber filters, cellulose nitrate membranes, nylon membranes
• conducting solid surfaces e.g., indium-tin-oxide (ITO)
• the substrate can be any shape or thickness, but generally will be flat and thin.
• transparent substrates such as glass (e.g., glass slides) or plastics (e.g., wells of microtiter plates).
• oligonucleotides are attached to the substrate.
• nanoparticles bearing oligonucleotides that would serve to bind the nanoparticles together as a consequence of hybridization with binding oligonucleotides could be used.
• the first type of oligonucleotides has a sequence b which is complementary to the sequence b' of a portion of a nucleic acid to be detected.
• the second type of oligonucleotides has sequence a or a' so that the third type of nanoparticles will hybridize to nanoparticles on the exterior of the core.
• the aggregate probe can also be prepared by utilizing two types of nanoparticles (see Figure 28B). Each type of nanoparticles has at least two types of oligonucleotides attached to them.
• the first type of oligonucleotides present on each of the two types of nanoparticles has sequence b which is complementary to the sequence b' of a portion of the nucleic acid to be detected.
• the aggregate probe can be utilized to detect nucleic acid in any of the above assay formats performed on a substrate, eliminating the need to build up layers of individual nanoparticles in order to obtain or enhance a detectable change.
• layers of aggregate probes can be built up by using two types of aggregate probes, the first type of aggregate probe having oligonucleotides attached to it that are complementary to oligonucleotides on the other type of aggregate probe.
• the aggregate probes can hybridize to each other to form the multiple layers.
• the scanner can be a black-and-white scanner or, preferably, a color scanner. Most preferably, the scanner is a standard color scanner of the type used to scan documents into computers. Such scanners are inexpensive and readily available commercially. For instance, an Epson Expression 636 (600 x 600 dpi), a UMAX Astra 1200 (300 x 300 dpi), or a Microtec 1600 (1600 x 1600 dpi) can be used. The scanner is linked to a computer loaded with software for processing the images obtained by scanning the substrate.
• a plurality of binding oligonucleotides having the same first portion and different second portions can be used, in which case the "universal probe", after hybridization to the binding oligonucleotides, can bind to multiple portions of the nucleic acid to be detected or to different nucleic acid targets.
• oligonucleotides Methods of labeling oligonucleotides with fluorescent molecules and measuring fluorescence are well known in the art. Suitable fluorescent molecules are also well known in the art and include the fluoresceins, rhodamines and Texas Red. The oligonucleotides will be attached to the nanoparticles as described above.
• the above described particles and nanoparticles having oligonucleotides labeled with acceptor and donor fluorescent molecules attached can be used in the assay formats described above, including those performed in solution and on substrates.
• the oligonucleotide sequences are preferably chosen so that they bind to the target nucleic acid as illustrated in Figures 15A-G.
• the binding oligonucleotides may be used to bring the acceptor and donor fluorescent molecules on the two nanoparticles in proximity.
• the oligonucleotides attached the substrate may be labeled with d.
• other labels besides fluorescent molecules can be used, such as chemiluminescent molecules, which will give a detectable signal or a change in detectable signal upon hybridization.
• the microporous material should be transparent or a color (e.g., white) which allows for detection of the pink/red color of the gold nanoparticles.
• the microporous material should also have a pore size sufficiently large to allow the gold nanoparticles to pass through the pores and sufficiently small to retain the latex microspheres on the surface of the microporous material when the microporous material is washed.
• the size (diameter) of the latex microspheres must be larger than the size (diameter) of the gold nanoparticles.
• the microporous material must also be inert to biological media.
• a negative result is evidenced by a white color and fluorescence, because the gold nanoparticles would pass through the pores of the microporous material when it is washed (so no quenching of the fluorescence would occur), and the white latex microspheres would be trapped on top of it (see Figure 21).
• changes in fluorescence and color can be observed as a function of temperature. For instance, as the temperature is raised, fluorescence will be observed once the dehybridization temperature has been reached. Therefore, by looking at color or fluorescence as a function of temperature, information can be obtained about the degree of complementarity between the oligonucleotide probes and the target nucleic acid.
• this detection method exhibits high sensitivity. As little as 3 femtomoles of single-stranded target nucleic acid 24 bases in length and 20 femtomoles of double-stranded target nucleic acid 24 bases in length have been detected with the naked eye.
• the method is also very simple to use. Fluorescence can be generated by simply illuminating the solution or microporous material with a UV lamp, and the fluorescent and colorimetric signals can be monitored by the naked eye. Alternatively, for a more quantitative result, a fluorimeter can be employed in front-face mode to measure the fluorescence of the solution with a short path length.
• the above embodiment has been described with particular reference to latex microspheres and gold nanoparticles.
• microsphere or nanoparticle having the other properties described above and to which oligonucleotides can be attached, can be used in place of these particles.
• Many suitable particles and nanoparticles are described above, along with techniques for attaching oligonucleotides to them.
• microspheres and nanoparticles having other measurable properties may be used.
• polymer-modified particles and nanoparticles, where the polymer can be modified to have any desirable property, such as fluorescence, color, or electrochemical activity can be used. See, Watson et al., J. Am. Chem. Soc, 121, 462-463 (1999) (polymer-modified gold nanoparticles).
• the fluorescence of the oligonucleotides attached to the nanoparticles is quenched while part of this network.
• the fluorescence of a solution containing nucleic acid and the two probes can be monitored to detect the results, with a reduction in, or elimination of, fluorescence indicating a positive result.
• the results of the assay are detected by placing a droplet of the solution onto a microporous material (see Figure 22).
• Fluorescence can be generated by simply illuminating the solution or microporous material with a UV lamp, and the fluorescent signal can be monitored by the naked eye.
• a fluorimeter can be employed in front-face mode to measure the fluorescence of the solution with a short path length.
• a "satellite probe” is used (see Figure 24).
• the satellite probe comprises a central particle with one or several physical properties that can be exploited for detection in an assay for nucleic acids (e.g., intense color, fluorescence quenching ability, magnetism).
• Suitable particles include the nanoparticles and other particles described above.
• the particle has oligonucleotides (all having the same sequence) attached to it (see Figure 24). Methods of attaching oligonucleotides to the particles are described above. These oligonucleotides comprise at least a first portion and a second portion, both of which are complementary to portions of the sequence of a target nucleic acid (see Figure 24).
• the satellite probe also comprises probe oligonucleotides.
• Each probe oligonucleotide has at least a first portion and a second portion (see Figure 24).
• the sequence of the first portion of the probe oligonucleotides is complementary to the first portion of the sequence of the oligonucleotides immobilized on the central particle (see Figure 24). Consequently, when the central particle and the probe oligonucleotides are brought into contact, the oligonucleotides on the particle hybridize with the probe oligonucleotides to form the satellite probe (see Figure 24).
• Both the first and second portions of the probe oligonucleotides are complementary to portions of the sequence of the target nucleic acid (see Figure 24).
• Each probe oligonucleotide is labeled with a reporter molecule (see Figure 24), as further described below.
• the amount of hybridization overlap between the probe oligonucleotides and the target is as large as, or greater than, the hybridization overlap between the probe oligonucleotides and the oligonucleotides attached to the particle (see Figure 24). Therefore, temperature cycling resulting in dehybridization and rehybridization would favor moving the probe oligonucleotides from the central particle to the target. Then, the particles are separated from the probe oligonucleotides hybridized to the target, and the reporter molecule is detected.
• the satellite probe can be used in a variety of detection strategies.
• the central particle has a magnetic core and is covered with a material capable of quenching the fluorescence of fluorophores attached to the probe oligonucleotides that surround it
• this system can be used in an in situ fluorometric detection scheme for nucleic acids.
• Functionalized polymer-coated magnetic particles Fe 3 O 4
• Dynal Dynal
• Bangs Laboratories EstaporTM
• silica-coated magnetic Fe 3 O 4 nanoparticles could be modified (Liu et al., Chem.
• Probes forms extremely stable amide bonds upon reaction with primary alkylamino . groups.
• any magnetic particle or polymer-coated magnetic particle with primary alkyl amino groups could be modified with both oligonucleotides, as well as these quencher molecules.
• the DABCYL quencher could be attached directly to the surface-bound oligonucleotide, instead of the alkyl amino-modified surface.
• the satellite probe comprising the probe oligonucleotides is brought into contact with the target. The temperature is cycled so as to cause dehybridization and rehybridization, which causes the probe oligonucleotides to move from the central particle to the target. Detection is accomplished by applying a magnetic field and removing the particles from solution and measuring the fluorescence of the probe oligonucleotides remaining in solution hybridized to the target.
• This approach also can be further extended to an electrochemical assay by using an oligonucleotide-magnetic particle conjugate in conjunction with a probe oligonucleotide having attached a redox-active molecule.
• Any modifiable redox- active species can be used, such as the well-studied redox-active ferrocene derivative.
• a ferrocene derivatized phosphoramidite can be attached to oligonucleotides directly using standard phosphoramidite chemistry. Mucic et al., Chem. Commun., 555 (1996); Eckstein, ed., in Oligonucleotides and Analogues, 1st ed., Oxford University, New York, NY (1991).
• the ferrocenylphosphoramidite is prepared in a two-step synthesis from 6-bromohexylferrocene.
• 6- bromohexylferrocene is stirred in an aqueous HMPA solution at 120°C for 6 hours to from 6-hydroxyhexylferrocene.
• the 6-hydroxyhexylferrocene is added to a THF solution of N,N-diisopropylethylamine and beta-cyanoethyl-N,N- diisopropylchlorophosphoramide to form the ferrocenylphosphoramidite.
• Oligonucleotide-modified polymer-coated gold nanoparticles could also be utilized. Watson et al., J. Am. Chem. Soc, 121, 462-463 (1999). A copolymer of amino reactive sites (e.g., anhydrides) could be inco ⁇ orated into the polymer for reaction with arnino- modified oligonucleotides. Moller et al., Bioconjugate Chem., 6, 174-178 (1995). In the presence of target and with temperature cycling, the redox-active probe oligonucleotides will move from the satellite probe to the target.
• a copolymer of amino reactive sites e.g., anhydrides
• the oligonucleotides on the first type of nanoparticles have a sequence complementary to the sequence of a first portion of a nucleic acid.
• the oligonucleotides on the second type of nanoparticles have a sequence complementary to the sequence of a second portion of the nucleic acid.
• the container may further comprise filler oligonucleotides having a sequence complementary to a third portion of the nucleic acid, the third portion being located between the first and second portions.
• the filler oligonucleotide may also be provided in a separate container.
• the kit comprises at least two containers.
• the kit comprises a substrate, the substrate having attached thereto nanoparticles.
• the nanoparticles have oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
• the kit also includes a first container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid.
• the oligonucleotides may have the same or different sequences, but each of the oligonucleotides has a sequence complementary to a portion of the nucleic acid.
• the kit further includes a second container holding a binding oligonucleotide having a selected sequence having at least two portions, the first portion being complementary to at least a portion of the sequence of the oligonucleotides on the nanoparticles in the first container.
• the kit also includes a third container holding nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to the sequence of a second portion of the binding oligonucleotide.
• the kit comprises a substrate having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
• the kit also includes a first container holding liposomes having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid and a second container holding nanoparticles having at least a first type of oligonucleotides attached thereto, the first type of oligonucleotides having a cholesteryl group attached to the end not attached to the nanoparticles so that the nanoparticles can attach to the liposomes by hydrophobic interactions.
• the kit may further comprise a third container holding a second type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to at least a portion of the sequence of a second type of oligonucleotides attached to the first type of nanoparticles.
• the second type of oligonucleotides attached to the first type of nanoparticles having a sequence complementary to the sequence of the oligonucleotides on the second type of nanoparticles.
• kits may comprise one or two containers holding two types of particles.
• the first type of particles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
• the oligonucleotides are labeled with an energy donor on the ends not attached to the particles.
• the second type of particles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of a nucleic acid.
• the oligonucleotides are labeled with an energy acceptor on the ends not attached to the particles.
• the energy donors and acceptors may be fluorescent molecules.
• the kit comprises a container holding a satellite probe.
• the satellite probe comprises a particle having attached thereto oligonucleotides.
• the oligonucleotides have a first portion and a second portion, both portions having sequences complementary to portions of the sequence of a nucleic acid.
• the satellite probe also comprises probe oligonucleotides hybridized to the oligonucleotides attached to the nanoparticles.
• the probe oligonucleotides have a first portion and a second portion. The first portion has a sequence complementary to the sequence of the first portion of the oligonucleotides attached to the particles, and both portions have sequences complementary to portions of the sequence of the nucleic acid.
• the probe oligonucleotides also have a reporter molecule attached to one end.
• nanoparticles having one or more different types of oligonucleotides attached thereto are contemplated.
• the number of different oligonucleotides attached to a nanoparticle and the lengths and sequences of the one or more oligonucleotides will contribute to the rigidity and structural features of the resulting nanomaterials and nanostructures.
• oligonucleotide components For construction of nanomaterials and nanostructures, it may be desirable in some cases to "lock" the assembly in place by covalent cross-links after formation of the nanomaterial or nanostructure by hybridization of the oligonucleotide components. This can be accomplished by inco ⁇ orating functional groups that undergo a triggered irreversible reaction into the oligonucleotides.
• An example of a functional group for this pu ⁇ ose is a stilbenedicarboxamide group. It has been demonstrated that two stilbenedicarboxamide groups aligned within hybridized oligonucleotides readily undergo cross-linking on irradiation with ultraviolet light (340 nm) (Lewis, F.D. et al. (1995) J Am. Chem. Soc. Ill, 8785-8792).
• a 5'-O-tosyl group from an oligonucleotide, held at the 3 '-position to a nanoparticle by .a mercaptoalkly group, with a thiophosphoryl group at the 3 '-end of an oligonucleotide held to an nanoparticle by a mercaptoalkyl group.
• thiophosphoryl oligonucleotides do not react with gold nanoparticles under the conditions employed in attaching mercaptoalkyl- oligonucleotides to gold nanoparticles enables one to prepare gold nanoparticle- oligonucleotide conjugates anchored through the mercapto group to the nanoparticles and containing a terminal thiophosphoryl group free for the coupling reaction.
• the properties of the nanomaterials and nanostructures can be altered by inco ⁇ orating into the interconnecting oligonucleotide chains organic and inorganic functions that are held in place by covalent attachment to the oligonucleotide chains.
• backbone, base and sugar modifications are well known (see for example Uhlmann, E., and Peyman, A. Chemical Reviews, 90, 544-584 (1990).
• the oligonucleotide chains could be replaced by "Peptide Nucleic Acid” chains (PNA), in which the nucleotide bases are held by a polypeptide backbone (see Wittung, P. et al., Nature, 368, 561-563 (1994).
• the nanofabrication method of the invention is extremely versatile.
• the nanomaterials and nanostructures that can be made by the nanofabrication method of the invention include nanoscale mechanical devices, separation membranes, bio-filters, and biochips. It is contemplated that the nanomaterials and nanostructures of the invention can be used as chemical sensors, in computers, for drug delivery, for protein engineering, and as templates for biosynthesis/nanostrucrure fabrication/directed assembly of other structures. See generally Seeman et al., New J. Chem., 17, 739 (1993) for other possible applications.
• the nanomaterials and nanostructures that can be made by the nanofabrication method of the invention also can include electronic devices. Whether nucleic acids, could transport electrons has been the subject of substantial controversy. As shown in Example 21 below, nanoparticles assembled by DNA conduct electricity (the DNA connectors function as semiconductors).
• the method comprises providing oligonucleotides having covalently bound thereto a moiety comprising a functional group which can bind to the nanoparticles.
• the moieties and functional groups are those described above for binding (i.e., by chemiso ⁇ tion or covalent bonding) oligonucleotides to nanoparticles.
• oligonucleotides having an alkanethiol, an alkanedisulfide or a cyclic disulfide covalently bound to their 5' or 3' ends can be used to bind the oligonucleotides to a variety of nanoparticles, including gold nanoparticles.
• the oligonucleotides and nanoparticles are incubated in the salt solution for an additional period of time sufficient to allow sufficient additional oligonucleotides to bind to the nanoparticles to produce the stable nanoparticle-oligonucleotide conjugates.
• an increased surface density of the oligonucleotides on the nanoparticles has been found to stabilize the conjugates.
• the time of this incubation can be determined empirically. A total incubation time of about 24-48, preferably 40 hours, has been found to give good results (this is the total time of incubation; as noted above, the salt concentration can be increased gradually over this total time).
• This second period of incubation in the salt solution is referred to herein as the "aging" step.
• Other suitable conditions for this "aging” step can also be determined empirically. For instance, incubation at room temperature and pH 7.0 gives good results.
• the conjugates produced by use of the "aging” step have been found to be considerably more stable than those produced without the “aging” step. As noted above, this increased stability is due to the increased density of the oligonucleotides on the surfaces of the nanoparticles which is achieved by the "aging” step.
• the surface density achieved by the “aging” step will depend on the size and type of nanoparticles and on the length, sequence and concentration of the oligonucleotides. A surface density adequate to make the nanoparticles stable and the conditions necessary to obtain it for a desired combination of nanoparticles and oligonucleotides can be determined empirically.
• a surface density of at least 10 picomoles/cm 2 will be adequate to provide stable nanoparticle-oligonucleotide conjugates.
• the surface density is at least 15 picomoles/cm 2 . Since the ability of the oligonucleotides of the conjugates to hybridize with nucleic acid and oligonucleotide targets can be diminished if the surface density is too great, the surface density is preferably no greater than about 35-40 picomoles/cm 2 .
• stable means that, for a period of at least six months after the conjugates are made, a majority of the oligonucleotides remain attached to the nanoparticles and the oligonucleotides are able to hybridize with nucleic acid and oligonucleotide targets under standard conditions encountered in methods of detecting nucleic acid and methods of nanofabrication.
• the nanoparticle-oligonucleotide conjugates made by this method exhibit other remarkable properties. See, e.g., Examples 5, 7, and 19 of the present application.
• they will assemble into large aggregates in the presence of a target nucleic acid or oligonucleotide.
• the temperature over which the aggregates form and dissociate has unexpectedly been found to be quite narrow, and this unique feature has important practical consequences.
• it increases the selectivity and sensitivity of the methods of detection of the present invention.
• a single base mismatch and as little as 20 femtomoles of target can be detected using the conjugates.
• the diluent and recognition oligonucleotides have been found to attach to the nanoparticles in about the same proportion as their ratio in the solution contacted with the nanoparticles to prepare the conjugates.
• the ratio of the diluent to recognition oligonucleotides bound to the nanoparticles can be controlled so that the conjugates will participate in a desired number of hybridization events.
• the diluent oligonucleotides may have any sequence which does not interfere with the ability of the recognition oligonucleotides to be bound to the nanoparticles or to bind to a nucleic acid or oligonucleotide target.
• the diluent oligonucleotides do not interefere with the ability of the recognition portions of the recognition oligonucleotides to hybridize with nucleic acid or oligonucleotide targets. Even more preferably, the diluent oligonucleotides have the same sequence as the sequence of the spacer portions of the recognition oligonucleotides.
• Protein receptors and other specific binding pair members can be functionalized with oligonucleotides and immobilized onto.oligonucleotide-modified nanoparticles to generate a new class of hybrid particles (nanoparticle-receptor conjugates) that exhibit the high stability of the oligonucleotide modified particles but with molecular recognition properties that are dictated by the protein receptor rather than DNA.
• the use of these novel nanoparticle-receptor conjugates in analyte detection strategies have been evaluated in a number of ways including identification of targets and screening for protein-protein interactions.
• Figure 49 where A and B can be a protein, peptide, carbohydrate, sugar, oligo- or polynucleotide, synthetic polymer or oligomer, or a small molecule and any combination thereof).
• the basic concept is to attach a "receptor unit" (A in Figure 49) to an oligonucleotide which is complementary to oligonucleotides bound to the nanoparticle.
• Hybridization then generates a nanoparticle probe containing a sheath of oligonucleotides around the nanoparticle matrix which serves to enhance water solubility of the system and to stabilize the colloids with respect to aggregation.
• Probe IF is then used to interrogate a target (B) immobilized on a solid surface. Binding of A to B is monitored by detection of the nanoparticles bound to the solid- surface (e.g. colorimetrically, by fluorescence, silver staining, etc.).
• This scheme can be used for any molecules wherein A can be conjugated to an oligonucleotide and B can be immobilized on a surface.
• I is a gold nanoparticle bearing a large number of oligonucleotides linked firmly to the gold surface (e.g. via a sulfur-gold bond) and 1 is a protein containing a pendant oligonucleotide with a sequence complementary to the sequence for the oligonucleotides attached to the nanoparticle.
• Procedures for constructing nanoparticle-oligonucleotide conjugates having a high surface density of oligonucleotides are described herein. See for instance Example 3 and C. A. Mirkin et al. Nature, 382, 607-609 (1996); R. Elghanian et al., Science, 277, 1078-1081 (1997); J. J.
• FIG. 50(b) An alternative embodiment of the nanoparticle receptor conjugate is shown in Figure 50(b) which entails the use of a linking oligonucleotide that brings the nanoparticle-oligonucleotide constructs and oligonucleotide-protein conjugate together under conditions for hybridization.
• the linker oligonucleotide has one segment (a') complementary to oligonucleotide (a) bound to the nanoparticle and another segment (b') complementary to oligonucleotide (b) bound to the receptor.
• FIG 51 illustrates a number of representative detection schemes that can employ the nanoparticle-protein conjugates as a probe.
• the nanoparticle-protein conjugates have a wide variety of applications including identifying target analytes, screening a library of molecules such as drugs immobilized in array onto a support ( Figure 51(a)) or in histochemical applications to identify for the presence of analytes in cells or tissues.
• the probe can also be used in a spot test where the analyte, e.g., protein or drug, has multiple binding sites.
• the gold probe-receptor-ligand target combinations resulting from these assays can be observed by visually (e.g., spot test or formation of aggregates or silver staining) or by any known procedure.
• the nanoparticle-protein conjugate system can be used to develop a colorimetric test for nucleic acids, which relies on the aggregate properties of the nanoparticle/DNA/protein composite, Figure 52 (A).
• solutions of a complex comprised of streptavidin bound to four biotin -oligonucleotide conjugates (1-STV) and a gold nanoparticle DNA conjugate (2-Au) with and without target nucleic acid (3) were prepared.
• the sequence of the target nucleic acid has two portions.
• the oligonucleotides bound to the complex is complementary to the first portion of the nucleic acid while the oligonucleotides bound to the nanoparticles are complementary to the . second part of the nucleic acid.
• the solutions were heated to 53 °C for 30 min, and then 3 ⁇ L , aliquots of the solutions were spotted on a C18 reverse-phase thin-layer chromatography plate.
• the solution with target nucleic acid showed a blue spot and the solution without target showed a red spot.
• This result and the sha ⁇ melting curve demonstrate that one of the gold nanoparticle probes in the above-described spot test ( Figure 52 (B)) can be replaced by streptavidin/DNA conjugates, which are simpler to prepare than gold probes.
• the system shown in 52(a) can also be used to prepare novel 3-dimensional nanomaterials or assemblies as discussed above.
• Figure 52(c) no linking oligonucleotides are used and the oligonucleotide attached to the complex are complementary to the oligonucleotides bound to the nanoparticles.
• nanoparticle-protein complexes are based on gold nanoparticles
• other particles based on a wide variety of other materials (e.g., silver, platinum, mixtures of gold and silver, magnetic particles, semiconductors, quantum dots) can be used, and the particle sizes may range from 2-100 nm as described above.
• U.S. Patent application Serial No. 09/344,667 and PCT application WO 98/04740 both of which are inco ⁇ orated herein by reference in their entirety, describe suitable nanoparticles and methods of attaching oligonucleotides to them.
• the nanoparticle-oligonucleotide-protein complexes (II) are employed as probes in detecting specific target molecules such as proteins immobilized on a smooth surface. See, for instance, Figures 48, 49 51 and 54. For this pu ⁇ ose, a number of different proteins may be immobilized at different discrete spots as array on a glass slide. A number of linkage methods may be used.
• One method, well known in the art, is to treat the glass with 3-aminopropyltriethoxysilane followed by 1,4-phenylene disothiocyanate. This sequence generates a surface holding pendant isothicyanate groups that can be used to bind substances containing one or more amino groups.
• Targets containing amino groups can be immobilized directly onto tins modified surface.
• an aminoalkyl group can be tethered to the target to provide the necessary reactive group.
• the surface is exposed to a colloidal solution of II.
• the probes bind to the portion of the slide with biotin.
• the signal associated with the complexed probes could be further developed by treating with silver enhancing solution (see Figure 54).
• useful probes of type II can be made using a great variety of substances as the functional recognition elements.
• the scheme for synthesis and application of the probes, shown in Figures 49 and 50, is completely analogous to that presented in Figure 48 for studying protein-protein interactions.
• the conjugate probe is designated IF, the receptor unit as A, and the target immobilized on the solid surface as B.
• the system in Figure 48 and variations described herein is a special case of the general system shown in Figure 49.
• oligonucleotide-nanoparticle probes of type II that are constructed from non-metal nanoparticles.
• Type II probes based on inherently fluorescent nanoparticles may be observed by their fluorescence.
• Other nanoparticles can be made fluorescent by appending fluorescent tags to the particles either before or after the oligonucleotide sheath has been added.
• a common feature of all these nanoparticle-oligonucleotide-receptor conjugate systems is that the signal for interaction of the components being tested, e.g. receptor A and B in Figure 49, depends both on A binding to B and on the interaction of oligonucleotide a with oligonucleotide a'. Since the dissociation temperature for the oligonucleotide duplex segment can be tuned by controlling the length and sequence of the complementary strands and the salt concentration, one can in many cases design systems such that the oligonucleotide duplexes will dissociate at a lower temperature, or a higher temperature, than the components being tested, according to the wishes of the investigator.
• any of the above conjugates can be, and are preferably, used in any of the methods of detecting analytes such as nucleic acids described above, and the invention also provides a kit comprising a container holding any of the above conjugates.
• the conjugates can be, and are preferably, used in any of the methods of nanofabrication of the invention and the method of separating nucleic acids.
• the invention also relates to the use of an electric field to facilitate hybridization of inventive nanoparticle-oligonucleotide conjugates to complementary oligonucleotides on an electrode surface.
• the electric field strength in particular the current level and density
• these electric fields can be extended to facilitate other interactions involving nanoparticle-charged molecule . conjugates that include, but are not limited to, most molecular biological procedures, such as specific binding pair interactions, antibody/antigen reaction, cell separations, and related clinical diagnostics.
• Biosensors are discussed in some detail in Protein immobilization, Fundamentals & Applications, R.F. Taylor, ed. (1991) (chapter 8); and Immobilized Affinity Ligand Techniques, Hermanson et al. (1992) (chapter 5). See also U.S. Patent No. 5,965,452 and references cited therein.
• Nanogen and others have developed microelectronic nucleic acid array methods and devices in that utilize electric fields as an independent parameter to control transport, hybridization and stringency of nucleic acid interactions. These are "active" array devices in that they exploit microelectronic as well as microfabrication technology. See, for instance, Edman et al., Nucleic Acids Res., 1997, Vol. 25 (24), 4907-14; U.S. Patent Nos. 6,051,380; 6,068,818; 5,929,208; 5,632,957; 5,565,322; 5,605,662; 5,849,486; 6,048,690; 6,013,166; and 5,965,452, which are inco ⁇ orated by reference in their entirety.
• Combinatorial oligonucleotide array (or "gene chip”) technology depends on the quantitative detection of target DNA hybridized to complementary array elements. We recently reported a "scanometric" method for detecting DNA targets hybridized to gene arrays in which oligonucleotide-functionalized, 13 nm diameter gold nanoparticles serve as the indicators of target hybridization to the chip. [Taton, T.A.; Mirkin, C.A.; Letsinger, R.L. Science 200, 289, 1757].
• the selectivity of the scanometric DNA detection system was intrinsically higher (by a factor of 4) than that of a conventional array system based upon fluorophore probes.
• enlarging the array-bound nanoparticles by gold-promoted reduction of silver (I) permitted the arrays to be imaged, in black-and- white by a flatbed optical scanner, with 100 times the sensitivity than that typically observed by confocal fluorescence imaging of fluorophore-labeled gene chips.
• Metal nanoparticles that differ in size and composition can be designed to scatter light of different wavelengths according to their distinct surface plasmon resonances [Mie, G. Ann. Phys. 1908, 25, 377]. Scattered light from different sized nanoparticles has been used in histochemical imaging [Schultz, S,; Smith, D.R.;
• the a ⁇ ay slides were mounted on a microscope stage and illuminated in the plane of the slide by a fiber optic illuminator [Darklite Illuminator (Micro Video Instruments, Avon, MA)]; in this configuration, the slide served as a planar waveguide, preventing any light from reaching the microscope objective by total internal reflectance.
• a fiber optic illuminator Darklite Illuminator (Micro Video Instruments, Avon, MA)]
• the slide served as a planar waveguide, preventing any light from reaching the microscope objective by total internal reflectance.
• evanescently coupled light [M ⁇ ller, G.J. In Multichannel Image Detectors; Talmi, Y., Ed.; ACS Symposium Series 102; American Chemical Society: Washington, DC, 1979; pp 239-262] was scattered out of the guide plane and was imaged as bright, colored spots on a dark background.
• the DNA array imaging method described herein based on scattered light from larger oligonucleotide-functionalized nanoparticles, provides the opportunity for sensitive, ultraselective, multicolor labeling of DNA a ⁇ ays.
• the method described will be extendable to additional colors using nanoparticles of different compositions and sizes [Link, S.; Wang, Z.L.; El-Sayed, M.A. J. Phys. Chem. B 1999, 103, 3529].
• the inventive method involves detecting the scattering of light directed into the waveguide, the scattering being the result of light scattering nanoparticle conjugates of the invention specifically bound to the waveguide within the penetration depth of an evanescent wave.
• the waveguide may be transparent plastic or glass or any suitable material and the binding is typically by oligonucleotide hybridization or if desired, by immunological capture as described above.
• Light scattering detectable nanoparticle probes may be prepared from any of the novel metal or semiconductor nanoparticles, including gold, prepared by the inventive ageing process described above. Real-time binding and dissociation can be monitored visually or by video imaging, such as with a CCD camera and frame grabber software. Hybridization mismatches of as few as one base can be distinguished by real-time melting curves.
• the light source can be a small incandescent light bulb powered by a battery, such as is used in pocket flashlight.
• the light source includes potentiometer means for varying the intensity of the light source.
• filters and/or lenses may be employed to adjust the intensity to a suitable level.
• Detection means for determining the degree of light scattering are described in detail below but briefly comprise both instrument and visual means. It is an important feature of the invention that light scattering events across the entire waveguide can be monitored essentially simultaneously, whether by the eye and brain of an observer or by photodetection devices including CCD cameras forming images that are digitized and processed using computers. In each case only a single, multifunctional surface is used and is illuminated simultaneously by the evanescent wave.
• the invention also relates to a salt-based stringency wash for enhancing target selectivity in a detection method.
• Increasing target nucleic acid analyte selectivity generally involves a adjustment of the hybridization conditions or the use of a thermal based stringency wash at melting temperatures in a post-hybridization step that results in dehybridization of nucleic acid duplexes from base mismatched or non-complementary strands.
• the greater the stringency of the subsequent wash step the fewer, if any, mismatches remain in the duplex structure.
• salt concentration as a stringency tool rather than temperature is provides a number of su ⁇ rising and unexpected advantages, including eliminating the need for thermocyclers in nanoparticle-based detection systems and providing higher selectivity than temperature-based stringency for nanoparticle probes.
• use of salt concentration as a stringency tool is useful where the detection probe are not stable at elevated temperature.
• a method for detecting a nucleic acid comprises providing a substrate having oligonucleotides bound thereto, the oligonucleotides bound to the substrate have a sequence that is complementary to a first portion of a sequence of a nucleic acid; providing labels, such as nanoparticles, having oligonucleotides bound thereto, at least some of the oligonucleotides having a sequence that is complementary to the sequence of a second portion of the nucleic acid; contacting the substrate, nucleic acid, and labels, the contacting taking place under conditions effective to allow hybridization between the oligonucleotides bound to the substrate with the nucleic acids and between the nucleic acid and the oligonucleotide bound to the label so as to form a test substrate having labels complexed thereto; contacting the test substrate with an aqueous salt solution having a salt concentration effective to substantially remove non-specifically bound labels; and observing
• stringency may be adjusted in a post-hybridization wash step that employs an aqueous salt solution of a proper cationic strength.
• Any suitable stringency wash solution may be employed in practicing this invention including wash solutions described in Maniatis's Molecular Cloning: A Laboratory Manual, Second edition (Cold Spring Harbor Laboratory Press), 1989 and Ausubel et al., Short Protocols in Molecular Biology, fourth Edition (John Wiley & Sons), 1999.
• Representative aqueous salt solution comprise a salt selected from the group consisting of sodium chloride, magnesium chloride, potassium chloride, ammonium chloride, sodium acetate, ammonium acetate, a combination of two or more of these salts, one of these salts in a phosphate buffer, and a combination of two or more of these salts in a phosphate buffer. While phosphate buffer is prefe ⁇ ed, any other buffer or combination of two or more suitable buffers may be used. Representative examples of suitable buffers include, without limitation, tris (hydroxymethyl)aminomethane (TRIS) and TRIS-HC1 buffer.
• TRIS-HC1 buffer Tris (hydroxymethyl)aminomethane
• any suitable concentration of the salt and buffer components in the stringency wash solution may be used.
• the skilled artisan will know how to adjust the salt, solution to achieve a proper cationic concentration. For instance, the skilled artisan may evaluate a range of solutions of different cationic concentration and further prepare a dissociation curve, similar to the one shown in Figure 69(C) (Example 32).
• a representative stringency solution is described in Example 32 and includes sodium chloride in a phosphate buffer.
• the sodium chloride salt component generally ranges from about 0 M to about 0.5 M, preferably from about 0.005 M to about 0.1 M.
• the phosphate buffer component generally ranges from about 0.01 mM to about 15 mM, preferably about 10 mM.
• the stringency buffer may have any suitable pH, generally about pH 7. In using the salt based wash as a post-hybridization wash, stringency levels of at least 90% or greater, preferably at least 95% or 97%, may be achieved.
• the salt-based stringency wash system can be expanded to any other suitably charged labels having oligonucleotides.
• Representative labels include, without limitation, radioisotopes, fluorescent dyes such as fluorescein or tetramethylrhodamine, enzymes such as alkaline or horseradish peroxidase, reporter groups such as biotin of digoxigenin, polyanionic polymers, and spectroscopic labels such as raman dyes.
• the salt concentration dependent post-hybridization stringency conditions rely, in part, on the adjustment of the cationic strength of the solution.
• the substrate may include a plurality of pairs of electrodes located on it in an a ⁇ ay to allow for the detection of multiple portions of a single nucleic acid, the detection of multiple different nucleic acids, or both, each of , the pairs of electrodes having a type of oligonucleotides attached to the substrate between them.
• the circuit between the electrodes should be closed or can be made to close by any suitable material as discussed herein including the use of silver, gold, or any other conductive materials such as metals or material that can catalyze the local aggrandization of material that can conduct electricity including elemental carbon.
• the presence of the closed circuit can be detected by any suitable means such as a change in the electrical property of the electrodes. Such a change can be detected by any suitable means including, without limitation, a change in conductivity, resistivity, capacitance, or impedance.
• Gold colloids (13 nm diameter) were prepared by reduction of HAuCl with citrate as described in Frens, Nature Phys. Sci., 241, 20 (1973) and Grabar, Anal. Chem., 67, 735 (1995). Briefly, all glassware was cleaned in aqua regia (3 parts HC1, 1 part HNO 3 ), rinsed with Nanopure H 2 O, then oven dried prior to use. HAuCl and sodium citrate were purchased from Aldrich Chemical Company. Aqueous HAuCl 4 (1 mM, 500 mL) was brought to reflux while stirring. Then, 38.8 mM sodium citrate (50 mL) was added quickly.
• Au colloids were characterized by UV-vis spectroscopy using a Hewlett Packard 8452A diode array spectrophotometer and by Transmission Electron Microscopy (TEM) using a Hitachi 8100 transmission electron microscope. Gold particles with diameters of 13 nm will produce a visible color change when aggregated with target and probe oligonucleotide sequences in the 10-35 nucleotide range.
• DTT dithiothreitol
• 5'-Thiol-Modif ⁇ er C 6 -phosphorar ⁇ idite reagent was purchased from Glen Research, 44901 Falcon Place, Sterling, Va 20166. The oligonucleotides were synthesized, and the final DMT protecting group removed. Then, 1 ml of dry acetonitrile was added to 100 ⁇ mole of the 5' Thiol Modifier C 6 - phosphoramidite.
• Reverse phase HPLC was performed with a Dionex DX500 system equipped with a Hewlett Packard ODS hypersil column (4.6 x 200 mm, 5 mm particle size) using 0.03 M Et 3 NH + OAc- buffer (TEAA), pH 7, with a 1%/min. gradient of 95% CH 3 CN/5%
• the amount of oligonucleotide was determined by absorbance at 260 nm, and final purity assessed by reverse phase HPLC (elution time 14.5 minutes).
• the same protocol was used for purification of the 3'-thiol-oligonucleotides, except that DTT was added after extraction of DMT to reduce the amount of disulfide formed. After six hours at 40°C, the DTT was extracted using ethyl acetate, and the oligonucleotides repurified by HPLC (elution time 15 minutes).
• preparatory HPLC was performed under the same conditions as for unmodified oligonucleotides.
• the trityl protecting group was removed by adding 150 ⁇ L of a 50 mM AgNO 3 solution to the dry oligonucleotide sample.
• the sample turned a milky white color as the cleavage occu ⁇ ed.
• 200 ⁇ L of a 10 mg/ml solution of DTT was added to complex the Ag (five minute reaction time), and the sample was centrifuged to precipitate the yellow complex.
• the oligonucleotide solution ( ⁇ 50 OD) was then transferred onto a desalting NAP-5 column (Pharmacia Biotech, Uppsala, Sweden) for purification (contains DNA Grade Sephadex G-25 Medium for desalting and buffer exchange of oligonucleotides greater than 10 bases).
• the amount of 5' thiol modified oligonucleotide was determined by UV-vis spectroscopy by measuring the magnitude of the absorbance at 260 nm.
• the oligonucleotide-modified nanoparticles are stable at elevated temperatures (80°C) and high salt concentrations (1M NaCl) for days and have not been observed to undergo particle growth. Stability in high salt concentrations is important, since such conditions are required for the hybridization reactions that form the basis of the methods of detection and nanofabrication of the invention.
• Example 1 They had the following sequences:
• DNA solutions were approximately 1 absorbance unit(s) (OD), buffered at pH 7 using 10 mM phosphate buffer and at 1M NaCl concentration.
• non-thiolated oligonucleotides having sequences complementary to the sticky ends of the linking oligonucleotide and reacted with nanoparticles did not produce reversible aggregation when the nanoparticles were combined with the linking oligonucleotide.
• Example 3 Preparation of Oligonucleotide-Modified Gold Nanoparticles
• Gold colloids (13 nm diameter) were prepared as described in Example 1.
• the method of attaching thiol-oligonucleotides to gold nanoparticles described in Example 1 was found not to produce satisfactory results in some cases.
• the oligonucleotide-colloid conjugates were not stable in the presence of a large excess of high molecular weight salmon sperm DNA used as model for the background DNA that would normally be present in a diagnostic system.
• Longer exposure of the colloids to the thiol-oligonucleotides produced oligonucleotide-colloid conjugates that were stable to salmon sperm DNA, but the resulting conjugates failed to hybridize satisfactorily.
• the solution was next centrifuged at 14,000 ⁇ m in an Eppendorf Centrifuge 5414 for about 15 minutes to give a very pale pink supernatant containing most of the oligonucleotide (as indicated by the absorbance at 260 nm) along with 7-10% of the colloidal gold (as indicated by the absorbance at 520 nm), and a compact, dark, gelatinous residue at the bottom of the tube.
• the supernatant was removed, and the residue was resuspended in about 200 ⁇ L of buffer (10 mM phosphate, 0.1 M NaCl) and recentrifuged.
• hybridization was achieved by heating rapidly and then cooling rapidly to the stringent temperature. For example, hybridization was carried out in 100 ⁇ L of 0.1 M NaCl plus 5 mM MgCl 2 containing 15 nM of each oligonucleotide-colloid conjugate 1 and 2, and 3 nanomoles of target oligonucleotide 3, 4, 5, 6, or 7, heating to 74°C, cooling to the temperatures indicated in Table 1 below, and incubating the mixture at this temperature for 10 minutes. A 3 ⁇ L sample of each reaction mixture was then spotted on a C-18 TLC silica plate. On drying (5 minutes), a strong blue color appeared if hybridization had taken place. The results are presented in Table 1 below.
• a target containing a single mismatch T nucleotide was found to give a positive test at 58°C (blue color) and a negative test (red color) at 64°C with conjugates 1 and 2.
• the fully-matched target (3) gave a positive test at both temperatures, showing that the test can discriminate between a target that is fully matched and one containing a single mismatched base.
• hybridization was carried out in 100 ⁇ L of 0.1 M NaCl containing 15 nM of each oligonucleotide-colloid conjugate 1 and 2, and 10 picomoles of target oligonucleotide 3, 4, 5, 6, or 7, freezing in a dry ice-isopropyl alcohol bath for 5 minutes, thawing at room temperature, then warming rapidly to the temperatures indicated in Table 2 below, and incubating the mixture at this temperature for 10 minutes. A 3 ⁇ L sample of each reaction mixture was then spotted on a C-18 TLC silica plate. The results are presented in Table 2. TABLE 2
• a mismatch in either segment is more destabilizing than a mismatch in a longer probe (e.g., an oligonucleotide 30 bases long) in a comparable two-component detection system.
• the signal at 260 nm obtained on hybridization of the target oligonucleotides with the nanoparticle conjugates in solution, is nanoparticle-based, not DNA-based. It depends on dissociation of an assembly of nanoparticles organized in a polymeric network by multiple oligonucleotide duplexes. This results in a narrowing of the temperature range that is observed for aggregate dissociation, as compared with standard DNA thermal denaturation.
• the temperature range for aggregate melting is very narrow (4°C) as compared with the temperature range associated with melting the comparable system without nanoparticles (12°C). Even more striking and advantageous for this detection approach is the temperature range for the colorimetric response ( ⁇ 1°C) observe on the CI 8 silica plates.
• this three-component nanoparticle based strategy will be more selective than any two-component detection system based on a single-strand probe hybridizing with target nucleic acid.
• a master solution containing 1 nmol of target 3 was prepared in 100 ⁇ l of hybridization buffer (0.3 M NaCl, 10 mM phosphate, pH 7). One ⁇ l of this solution corresponds to 10 picomole of target oligonucleotide. Serial dilutions were performed by taking an aliquot of the master solution and diluting it to the desired concentration with hybridization buffer. Table 3 shows the sensitivity obtained using 3 ⁇ l of a mixture of probes 1 and 2 with different amounts of target 3. After performing the hybridization using freeze-thaw conditions, 3 ⁇ l aliquots of these solutions were spotted onto C-18 TLC plates to determine color. In Table 3 below, pink signifies a negative test, and blue signifies a positive test.
• DNA modified nanoparticles were adsorbed onto modified transparent substrates as shown in Figure 13B.
• This method involved the linking of DNA modified • nanoparticles to nanoparticles that were attached to a glass substrate, using DNA hybridization interactions.
• Glass microscope slides were purchased from Fisher scientific. Slides were cut into approximately 5 15 mm pieces, using a diamond tipped scribing pen. Slides were cleaned by soaking for 20 minutes in a solution of 4:1 H 2 SO 4 :H 2 0 at 50°C. Slides were then rinsed with copious amounts of water, then ethanol, and dried under a stream of dry nitrogen.
• the resulting slides have a pink appearance due to the adsorbed nanoparticles and exhibit similar UV-vis absorbance profiles (surface plasmon absorbance peak at 520 nm) as the aqueous gold nanoparticle colloidal solutions. See Figure 14A.
• DNA was attached to the nanoparticle modified surface by soaking the glass slides in 0.2 OD (1.7 ⁇ M) solution containing freshly purified 3' thiol oligonucleotide (3' thiol ATGCTCAACTCT [SEQ ID NO:33]) (synthesized as described in Examples 1 and 3). After 12 hours of soaking time, the slides were removed and rinsed with water.
• linking oligonucleotide prepared as described in Example 2 was 24 bp long (5'
• the substrate was then soaked in a hybridization buffer (0.5 M NaCl, 10 mM phosphate buffer pH 7) solution containing the linking oligonucleotide (0.4 OD, 1.7 ⁇ M) for 12 hours.
• the substrate was soaked in a solution containing 13 nm diameter gold nanoparticles which had been modified with an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO;35]) (prepared as described in Example 3) that is complementary to the unhybridized portion of the linking oligonucleotide attached to the substrate.
• an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO;35]) (prepared as described in Example 3) that is complementary to the unhybridized portion of the linking oligonucleotide attached to the substrate.
• the, substrate was removed and rinsed with the hybridization buffer.
• the substrate color had darkened to a pu ⁇ le color and the UV-vis absorbance at 520 nm approximately doubled ( Figure 14A).
• 15A-G were prepared as described in Example 3, except that the nanoparticles were redispersed in hybridization buffer (0.3 M NaCl, 10 mM phosphate, pH 7).
• the final nanoparticle-oligonucleotide conjugate concentration was estimated to be 13 nM by measuring the reduction in intensity of the surface plasmon band at 522 nm which gives rise to the red color of the nanoparticles.
• the oligonucleotide targets illustrated in Figures 15A-G were purchased from the Northwestern University Biotechnology Facility, Evanston, IL.
• the solution was diluted to 1 ml with hybridization buffer, and the optical signature of the aggregates at 260 nm was recorded at one minute intervals as the temperature was increased from 25 C to 75 ° C, with a holding time of 1 minute/degree.
• T m melting temperature
• FW ⁇ 2 -13.5 C).
• the 'melting analysis' of the oligonucleotide solution without nanoparticles was performed under similar conditions as the analysis with nanoparticles, except that the temperature was increased from 10-80 ° C. Also, the solution was 1.04 ⁇ M in each oligonucleotide component.
• the T m for the aggregate formed from the perfect complement 4 of probes 1 and 2 was compared with the T m 's for aggregates formed from targets that contained one base mismatches, deletions, or insertions ( Figures 15A-G).
• All of the gold nanoparticle-oligonucleotide aggregates that contained imperfect targets exhibited significant, measurable destabilization when compared to the aggregates formed from the perfect complement, as evidenced by T m values for the various aggregates (see Figures 15A-G).
• the solutions containing the imperfect targets could easily be distinguished from the solution containing the perfect complement by their color when placed in a water bath held at 52.5 C.
• This temperature is above the T m of the mismatched polynucleotides, so only the solution with the perfect target exhibited a pu ⁇ le color at this temperature.
• a 'melting analysis' was also performed on the probe solution which contained the half-complementary target. Only a minute increase in absorbance at 260 nm was observed.
• the colorimetric transition that can be detected by the naked eye occurs over less than 1 C, thereby allowing one to easily distinguish the perfect target 4 from the targets with mismatches (5 and 6), an end deletion (7), and a one base insertion at the point in the target where the two oligonucleotide probes meet (8) (see Table 4).
• T c is close in temperature, but not identical, to T m . In both controls, there were no signs of particle aggregation or instability in the solutions, as evidenced by the pinkish red color which was observed at all temperatures, and they showed negative spots (pink) in the plate test at all temperatures (Table 4).
• the results indicate that any one base mismatch along the target strand can be detected, along with any insertions into the target strand.
• the temperature range over which a color change can be detected is extremely sha ⁇ , and the change occurs over a very narrow temperature range.
• This sha ⁇ transition indicates that there is a large degree of cooperativity in the melting process involving the large network of colloids which are linked by the target oligonucleotide strands. This leads to the remarkable selectivity as shown by the data.
• Example 8 Assays Using Nanoparticle-Oligonucleotide Conjugates A set of experiments were performed involving hybridization with 'filler' duplex oligonucleotides. Nanoparticle-oligonucleotide conjugates 1 and 2 illustrated in Figure 16A were incubated with targets of different lengths (24, 48 and 72 bases in length) and complementary filler oligonucleotides, as illustrated in Figures 16A-C. Otherwise, the conditions were as described in Example 7. Also, the oligonucleotides and nanoparticle- oligonucleotide conjugates were prepared as described in Example 7.
• the color changes observed in this and other examples occur when the distance between the gold nanoparticles (the inte ⁇ article distance) is approximately the same or less than the diameter of the nanoparticle.
• the size of the nanoparticles, the size of the oligonucleotides attached to them, and the spacing of the nanoparticles when they are hybridized to the target nucleic acid affect whether a color change will be observable when the oligonucleotide-nanoparticle conjugates hybridize with the nucleic acid targets to form aggregates.
• the color change observed with gold nanoparticles is attributable to a shift and broadening of the surface plasmon resonance of the gold. This color change is unlikely for gold nanoparticles less than about 4 nm in diameter because the lengths of the oligonucleotides necessary for specific detection of nucleic acid would exceed the nanoparticle diameter.
• a solution containing 12.5 microliters of each probe 1 and 2 and 0.25 microliters of target 3 was heated to 70°C. After cooling to room temperature, 2.5 microliters of a saliva solution (human saliva diluted 1:10 with water) was added. After the resultant solution was frozen, thawed and then spotted onto a C-18 TLC plate, a blue spot was obtained, indicating hybridization of the probes with the target. In control experiments with no target added, blue spots were not observed.
• a saliva solution human saliva diluted 1:10 with water
• the slides were soaked in a 1% solution of trimethoxysilylpropyldiethyltriamine (DET A, purchased from United Chemical Technologies, Bristol, PA) in 1 mM acetic acid in Nanopure water for 20 minutes at room temperature.
• the slides were rinsed with water, then ethanol. After drying with a dry nitrogen stream, the slides were baked at 120°C for 5 minutes using a temperature-controlled heating block.
• the slides were allowed to cool, then were soaked in a 1 mM succinimidyl 4-(malemidophenyl)-butyrate (SMPB, purchased from Sigma Chemicals) solution in 80:20 methanol;dimethoxysulfoxide for 2 hours at room temperature.
• SMPB succinimidyl 4-(malemidophenyl)-butyrate
• DNA was attached to the surfaces by soaking the modified glass slides in a 0.2 OD (1.7 ⁇ M) solution containing freshly purified oligonucleotide (3' thiol ATGCTCAACTCT [SEQ ID NO:33]). After 12 hours of soaking time, the slides were removed and rinsed with water.
• the substrate was soaked in a solution containing 13 nm diameter gold nanoparticles which had been modified with an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO:35]) that is complementary to the unhybridized portion of the linking oligonucleotide attached to the substrate.
• an oligonucleotide TAGGACTTACGC 5' thiol [SEQ ID NO:35]
• the substrate was removed and rinsed with the hybridization buffer.
• the glass substrate's color had changed from clear and colorless to a transparent pink color. See Figure 19 A.
• Additional layers of nanoparticles were added to the slides by soaking the slides in a solution of the linking oligonucleotide as described above and then soaking in a solution containing 13 nm gold nanoparticles having oligonucleotides (3' thiol ATGCTCAACTCT [SEQ ID NO:33]) attached thereto. After soaking for 12 hours, the slides were removed from the nanoparticle solution and rinsed and soaked in hybridization buffer as described above. The color of the slide had become noticeably more red. See Figure 19A.
• a final nanoparticle layer was added by repeating the linking oligonucleotide and nanoparticle soaking procedures using 13 nm gold nanoparticles which had been modified with an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO:35]) as the final nanoparticle layer. Again, the color darkened, and the UV-vis absorbance at 520 nm increased. See Figure 19 A.
• a melting curve was performed.
• a slide was placed in a cuvette containing 1.5 mL of hybridization buffer, and an apparatus similar to that used in Example 2, part B, was used.
• the absorbance signal due to the nanoparticles (520 nm) was monitored at each degree as the temperature of the substrate was increased from 20°C to 80°C, with a hold time of 1 minute at each integral degree.
• the nanoparticle signal dramatically dropped when the temperature passed 52°C. See Figure 19B.
• a first derivative of the signal showed a melting temperature of 55°C, which corresponds with the temperature seen for the oligonucleotide-nanoparticle conjugates and linking oligonucleotides hybridized in solution. See Figure 19B.
• Example 11 Assay of a Polyribonucleotide Using
• Example 12 Assay for Protective Antigen DNA Segment of Anthrax Using Nanoparticle-Oligonucleotide Conjugates
• nanoparticle-oligonucleotide conjugates can be used to assay for a DNA strand in the presence of its complement (i.e., assaying for a single strand after thermal dehybridization of a double-stranded target) and can recognize and specifically bind to an amplicon obtained from a PCR reaction.
• a PCR solution containing a 141 base pair duplex amplicon of the Protective Antigen segment of Anthrax was provided by the Navy (sequence given in Figure 23).
• the assay for this amplicon was carried out by isolating the DNA from 100 ⁇ L of the PCR solution using a Qiaquick Nucleotide Removal Kit (Qiagen, Inc., Santa Clarita, CA) and the standard protocol for this kit, with the exception that elution of the DNA was effected with 10 mM phosphate buffer at pH 8.5, rather than with the buffer provided with the kit.
• the eluant was then evaporated to dryness on a Speed Vac (Savant).
• a master mix prepared by mixing equal volumes of each of two solutions of two different oligonucleotide-nanoparticle probes (see Figure 23). Each oligonucleotide-nanoparticle probe was prepared as described in Example 3.
• the solutions of the probes which were combined to form the master mix were prepared by adding 10 ⁇ L of 2 M NaCl and 5 ⁇ L of oligonucleotide blocker solution (50 pmoles of each Blocker oligonucleotide (see Figure 23 and below) in a 0.3 M NaCl, 10 mM phosphate, pH 7.O., solution) to 5 ⁇ L of full-strength (about 10 nM) nanoparticle- oligonucleotide solution.
• the amplicon-probe mixture was heated to 100°C for 3 minutes, then frozen in a DRY ICE/ethanol bath and allowed to come to room temperature. A small aliquot (2 ⁇ L) was spotted on a C18 TLC plate and allowed to dry. A strong blue spot indicative of hybridization was obtained.
• the oligonucleotide Blockers were added to inhibit binding of the second strand of the initial duplex target (i.e., the strand complementary to the target strand) to regions of the target nucleic acid strand outside the segment that binds to the probes (see Figure 23 for sequences), since such binding interferes with binding of the nanoparticle oligonucleotide probes to the target strand.
• the Blocker oligonucleotides were complementary to the single-stranded target in regions not covered by the probes.
• An alternative scheme is to use blocker oligonucleotides that are complementary to the PCR complementary strand (the strand complementary to the target strand) outside the region that competes with the probe oligonucleotides.
• Example 13 Direct assay of PCR Amplicons without isolation of the amplicons from the PCR solution
• double-stranded targets were dehybridized by heating to generate single strands which interacted with single-stranded oligonucleotide probes bound to nanoparticles.
• the present example demonstrates that in cases where triple- stranded complexes can form, double-stranded oligonucleotide sequences can be recognized by the nanoparticle probes without prior dehybridization of the target.
• Tests were carried out with two different systems— polyA:polyU and dAr ⁇ . ⁇ K) — by adding 1 ⁇ L of a solution containing 0.8 A 260 Units of the target duplex in 100 ⁇ L of buffer (0.1 M NaCl, 10 mM phosphate, pH 7.0) to 100 ⁇ L of a colloidal solution of Au- sdT 20 nanoparticle-oligonucleotide conjugate ( ⁇ 10 nM in particles; see Example 11) in 0.3 M NaCl, 10 mM phosphate buffer at pH 7.0.
• a DMF solution of a one thousand fold excess of 1,4-phenylene diisothiocyanate was added to an aqueous borate buffer solution (0.1 M, pH 9.3) of the amino-modified oligonucleotide. After several hours, the excess 1,4-phenylene diisothiocyanate was extracted with butanol and the aqueous solution lyophilized. The activated oligonucleotides were redissolved in borate buffer and reacted with the amino-functionalized latex microspheres in a carbonate buffer (0.1 M, pH 9.3, 1 M NaCl).
• a double-stranded target oligonucleotide (1-5 ⁇ l, 20 nM), 3 ⁇ l of a solution of fluorophore-labeled- oligonucleotide-latex microspheres (3.1 ⁇ m; 100 fM) and 3 ⁇ l of a solution of 5'-oligonucleotide-gold nanoparticles (13 nm; 8 nM) were combined and heated to 100 °C for 3 minutes. Then, the solution was immediately frozen by immersing the reaction vessel containing it in a liquid N 2 bath for 3 minutes. This solution was then thawed at room temperature and filtered as described above. For a 24-base pair model system, using the unaided eye, 20 femtomoles of duplex target oligonucleotide could be detected colorimetrically.
• 25 femtomoles could be detected colorimetrically by the naked eye. Fluorescent spots could be visualized by the naked eye with a hand-held UV-lamp until the target amount in the 3 ⁇ l aliquot used to form the spot was as low as 50 femtomoles. It is believed that optimization of this system will allow for detection of even lower amounts of target nucleic acid.
• oligonucleotide-modified gold nanoparticles and unmodified DNA target could be hybridized to oligonucleotide probes attached to a glass substrate in a three-component sandwich assay (see Figures 25A-B).
• the nanoparticles can either be individual ones (see Figure 25 A) or "trees" of nanoparticles (see Figure 25B).
• the “trees” increase signal sensitivity as compared to the individual nanoparticles, and the hybridized gold nanoparticles "trees" often can be observed with the naked eye as dark areas on the glass substrate.
• a target oligonucleotide (5' - TACGAGTTGAGAATCCTGAATGCG - 3*, SEQ ID NO: 44, concentrations given below in Table 6 for each experiment) was hybridized with the capture oligonucleotides in 0.3 M NaCl, 10 mM phosphate buffer as described in Example 10.
• the substrate was rinsed twice with the same buffer solution and immersed in a solution containing gold nanoparticle probes functionalized with target-complementary DNA (5' - HS(CH 2 ) 6 A 10 CGCATTCAGGAT, SEQ ID NO: 45)(preparation described in Example 3) for 12 hours.
• the substrate was rinsed copiously with 0.3 M NaNO to remove Cir.
• the substrate was then developed with silver staining solution (1:1 mixture of Silver Enhancer Solutions A and B, Sigma Chemical Co., # S-5020 and # S-5145) for 3 minutes.
• Greyscale measurements were made by scanning the substrate on a flatbed scanner (normally used for scanning documents into a computer) linked to a computer loaded with software capable of calculating greyscale measurements (e.g., Adobe Photoshop). The results are presented in Table 6 below.
• Example 17 Assemblies Containing Quantum Dots This example describes the immobilization of synthetic single-stranded DNA on semiconductor nanoparticle quantum dots (QDs). Native CdSe/ZnS core/shell QDs (-4 nm) are soluble only in organic media, making direct reaction with alkylthiol-terminated single-stranded DNA difficult. This problem was circumvented by first capping the QDs with 3-mercaptopropionic acid.
• QDs semiconductor nanoparticle quantum dots
• the carboxylic acid group was then deprotonated with 4- (dimethylamino)pyridine, rendering the particles water soluble, and facilitating reaction of the QDs with either 3'-propylthiol- or 5'-hexylthiol-modified oligonucleotide sequences.
• the particles were separated from unreacted DNA by dialysis.
• a "linker" DNA strand was then hybridized to surface-bound sequences, generating extended assemblies of nanoparticles.
• the QD assemblies which were characterized by TEM, UV/Visible spectroscopy, and fluorescence spectroscopy, could be reversibly assembled by controlling the temperature of the solution.
• the temperature dependent TJV-Vis spectra were obtained for the novel QD assemblies and composite aggregates formed between QDs and gold nanoparticles ( ⁇ 13 nm).
• Nanopure water (18.1 M ⁇ ) prepared using a NANOpure ultrapure water purification system was employed throughout. Fluorescence spectra were obtained using a Perkin Elmer LS 50 B Luminescence Spectrometer. Melting analyses were performed using a HP 8453 diode array spectrophotometer equipped with a HP 9090a Peltier
• DNA is the ideal synthon for programming the assembly of nanoscale building blocks into periodic two- and three-dimensional extended structures.
• the many attributes of DNA which include ease of synthesis, extraordinary binding specificity, and virtually unlimited programmability by virtue of nucleotide sequence, can be exploited for the use of QD assembly.
• Precipitate (dissolved in water) was characterized by IR spectroscopy (polyethylene card, 3M). IR (cm "1 ): 1647 (m), 1559 (s), 1462 (m), 1214 (w), 719 (w), 478 (s). After standing for 12 hours, the oligonucleotide-containing solution was brought to 0.15 M NaCl, and the particles were aged for an additional 12 hours. The NaCl concentration was then raised to 0.3 M, and the mixture was allowed to stand for a further 24-40 hours before dialyzing against PBS (0.3 M NaCl, 10 mM phosphate buffer, pH 1, 0.01% sodium azide) using a 100 kDa membrane (Spectra/Por Cellulose Ester Membrane). The dialysis was carried out over a period of 48 hours, during which time the dialysis bath was refreshed tliree times.
• PBS 0.3 M NaCl, 10 mM phosphate buffer, pH 1, 0.01% sodium azide
• the clusters generated were not large enough to settle out of solution. However, they could be separated by centrifugation at relatively low speeds (10,000 RPM for 10 min), as compared with the unlinked particles (30,000 RPM for 2-3 hours).
• the "melting" behavior of the DNA was monitored by observing the UV-Vis spectra of the aggregates as a function of temperature.
• the precipitate containing the QD/QD assemblies was centrifuged at 10,000 ⁇ m for 10 minutes, washed with 7 ⁇ L of PBS, recentrifuged, and suspended in 0.7 mL of PBS.
• the UV/Visible spectroscopic signature of the assemblies was recorded at two degree intervals as the temperature was increased from 25°C to 75°C, with a holding time of 1 minute prior to each measurement.
• HAuCl 4 A «3H 2 0 and trisodium citrate were purchased from Aldrich chemical company, Milwaukee, WI. Gold wire, 99.999% pure, and titanium wire were purchased from Goldsmith Inc., Evanston, IL.
• Silicon wafers (100) with a 1 micron thick oxide layer were purchased from Silicon Quest International, Santa Clara, CA. 5'-thiol- modifier C6-phosphoramidite reagent, 3'-propylthiol modifier CPG, fluorescein phosphoramidite, and other reagents required for oligonucleotide synthesis were purchased from Glen Research, Sterling, VA.
• oligonucleotides were prepared using an automated DNA synthesizer (Expedite) using standard phosphoramidite chemistry (Eckstein, F. Oligonucleotides and Analogues; 1st ed.; Oxford University Press, New York, 1991). Oligonucleotides containing only 5' hexylthiol modifications were prepared as described in Example 1. 5 -(and 6)-carboxyfTuorescein, succinimidyl ester was purchased from Molecular Probes, Eugene, OR. NAP-5 columns (Sephadex G-25
• Nanopure H 2 0 (>18.0 M ⁇ ), purified using a Barnstead NANOpure ultrapure water system, was used for all experiments.
• High Performance Liquid Chromatography (HPLC) was performed using a HP series 1100 HPLC.
• SA 20 12F contained the same 12mer sequence with the addition of a 20 dA spacer sequence to the 5' end [SEQ ID NO: 51].
• the thiol-modified oligonucleotides were prepared as described in Storhoff et al., J. Am. Chem.Soc. 120:1959-1964 (1998).
• An amino-modifier C7 CPG solid support was used in automated synthesis, and the 5' terminus was manually modified with hexylthiol phosphoramidite, as described previously.
• the 3' amino, 5' trityl-protected thiol modified oligonucleotides were purified by reverse-phase HPLC using an HP ODS Hypersil column (5 mm, 250 x 4 mm) with 0.03 M triethyl ammonium acetate (TEAA), pH 7 and a 1% / minute gradient of 95% CH 3 CN / 5% 0.03 M TEAA at a flow rate of 1 mL/min., while monitoring the UV signal of DNA at 254 nm.
• the retention times of the 5'-S-trityl, 3' amino modified 12-base and 32-base oligonucleotides were 36 and 32 minutes respectively.
• the lyophilized product was redispersed in 1 ml of 0.1 M Na 2 C0 3 and, while stirring in the dark, 100 ⁇ L of 10 mg/ml succinimidyl ester of fluorescein (5,6 FAM-SE, Molecular Probes) in dry DMF was added over 1.5 hours according to the directions of the manufacturer (Molecular Probes literature). The solution was stirred at room temperature for an additional 15 hours, then precipitated from 100% ethanol at -20 C. The precipitate was collected by centrifugation, dissolved in H 2 0 and the coupled product separated from unreacted amino-terminated oligonucleotide by ion-exchange HPLC.
• a Dionex Nucleopac PA- 100 column (250 x 4 mm) was operated with 10 mM NaOH aqueous eluent and a 1% / minute gradient of 1 M NaCl/lOmM NaOH at a flow rate of 0.8 mL/minute. Retention times of 5'-S-trityl, 3' fluorescein modified 12mer and 32mer were 50 and 49 minutes respectively.
• the oligonucleotide product was desalted by reverse-phase HPLC.
• trityloligonucleotide was performed using silver nitrate and dithiothreitol (DTT) as previously described (Storhoff et al., J. Am. Chem.Soc. 120:1959-1964 (1998)). The yield and purity of the oligonucleotides were assessed using the techniques previously described for alkylthiol oligonucleotides (Storhoff et al., J. Am. Chem.Soc. 120:1959-1964 (1998)). Oligonucleotides were used immediately after detritylation of the thiol group.
• DTT dithiothreitol
• the fluorophore labeled complement (12'F) consisted of 12 bases 3 -GCG-TAA- GTC-CTA-5'-(CH 2 ) 6 -F [SEQ ID NO:53] complementary to the 12mer sequence in S12F and SA 0 12F.
• the oligonucleotide was synthesized using standard methods, and a syringe-based procedure, similar to the procedure reported above for the 5' alkylthiol modification, was used to couple fluorescein phosphoramidite (6-FAM, Glen Research) to the 5' end of the CPG-bound oligonucleotide.
• Gold nanoparticles were prepared by citrate reduction of HAuCl 4 as described in Example 1.
• Transmission Electron Microscopy (TEM) performed with a Hitachi 8100 TEM was used to determine the size distribution of the resulting nanoparticles. At least 250 particles were sized from TEM negatives using graphics software (ImageTool). The average diameter of a typical particle preparation was 15.7 + 1.2 nm. Assuming spherical nanoparticles and density equivalent to that of bulk gold (19.30 g/cm 2 ), an average molecular weight per particle was calculated (2.4 x 10 7 g/mol). The atomic gold concentration in a solution of gold nanoparticles was determined by ICP-AES
• Silicon supported gold thin films were immersed in deposition solutions of deprotected alkylthiol modified oligonucleotides for equal times and buffer conditions as for the gold nanoparticles. Following oligonucleotide deposition, the films were rinsed extensively with 0.3 M PBS and stored in buffer solution. Gold was evaporated on one side only, leaving an unpassivated silicon/silicon oxide face. However, alkylthiol modified DNA did not adsorb appreciably to bare silicon oxide surfaces that were rinsed with PBS.
• the average number of oligonucleotides per particle was obtained by dividing the measured oligonucleotide molar concentration by the original Au nanoparticle concentration. Normalized surface coverage values were then calculated by dividing by the estimated particle surface area (assuming spherical particles) in the nanoparticle solution. The assumption of roundness is based on a calculated average roundness factor of 0.93. Roundness factor is computed as: (4 x pi x Area)/(perimeter x 2) taken from Baxes, Gregory, Digital Image Processing, p. 157 (1994).
• the fluorophore-labeled oligonucleotides were dehybridized by addition of NaOH (final concentration ⁇ 50 mM, pH 11-12, 4 hr). Following separation of the solution containing the 12'F from the nanoparticle solutions by centrifugation, and neutralization of the solutions by addition of 1 M HC1, the concentrations of hybridized oligonucleotide and corresponding hybridized target surface density were determined by fluorescence spectroscopy. K.
• the intensity of fluorescence associated with the solution free of nanoparticles can be used to determine how much oligonucleotide was released from the nanoparticles.
• the amount of oligonucleotide freed in exchange with ME increased until about 10 hours of exposure ( Figure 29), which is indicative of complete oligonucleotide displacement.
• the displacement reaction was rapid, which is presumably due to the inability of the oligonucleotide film to block access of the ME to the gold surface (Biebuyck et al., Langmuir 9:1766 (1993)).
• the average oligonucleotide surface coverage of alkylthiol-modified 12mer oligonucleotide (S12F) on gold nanoparticles was 34 + 1 pmol/cm 2 (average often independent measurements of the sample.) For 15.7 + 1.2 nm diameter particles, this corresponds to roughly 159 thiol-bound 12mer strands per gold particle. Despite slight particle diameter variation from batch to batch, the area-normalized surface coverages were similar for different nanoparticle preparations.
• Hybridized 12'F amounted to 1.3 + 0.2 pmol/cm (approximately 6 duplexes per 15.7 nm particle; the average number of duplexes per particle was computed by multiplying the normalized hybridized surface coverage in pmol/cm 2 by the average particle surface area as found from size distributions measured by TEM.).
• S12F modified gold nanoparticles were exposed to fluorophore-labeled non-complementary 12 base oligonucleotides (12F') in 0.3 M PBS.
• the interaction between oligonucleotides and the positively charged nanoparticle surface is expected to be even stronger.
• the high ionic strength medium effectively screens charge repulsion between neighboring oligonucleotides, as well as, attraction between the polyanionic oligonucleotide and the positively charged gold surface. This allows more oligonucleotides to bind to the nanoparticle surface, thereby increasing oligonucleotide surface coverage.
• a thiol modified 20 dA sequence (SA 20 ) [SEQ ID NO:55] proved to be suitable in terms of maintaining particle stability in the high ionic strength buffers which are needed for hybridization and protecting the surface from non-specific adso ⁇ tion.
• Nanoparticles were modified using solutions containing different recognition strand (SA 20 12F) to diluent (SA 20 ) strand molar ratios. The resulting particles were analyzed by the fluorescence method described above to determine the SA 20 12F surface density, and then tested for hybridization efficiency with 12'F.
• Sequence-selective DNA detection has become increasingly important as scientists unravel the genetic basis of disease and use this new information to improve medical diagnosis and treatment.
• Commonly used heterogeneous DNA sequence detection systems such as Southern blots and combinatorial DNA chips, rely on the specific hybridization of surface-bound, single-strand capture oligonucleotides complementary to target DNAs. Both the specificity and sensitivity of these assays are dependent upon the dissociation properties of capture strands hybridized to perfectly- matched and mismatched targets.
• a single type of nanoparticles hybridized to a substrate exhibits a melting profile that is substantially sha ⁇ er than both the analogous fluorophore-based system and unlabeled DNA.
• the melting temperature for the nanoparticle duplex is 11 degrees higher than for the analogous fluorophore system with identical sequences.
• a substrate was fabricated by functionalizing a float glass microscope slide (Fisher Scientific) with amine-modified probe oligonucleotides as described in Example 10. This method was used to generate slides functionalized with a single type of oligonucleotides over their entire surface or in arrays of multiple types of oligonucleotides spotted with a commercial microarrayer. Nanoparticles having indicator oligonucleotides attached to them and synthetic 30-mer oligonucleotide targets (based on the anthrax protective antigen sequence) were then cohybridized to these substrates (see Figure 32). Therefore, the presence of nanoparticles at the surface indicated the detection of a particular 30-base sequence.
• oligonucleotide- functionalized nanoparticles of the present invention can be further used to improve the selectivity of combinatorial oligonucleotide arrays (or "gene chips") (Fodor, Science 277, 393 (1997)).
• the relative ratio of target hybridized to different elements of an oligonucleotide array will determine the accuracy of the array in determining the target sequence; this ratio is dependent upon the hybridization properties of the duplex formed between different capture strands and the DNA target.
• these hybridization properties are dramatically improved by the use of nanoparticle labels instead of fluorophore labels.
• the ratio of target hybridized to complementary surface probes to that hybridized to mismatched probes after a stringency wash at a specific temperature is much higher with nanoparticle labels than fluorophore labels. This should translate to higher selectivity in chip detection formats.
• nanoparticle labels should increase array sensitivity by raising the melting temperature (T m ) of surface duplexes, which lowers the critical concentration below which duplexes spontaneously melt at room temperature.
• the synthetic target and either fluorescent-labeled or nanoparticle-labeled probes were hybridized stepwise to a ⁇ ays in hybridization buffer, and each step was followed with a stringency buffer wash at 35 °C.
• 20 ⁇ L of a 1 nM solution of synthetic target in 2 X PBS (0.3 M NaCl, 10 mM NaH 2 P0 /Na 2 HP0 4 buffer, pH 7) was hybridized to the array for 4 hours at room temperature in a hybridization chamber (Grace Bio-Labs Cover Well PC20), and then washed at 35°C with clean 2 X PBS buffer.
• Colorimetric, nanoparticle labeling of combinatorial oligonucleotide arrays will be useful in applications such as single nucleotide polymo ⁇ hism analysis, where single mismatch resolution, sensitivity, cost and ease of use are important factors.
• the sensitivity of this system which has yet to be totally optimized, points toward a potential method for detecting oligonucleotide targets without the need for target amplification schemes such as polymerase chain reaction.
• Glass slides were functionalized with 12-mer oligonucleotide 2 as described in Example 10.
• the substrates were first immersed in a 10 nM solution of 24-mer linker 3 (5'-TACGAGTTGAGAATCCTGAATGCG-3' [SEQ ID NO:60]) and allowed to hybridize with it for 4 hours at room temperature (see Figure 37).
• the substrates were washed with clean buffer solution, and then hybridized with a 2 nM solution of particle a for 4 hours at room temperature to attach the first nanoparticle layer.
• a second nanoparticle layer could be attached to the first one by similarly exposing the surface to solutions of linker 3 and nanoparticle b.
• the dissociation properties of the assembled nanoparticle multilayers were highly dependent upon the number of layers.
• the multilayer-coated substrates were suspended in buffer solution and the temperature raised above the T m of the linking oligonucleotides (53°C)
• the nanoparticles dissociated into solution, leaving behind a colorless glass surface.
• Increasing or decreasing the pH (>11 or ⁇ 3) or decreasing the salt concentration of the buffer suspension (below -0.01 M NaCl) also dissociated the nanoparticles by dehybridizing the linking DNA.
• the multilayer assembly was fully reversible, and nanoparticles could be hybridized to, and dehybridized from, the glass substrates (e.g. three cycles were demonstrated with no detectable irreversible nanoparticle binding).
• Electron transport through DNA has been one of the most intensely debated subjects in chemistry over the past five years. (Kelley et al, Science 283:375-381 (1999); Turro et al., JBIC 3:201-209 (1998); Lewis et al., JBIC 3:215-221 (1998); Ratner, M. Nature 397:480-481 (1999); Okahata et al., J. Am. Chem. Soc. 120:6165-6166 (1998)) Some claim that DNA is able to efficiently transport electrons, while others believe it to be an insulator.
• citrate-stabilized 13 nm gold nanoparticles were modified with 3' and 5' alkanethiol-capped 12-mer oligonucleotides 1 (3' SH (CH 2 ) 3 0(P0 2" )0-ATGCTCAACTCT 5' [SEQ ID NO:59]) and 2 (5' SH (CH 2 ) 6 0(P0 2" )0-CGCATTCAGGAT 3' [SEQ ID NO:50]) as described in Examples 1 and 3.
• DNA strands with lengths of 24, 48, or 72 bases (3 (5'TACGAGTTGAGAATCCTGAATGCG3 ' [SEQ ID NO:60]), 4
• 1-modified gold nanoparticles (652 ⁇ l, 9.7 nM) and 2-modified gold nanoparticles (652 ⁇ l, 9.7 nM) were added to linker DNA 3, 4 radical or 5 (30 ⁇ l, 10 nM). After full precipitation, the aggregates were washed with 0.3 M CH 3 COONH solution to remove excess linker DNA and NaCl.
• the dried DNA-linked aggregates could be redispersed in 0.3 M PBS buffer (1ml), and exhibited excellent melting properties; heating such a dispersion to 60 °C resulted in dehybridization of the DNA interconnects, yielding a red solution of dispersed nanoparticles.
• This combined with the FE-SEM data conclusively demonstrated that DNA-modified gold nanoparticles are not irreversibly aggregated upon drying.
• the conductivities of the aggregates formed from all three linkers ranged from 10 "s to 10 "4 S/cm at room temperature, and they showed similar temperature dependent behavior.
• the conductivities of the DNA-linked aggregates showed Arrhenius behavior up to about 190°K, which is characteristic of a semiconducting material. This is similar to the behavior of activated electron hopping observed in discontinuous metal island films (Barwinski, Thin Solid Films 128:1-9 (1985)).
• Gold nanoparticle networks linked by alkanedithiols have shown similar temperature dependence (Brust et al., Adv. Mater. 7:795-797 (1995); Bethell et al., J. Electroanal. Chem. 409:137-143 (1996)).
• Activation energies of charge transport can be obtained from a plot of In ⁇ versus 1/T using equation (1).
• the measured conductivities of the DNA-linked samples showed an anomalous dipping behavior.
• the conductivity started to decrease abruptly at approximately 190°K and continued to decrease until approximately 250°K, at which point it increased again.
• the electrical conductivity was measured as the sample was cooled and warmed repeatedly.
• the dip in conductivity only occurred in the direction of increasing temperature. Since DNA is hydrophilic and water could potentially affect the electrical properties of the hybrid structures, the effect of relative humidity on the conductivity of the gold aggregates was examined. The resistance increased by a factor of 10 with increasing humidity from 1% to 100%>. It should be noted that the characteristic dip was very weak when the sample was kept in vacuum (10 "6 Torr) for 48 hours prior to the conductivity measurement.
• Oligonucleotides 2 (5' SH(CH 2 ) 6 O(P0 2 -)O-CGC-ATT-CAG-GAT [SEQ ID NO:50]) were prepared and attached to 13 nm gold nanoparticles as described in Examples 1 andl8 to yield nanoparticles a.
• Target DNA 3 and nanoparticles a were added to the device. The color of the glass surface turned pink, indicating that target DNA-gold nanoparticle assemblies were formed on the glass substrate.
• the device was immersed in 0.3 M NaCl, 10 mM phosphate buffer and heated at 40 °C for 1 hour to remove nonspecifically bound DNA, and then treated with a silver staining solution as described in Example 19 for 5 minutes. The resistance of the electrode was 67 k ⁇ .
• a control device modified by attaching oligonucleotides 4, instead of oligonucleotides 1, between the electrodes.
• Oligonucleotides 4 have the same sequence (5' NH 2 (CH 2 ) 6 0(P0 2 -)O-CGC-ATT-CAG-GAT [SEQ ID NO:50]) as oligonucleotides 2 on the nanoparticles and will bind to target DNA 3 so as to prevent binding of the nanoparticles.
• the test was otherwise performed as described above. The resistance was higher than 40 M ⁇ , the detection limit of the multimeter that was used.
• Example 23 Preparation of Oligonucleotide-Modified Gold Nanoparticles using cyclic disulfide linkers
• a new cyclic disulfide linker for binding oligonucleotides to gold surfaces based on steroid disulfide la ( Figure 42) that is simple to prepare, is broadly useful, and affords gold-oligonucleotide conjugates exhibiting greater stability toward DTT than those prepared using mercaptohexyl linkers.
• a cyclic disulfide was selected as the reactive site of the anchor unit since ester derivatives of 1,2- dithiane-4,5-diol were known to form monolayers on gold surfaces (Nuzzo, et al., J. Am. Chem. Soc.
• oligonucleotide-gold probes used in previous studies were prepared by the reaction of oligonucleotides being terminal mercaptohexyl groups with gold nanoparticles in an aqueous buffer. They proved to be surprisingly robust, functioning well even after heating to 100°C or after storing for 3 years at 5 °C. We have found, however, that these conjugates lose activity as hybridization probes when soaked in solutions containing thiols, which act by displacing the derivatized oligonucleotides from the gold surface.
• the oligonucleotides were purified by reversed phase HPLC on a Dionex DX500 system equipped with a Hewlett Packard ODS Hypersil column (4.6 x 200 nm, 5 ⁇ m particle size) using TEAA buffer (pH 7.0) and a 1%/min gradient of 95% CH 3 CN/5% 0.03 TEAA at a flow rate of 1 mL/min.
• TEAA buffer pH 7.0
• a 1%/min gradient of 95% CH 3 CN/5% 0.03 TEAA at a flow rate of 1 mL/min A nice feature of the hydrophobic steroid group is that the capped derivatives separate cleanly from uncapped oligomers.
• Each of the modified oligonucleotides was immobilized on ⁇ 13 nm gold nanoparticles by the procedure used for anchoring oligonucleotides through a mercaptohexyl head group (Storhoff et al. (1998) J. Am. Chem. Soc. 120, 1959-1964). This involved soaking citrate stabilized nanoparticles ( ⁇ 13 nm in diameter) for 56 hours in a buffer-salt solution containing an oligonucleotide bearing a terminal sulfur substituent (HS- or acyclic or cyclic disulfide) followed by addition of NaCL to 0.1 M and 24h of standing.
• HS- or acyclic or cyclic disulfide a terminal sulfur substituent
• probes Icl, Ic2, IIcl, IIc2, and IIIcl by immobilizing the modified oligonucleotides on gold nanoparticles ( Figure 2).
• the oligomers in a given series have the same nucleotide sequence but differ in structure of the 5'-head group Y.
• Conjugates Icl and Ic2 have steroid-disulfide head groups; IIcl, IIc2, mercaptohexyl head groups; and IIIcl, acylic disulfide head groups.
• the (dA) 20 chains serve as spacers between the gold and the oligonucleotide recognition regions to facilitate hybridization. Many of the sulfur derivatized oligomers bind to each nanoparticle. Hybridization of pairs of nanoparticle probes with target oligonucleotides leads to formation of three dimensional networks and a change in color from red to blue- gray (Mucic, R. C, et al, J. Am. Chem. Soc. 120, 12674-12675).
• Hybridization of the probes was examined using a 79-mer oligonucleotide targets, containing sequences complementary to the probes (Figure 43).
• the reactions were carried out at room temperature by adding 1 ⁇ L of the target solution (10 pmol of IV) to colloidal solutions of the probe pairs Icl, Ic2, and IIcl and IIc2, and IIIcl and IIc2 (50 ⁇ L and 1.0 A 520 Unit of each nanoparticle probe) in 0.5 M NaCl, 10 mM phosphate (pH 7.0). At times 10 seconds, 5 minutes, and 10 minutes, aliquots (3 ⁇ L) were removed and spotted on a C-18 reversed phase TLC plate.
• colloidal probes derived from oligonucleotides with the mercaptohexyl (IIcl and IIc2) and acyclic oligonucleotide headgroups (IIIcl) reacted rapidly. A red-blue spot was obtained in 20 seconds and a strong blue spot within 5 minutes. By 100 minutes, most of the gold had precipitated. In contrast, no color change was observed for the reaction of the probes prepared with the steroid-cyclic disulfide head group (Icl, Ic2) within 40 minutes. It took 100 minutes to reach the same color obtained with probes prepared with IIcl, IIc2, or with IIIcl in 20 seconds.
• the rate of reaction of the steroid disulfide probes with DTT is of the order of l/300 th that of the other probes.
• the probe prepared from the acyclic disulifide anchor 3 c reacts at about the same rate as the probes prepared with the mercaptohexyl anchor.
• the latter result is not su ⁇ rising in view of evidence that the reaction of an acyclic disulfide with gold probably involves cleavage of the S-S bond (Zhong, C. J., Langmuir, 15, 518-525). Accordingly, an oligonucleotide with an acyclic head group would likely be linked to gold through a single sulfur atom, as in the case of mercaptohexyl-oligonucleotide derivatives.
• probes prepared from Icl and lc2 in fact still serve as hybridization probes after standing in the presence of DTT, we treated two samples of mixtures of the probes with DTT under the conditions used for the reactions in Table I. After 30 minutes, 1 ⁇ L of a solution of the 79-mer target oligonucleotide (10 pmol) was added to one. Both samples were frozen quickly, allowed to thaw, and assayed by the spot test.
• Gold nanoparticle-oligonucleotide conjugates made using this cyclic disulfide linker serve as effective probes for detecting specific oligonucleotide sequences, and they exhibit much greater stability toward dithiothreitol than corresponding conjugates prepared with the conventional mercaptohexyl group or an acyclic disulfide unit.
• the high stability toward thiol deactivation likely results, in part at least, from anchoring each oligonucleotide to gold through two sulfur atoms.
• Example 24 Preparation of Oligonucleotide-Modified Gold Nanoparticles using a simple cyclic disulfide linker.
• this Example we prepared a non-steroid cyclic disulfide linker and oligonucleotide-nanoparticle probes from this linker and evaluated the probes stability in the presence of thiol-containing solutions relative to probes prepared with steroidal cyclic disulfide and alkyl thiol linkers. Procedures have been described for preparing probes for detecting DNA or RNA sequences by binding oligonucleotides to gold nanoparticles using alkylthiol anchor groups, I, Figure 44 [C. A.
• the conjugates prepared using the steroid cyclic disulfide linker have proved advantageous in that they are much more stable in the presence of thiol compounds, such as mercaptoethanol or dithiothreitol (DTT), than are conjugates prepared using an alkylthiol anchor.
• thiol compounds such as mercaptoethanol or dithiothreitol (DTT)
• DTT dithiothreitol
• steroid cyclic anchor (compound 1, Figure 42): (1) the cyclic disulfide, which can in principle provide two binding sites that could act cooperatively in holding a given oligonucleotide at the gold surface, and (2) the steroid unit which could stabilize neighboring chains on the gold by hydrophobic interactions (see for example, R. L. Letsinger et al, J. Am. Chem. Soc. 115, 7535 (1993). To assess the importance of these contributions we have prepared and examined gold conjugates anchored by a cyclic disulfide lacking a steroid group, compound IIIc ( Figure 44).
• Compound 2a prepared by heating trans- l,2-dithiane-4,5-dithiol with acetol in toluene, was converted to a cyanoethyl N,N-di-i-propyl phosphoramidite reagent, 2b , which was employed in the final coupling step in the synthesis of modified oligonucleotides 2cl and 2c2.
• One gold conjugate probe was prepared by treating a gold colloid solution with 2c 1 and an equimolar amount of 2d, which serves a diluent on the gold surface.
• a companion probe was made from 2c2 and 2d in the same way.
• oligonucleotides 2c 1 and 2d or 2c2 and 2d were added to 13 nm gold colloids (- 10 nM) to provide solutions containing 1.7 ⁇ mole/mL of each oligonucleotide.
• the solutions were stored in the dark for 24 h; then salts were added to make the solutions 0.3 M in NaCl, 10 mM in phosphate (pH 7.0), and 0.01% in sodium azide. After 24 h the NaCl concentration was increased to 0.8 M and the solution were allowed to stand for another 24 h. The colloid was then filtered to remove any aggregates and the solution was centrifuged to collect the nanoparticles.
• Displacement studies were carried out at room temperature (22°C) by adding 2 ⁇ L of 0.1 M DTT to 20 ⁇ L of a mixture of equal volumes of the colloidal conjugates obtained from 2c 1 and 2c2. Aliquots (3 ⁇ L) were periodically removed and spotted onto a white Nylon membrane. Initially the spots were red. Displacement of the oligonucleotide sulfur derivatives from the gold by DTT led to mixtures that afforded a blue-gray spot in the spot test. The time for displacement by DTT was taken as the time for the mixture to give a strong blue-gray color in a spot test. For the mixture of conjugates derived from 2c 1 and 2c2 this time was 10 hours.
• oligonucleotide conjugates were similarly prepared from oligonucleotide sequences cl and c2 ( Figure 44) using the mercaptohexyl anchor (compound 2, Figure 42) and the steroid cyclic disulfide anchor (compound 1, Figure 42).
• 5'-DMT groups were subsequently removed by dissolving the oligonucleotide in 80% acetic acid for 30 min, followed by evaporation.
• the oligonucleotide was redissolved in 500 ⁇ L nanopure water and the solution was exfracted with ethyl acetate (3 x 300 ⁇ L). After evaporation of the solvent, the oligonucleotide was obtained as a white solid.
• the retentipn time of this 5'- tri- disulfide oligonucleotide with no DMT group was around 35 minutes on reverse phase, columns while 24 minutes on the ion-exchange column.
• oligonucleotide 8 ( Figure 45) was obtained by electrospray MS (calculated: 12242.85, found 12244.1). The three disulfide groups on the DNA stand were reduced tri thiol groups as described above for 5' monothiol DNA; then the oligonucleotide was purified though a NAP-5 column.
• single thiol oligonucleotide (l)-modified 30 nm gold particles quickly form an aggregate in 0.017M DTT; after 1.5 hours, the colloid totally turns blue.
• the solution containing disulfide oligonucleotide (4)-modified nanoparticles turns blue after 20 hours under identical conditions.
• the trithiol-oligonucleotide (cleaved 6) modified nanoparticles it took 40 h to turn the solution blue.
• Example 26 Detection of an analyte using a nanoparticle-nucleic acid-sfp member conjugate
• This example demonstrates the detection of an analyte (biotin) using a nanoparticle-streptavidin probe ( Figures 54 and 56).
• Nanoparticle-nucleic acid conjugates are prepared as described in Example 3.
• the oligonucleotide modifier used to prepare these conjugates have the following sequence: 5'SH(CH 2 ) 6 -A 10 -CGCATTCAGGAT 3' (2)(SEQ ID NO: 74).
• biotin labeled oligonucleotide (1) [3' biotin-TEG-A 10 -ATGCTCAACTCT 5'] (SEQ ID NO: 73) is prepared by literature procedure using a Biotin TEG CPG support (Glen Research, Sterling, Virginia; Catalog no. 20-2955-01).
• streptavidin was.reacted with 1 equivalent of biotin-modified oligonucleotides in 20 mM Tris (pH 7.2), 0.2 mM EDTA buffer solution at room temperature for 2 h on a shaker. Streptavidin complexed to different numbers of oligonucleotides were separated by ion exchange HPLC with 20 mM Tris (pH 7.2) and a 0.5 %/min gradient of 20 mM Tris, 1 M NaCl at a flow rate of 1 mL/min, while monitoring the UV signal of DNA at 260 nm and 280 nm.
• the streptavidin/biotin-modified oligonucleotide mixture showed four peaks at 45 min, 56 min, 67 min and 71 min, which correspond to the 1:1, 2:1, 3:1, and 4:1 oligonucleotide-streptavidin complexes, respectively.
• the 1:1 complex of streptavidin/oligonucleotide (10 uM, 5uL) was isolated and premixed with linker DNA [5'TACGAGTTGAGAATCCTGATTGCG3'] (3) (SEQ ID NO: 76) (lOuM, 5uL) in 0.3 M PBS (0.3 M NaCl, 10 mM phosphate buffer, pH 7) and then the mixture was added to the nanoparticle-oligonucleotide conjugates (10 nM, 130 uL) in 0.3 M PBS to prepare a nanoparticle-oligonucleotide-strepavidin conjugate.
• linker DNA [5'TACGAGTTGAGAATCCTGATTGCG3'] (3) (SEQ ID NO: 76) (lOuM, 5uL) in 0.3 M PBS (0.3 M NaCl, 10 mM phosphate buffer, pH 7) and then the mixture was added to the nanoparticle-oligonucleotide conjugates (10 nM,
• nanoparticle-oligonucleotide conjugates streptavidin oligonucleotide, and linker DNA was frozen in dry ice for 10 min and thawed to facilitate DNA hybridization. After 12 hr, the solution was centrifuged at 10000 ⁇ m for 20 min and supernatent was removed. Red oily precipitate of nanoparticle-oligonucleotide-strepavidin conjugate was redispersed in 0.3 M PBS buffer.
• nanoparticle-oligonucleotide-strepavidin conjugate was then used to detect for the presence of a target analyte, biotin immobilized onto a glass surface, (b) Detection of biotin Biotin was immobilized to a glass slide according to the following procedure: Oligonucleotide modified glass slide was prepared by previously reported method (Science, 2000, 289, 1757-1760) and then the biotin modified oligonucleotide was hybridized to the surface DNA. (Biotin modified glass slide can be prepared by various method.
• One example is to prepare amine modified glass slide and then react the surface amine with various commercially available biotinylation reagents which react with amine.)
• the immobilized biotin glass slide was then treated with a medium containing the nanoparticle-oligonucleotide-streptavidin (2 nM in 0.3 M PBS).
• the presence of the captured probe was demonstrated, after washing and treating with silver enhancing solution [silver enhancer solution A (catalog no. S5020, Sigma Company, St. Louis, MO, USA) and silver enhancer solution B (catalog no. S 5145, Sigma Company), see also Science, 2000, 289, 1757], by the appearance of a gray or shiny silver spot.
• Example 27 Specific binding comparison of gold colloid strepavidin conjugates
• nonspecific binding of the nanoparticle streptavidin probe prepared in accordance with Example 26 and a commercial Au colloid (20 nm)/ streptavidin conjugate full name: streptavidin-gold labeled
• specific binding pair members e.g., receptors or ligands
• Biotin modified DNA (2) was synthesized with Biotin TEG CPG support (Glen Research) and purified by literature methods. See J. J. Storhoff, R. Elghanian, R. C. Mucic, C. A. Mirkin, R. L. Letsinger, J. Am. Chem. Soc. 1998, 120, 1959; T. Brown, D. J. S. Brown, in Oligonuclieotides and Analogues (Ed.: F.
• Streptavidin was purchased from Sigma and dissolved in 20 mM Tris buffer (30 ⁇ M, pH 7.2). To make the streptavidin/DNA conjugate (1-STV), streptavidin was reacted with 8 equivalents of biotin-oligonucleotide conjugate 1 in 20 mM Tris (pH 7.2), 0.2 mM EDTA buffer solution at room temperature for 2 h on a shaker.
• the biotin-oligonucleotide conjugate has the sequence: [3' biotin- TEG-A ⁇ o-ATGCTCAACTCT5'](SEQ ID NO:73).
• streptavidin DNA conjugates were separated from excess DNA by ion exchange HPLC with 20 mM Tris (pH 7.2) and a 0.5 %/min gradient of 20 mM Tris, 1 M NaCl at a flow rate of 1 mL/min, while monitoring the UV signal of DNA at 260 nm and 280 nm.
• Purified streptavidin-biotinylated DNA conjugates were concentrated and dispersed in 0.3 M PBS by ultrafiltration (centricon 30). Aggregates for TEM, thermal denaturation experiments, and SAXS measurements were prepared by freezing the solution containing 1-STV, 2-Au, and 3 in dry ice for 10 min, and thawed prior to the measurement to facilitate hybridization.
• linker DNA 3 (10 ⁇ M, 21 ⁇ L) was introduced to the mixture of 2-Au (9.7 nM, 260 ⁇ L) and 1-STV (1.8 ⁇ M, 27 ⁇ L), or linker DNA 3 (10 ⁇ M, 21 ⁇ L) was premixed with 1-STV (1.8 ⁇ M, 27 ⁇ L) and then the mixture was added to 2-Au (9.7 nM, 260 ⁇ L) in 0.3 M PBS. Aggregates with similar properties could be formed by both methods, but premixing 3 and 1-STV facilitates aggregate formation. Since a 13 nm gold nanoparticle is substantially larger than streptavidin (4 nm x 4 nm x 5 nm) [P. C.
• the transmission electron microscopy (TEM) image ( Figure 57B) shows that the particles within the aggregates retain their physical shape prior to and after annealing, showing no particle fusion and further demonstrating the stabilizing influence of the surface oligonucleotide layer.
• This requirement of thermal activation for initiating particle assembly is in contrast to the previously studied system involving two gold nanoparticle conjugates ( Figure 52 b) where, under very similar conditions, the oligonucleotide-modified gold particle ' s assemble into aggregates within a few minutes upon adding linker DNA at room temperature.
• An Au nanoparticle/protein assembly also could be formed through streptavidin/biotin interactions as opposed to hybridizatiori-induced assembly.
• 3 (10 ⁇ M, 32 ⁇ L) and 2-modified nanoparticles (Au nanoparticle concentration: 9.7 nM, 260 ⁇ L) were mixed in 0.3 M PBS buffer to generate biotin-modified Au particles.
• the mixture was heated to 60 °C for 10 min and then cooled to room temperature to facilitate hybridization.
• q (47r/ ⁇ )sin(0/2)
• p particle number density.
• the nearest neighbor Au inte ⁇ article distances (center to center distance) obtained from the PDDFs are 19.3 nm, 25.4 nm, 28.7 nm, and 40.0 nm for the 24-mer linked Au-Au, 48-mer linked Au-Au, 24-mer linked Au-STV, and 48-mer linked Au-STV assemblies, respectively.
• a comparison of the inte ⁇ article distances for the Au- STV system and the Au-Au system clearly shows that the Au-STV assembly has the anticipated Au nanoparticle/streptavidin periodicity and that the two components (Au nanoparticle and streptavidin) are well separated by rigid DNA duplex linkers.
• This process can accelerate the movement of probes to an electrode surface with "captured target” or a set of probes that have captured target in solution to a surface of interest.
• the inventive method has important biodiagnostic applications that utilize nanoparticle-based probes. For example, it can be used to accelerate hybridization of a nanoparticle probe or set of probes to a surface functionalized with complementary DNA or a complementary antigen/antibody.
• Test oligonucleotide targets were synthesized by automated solid phase synthesis, and oligonucleotide arrays were fabricated on glass microscope slides using literature procedures.
• 50 nm and 100 nm diameter gold nanoparticles were functionalized with dithiane-terminated oligonucleotides and isolated by literature methods.
• oligonucleotide-nanoparticle conjugates and oligonucleotide targets were cohybridized to the DNA arrays in 0.3 M PBS hybridization buffer [0.3 M NaCl, 10 nM NaH 2 PO_t/Na 2 HP0 ' pH 7] at room temperature for 2 h. [ See Examples 30 and 31 below]. The arrays were then washed with clean buffer to remove unhybridized target and nanoparticle probes.
• the array slides were mounted on a microscope stage and illuminated in the plane of the slide by a fiber optic illuminator [Darklite Illuminator (Micro Video Instruments, Avon, MA)]; in this configuration, the slide served as a planar waveguide, preventing any light from reaching the microscope objective by total internal reflectance.
• a fiber optic illuminator Darklite Illuminator (Micro Video Instruments, Avon, MA)]
• the slide served as a planar waveguide, preventing any light from reaching the microscope objective by total internal reflectance.
• evanescently coupled light [M ⁇ ller, G. J. In Multichannel Image Detectors; Talmi, Y., Ed.; ACS Symposium Series 102; American Chemical Society: Washington, DC, 1979; pp 239-262] was scattered out of the guide plane and was imaged as bright, ⁇ colored spots on a dark background.
• oligonucleotide synthesis was performed on an Expedite 8909 Nucleic Acid Synthesizer (Applied Biosystems, Foster City, CA) using standard phosphoramidite chemistry. All the reagents required for oliognucleotide synthesis were purchased from
• Aqueous solutions of 50 nm and 100 nm diameter gold nanoparticles were used as received.
• To 10 mL of gold colloid solution was added 1.5 nmol of 5 '-steroid disulfide-modified oligonucleotide, prepared using literature procedures [Letsinger, R.L.; Elghanian, R.; Viswanadham, G.; Mirkin, CA. Bioconjugate Chem. 2000, 11, 289], in water.
• the solution was brought to 0.3 M NaCl, 10 mM NaH 2 P0 4 /Na 2 HP0 4 ⁇ H 7 buffer (0.3 M PBS) gradually by adding aliquots of 2 M NaCl and 0.1 M NaH 2 P0 4 /Na 2 HP0 4' pH 7 buffer solutions every 4 hours. After 48 hours, the particle solutions were centrifuged (for 50 nm gold nanoparticles: 5000 m for 10 min, for 100 nm gold nanoparticles: 2500 ⁇ m for 10 min) in an ultracentrifuge (Avanti 30, Beckman Instruments, Fullerton, CA) to yield a colorless supernatant above a dark red oily precipitate.
• the dark red oily precipitate was redispersed in fresh 0.3 M PBS buffer (7 mL and 4 mL for 50 nm and 100 nm gold colloids). Centrifugation and redispersion was repeated twice. The final concentrations of the product nanoparticle solutions were estimated from their measured visible abso ⁇ tion of 520 nm and published values for extinction coefficients of the unmodified particles [Yguerabide, J. and Yguerabide, E.E. Anal. Biochem.
• APS-modified slides were rinsed thoroughly with nanopure water and ethanol, dried under N 2 and baked at 120-130 °C for 20 min. Upon cooling, silanized slides were immediately treated with 2mM solution of succinimidyl 4-[malemidophenyl]-butyrate (SMPB) in 4:1 ethanolDMSO. The slides were allowed to soak in the SMPB solution overnight, rinsed with ethanol and dried under N 2 .
• SMPB succinimidyl 4-[malemidophenyl]-butyrate
• the slides were subsequently immersed in 1 : 1 :4 acetic anhydride:pyridine:DMF for 2h, washed with water and dried under N 2 .
• the SMPB- modified slides were then loaded into a robotic microarrayer (GMS 417, Genetic
• Glass slides were first functionalized with either DNA sequence c or d over their entire surface by the method described above for DNA microarray fabrication, except that spotting of an array was replaced by immersion of the entire slide in lmM 3 '-thiol- modified capture oligonucleotide c or d.
• model DNA arrays were prepared to evaluate the selectivity of the inventive scattering detection method described in Example 30.
• An oligonucleotide array was first fabricated by spotting with the four thiol- modified oligonucleotide sequences shown in Figure 61B.
• a 100 ⁇ L hybridization well as attached to the array and filled with a 0.3 M PBS buffer solution made 10 nM in oligonucleotide-functionalized 50 nm diameter gold nanoparticle probes and 200 nM in a 30-mer oligonucleotide target bearing an thymidine at position 8 (complementary to the chip sequence with X A, Figure 61B).
• the slide assembly was shaken for 2 h at room temperature, the hybridization well removed, and the array washed three times with clean 0.15 M PBS buffer.
• Arrays were prepared and incubated with 50 nm nanoparticle probes (10 nM in 0.3 M PBS) and oligonucleotide target as described above for the selectivity experiments, but with target concentrations varying from 1 ⁇ M down to 10 fM.
• the slide assembly was shaken for 2 h at room temperature, the hybridization well removed, and the array washed three times with clean 0.15 M PBS buffer.
• the data obtained is shown in Figure 67.
• the lowest concentration that can be statistically distinguished from background (> 2 ⁇ ) is 1 pM.
• Example 32 Assay-based electrical detection of DNA using nanoparticle probes and a salt-based stringency wash
• a model DNA array was prepared to evaluate the unusual salt- dependence on the melting properties of the hybridized particles and the use of a salt- based stringency wash, in place of a thermal stringency wash, to differentiate binding events involving mismatached strands from ones based upon perfectly complementary recognition elements.
• microelectrode preparation In a typical experiment, microelectrodes (60 nm Au on 5nm Ti) with 20 ⁇ m gaps were prepared by standard photolithography on a Si wafer with 1000 angstrom coating of Si0 2 ( Figure 68C). The exposed Si0 2 of the entire chip was modified with succinimidyl 4-[malemidophenyl]-butyrate (SMPB, Sigma Chemical, St. Louis, MO) using literature methodology (T. A. Taton, C. A. Mirkin, R. L. Letsinger, Science 289, 1757 (2000); L. A. Chrisey, G. U. Lee, C. E. O'Ferrall, Nucl. Acids Res. 24, 3031-3039 (1996)).
• SMPB succinimidyl 4-[malemidophenyl]-butyrate
• Capture oligonucleotide strands were immobilized onto the activated surface by spotting 0.3 M NaCl, 10 mM phosphate buffer (pH7) solutions (0.3 M PBS) of the appropriate alkylthiol-modified oligonucleotide (1 mM) in the electrode gaps by manual pipetting. All the oligonucleotides used in this study were prepared by automated solid phase syntheses (J. J. Storhoff, R. Elghanian, R. C Mucic, C. A. Mirkin, R. L. Letsinger, J. Am. Chem. Soc. 120, 1959-1964 (1998), F.
• the chip was stored in a humidity chamber for 24 h allowing the coupling reaction between the SMPB and alkylthiol capped DNA to take place. The chip was then washed with water and immersed in 2% mercaptohexanol in ethanol for 2 h to passivate the chip, including the Au electrodes. Finally, the DNA- functionalized chip was washed with ethanol and water and then dried under a stream of N 2 .
• the chip was treated with 0.3 M PBS solution of target DNA (10 nM) for 4 h, then rinsed with 0.3 M PBS solution. Thereafter, the chip was treated with a 0.3 M PBS solution of nanoparticle probes (2 nM) for 2 h.
• the DNA chip was rinsed with 0.3 M NaN0 3 in 10 mM phosphate buffer (pH 7) to remove chloride ions and then treated with a silver enhancer solution (Sigma
• the silver enhancer solution was replaced every 2 or 3 minutes to avoid the formation of silver particulate in solution.
• the chip was rinsed with water, dried with N 2) and the resistance values across the electrode gaps were measured using a Fluke 189 multimeter (Fluke, Everett, WA).
• the gaps with the four different oligonucleotide capture strands exhibit gap resistances larger than 500 M ⁇ , the limit of the multimeter used in the experiment, Figure 69A. In the absence of a stringency wash, the gap resistances decrease with increasing exposure to the silver enhancer solution.
• the particles are complex materials and when considered on an individual basis, must have slightly different levels of oligonucleotide functionalization and, therefore, different activities with respect to their ability to promote the reduction of Ag + to Ag by hydroquinone.
• target DNA In the absence of target DNA, there was no detectable signal even after 40 minutes of silver enchancing.
• target at 500 fM concentration was detected without effort to optimize the system.
• the detection limit of a conventional system based on fluorescence that utilizes a confocal microscope, these oligonucleotide strands, and a Cy3 -modified probe is -5 pM (T. A. Taton, C A. Mirkin, R. L. Letsinger, Science 289, 1757 (2000)).
• a conventional way of increasing target selectivity is to wash a DNA chip array with a buffer solution at a temperature that results in the dehybridization of DNA. duplexes formed from noncomplementary strands (G. H. Keller, M. M. Manak, DNA Probes (Stocktonton Press, New York, 1989)). It was previously shown that other nanoparticle-based DNA detection methods exhibit unusually high specificity due to the sha ⁇ melting transitions associated with duplex structures formed from oligonucleotide- modified probes and complementary oligonucleotides. (T. A. Taton, C A. Mirkin, R. L. Letsinger, Science 289, 1757 (2000).
• oligonucleotide-modified nanoparticles exhibit unusually sha ⁇ denaturation properties over salt concentration gradients, Figure 69C. Indeed, by examining the absorbance at 520 nm of two glass cuvettes functionalized with the complementary capture strand/target strand/probe complex and the capture strand with G-T mismatch/target/probe complex, respectively, as function of solution Na + concentration, the mismatched oligonucleotides can be easily differentiated from the complementary target. Significantly, one obtains better differentiation of the two strands using changes in salt concentration as opposed to changes in temperature, Figure 69C (inset).
• this system is based upon conventional microelectrodes, it is useful for massive multiplexing through the use of larger arrays of electrode pairs than the four used in this Example.
• the invention is useful for portable, point- of-site DNA detection method for single-nucleotide polymo ⁇ hism screening, and although the sensitivity of this system has not been fully optimized, it already is superior to the analogous fluorescence-based approach based on a confocal fluorescence microscope. By decreasing gap size, which will decrease the number of particles required to close the circuit, the sensitivity of this system should be dramatically improved.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Immunology (AREA)
• Physics & Mathematics (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Analytical Chemistry (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (5)

Publications (2)

Family

ID=32684383

Family Applications (1)

Country Status (5)

Cited By (7)

Families Citing this family (47)

Citations (1)

Family Cites Families (2)

• 2002
  • 2002-10-08 EP EP02799155A patent/EP1478774A4/de not_active Withdrawn
  • 2002-10-08 WO PCT/US2002/032088 patent/WO2003035829A2/en active IP Right Grant
  • 2002-10-08 JP JP2003538330A patent/JP4347049B2/ja not_active Expired - Lifetime
  • 2002-10-08 CA CA2463323A patent/CA2463323C/en not_active Expired - Fee Related
  • 2002-10-08 AU AU2002363062A patent/AU2002363062B2/en not_active Ceased

Patent Citations (1)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events