EP1180149A2 - Surexpression d'une sequence d'adn codant pour une 1-desoxy-d-xylulose-5-phosphate reductoisomerase a l'interieur de plantes - Google Patents

Surexpression d'une sequence d'adn codant pour une 1-desoxy-d-xylulose-5-phosphate reductoisomerase a l'interieur de plantes

Info

Publication number
EP1180149A2
EP1180149A2 EP00922642A EP00922642A EP1180149A2 EP 1180149 A2 EP1180149 A2 EP 1180149A2 EP 00922642 A EP00922642 A EP 00922642A EP 00922642 A EP00922642 A EP 00922642A EP 1180149 A2 EP1180149 A2 EP 1180149A2
Authority
EP
European Patent Office
Prior art keywords
plants
plant
dxpri
dna sequence
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00922642A
Other languages
German (de)
English (en)
Inventor
Hartmut Lichtenthaler
Jörg SCHWENDER
Andreas Reindl
Karin Herbers
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1180149A2 publication Critical patent/EP1180149A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis

Definitions

  • the invention relates to a DNA coding for a polypeptide with l-deoxy-D-xylulose-5-phosphate reductoisomerase (DXPRI) activity of plant origin.
  • DXPRI l-deoxy-D-xylulose-5-phosphate reductoisomerase
  • the invention relates to the use of DNA sequences coding for a polypeptide
  • DXPRI activity of plant origin for the production of plants with an increased content of tocopherols, carotenoids, vitamin K, chlorophylls and polyterpenes in particular the use of the DNA sequence SEQ-ID No. 1 or with this hybridizing DNA sequences, a process for the production of plants with an increased content of tocopherols, carotenoids, vitamin K, chlorophylls and polyterpenes, and the plant itself prepared in this way.
  • the eight naturally occurring compounds with vitamin E activity are derivatives of 6-chromanol (Ullmann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, vitamin E).
  • the first group (la-d) is derived from tocopherol, the second group consists of derivatives of tocotrienol (2ad):
  • ⁇ -Tocopherol is of great economic importance.
  • the genetic engineering process for example isolating the essential biosynthesis genes coding for the tocopherol synthesis performance and transferring them in crop plants in a targeted manner, is superior to the classic breeding method. This method assumes that biosynthesis and its regulation are known and that genes that influence biosynthesis performance are identified.
  • Isoprenoids or terpenoids consist of different classes of lipid-soluble molecules and are partially or completely formed from Cs-isoprene units.
  • Pure prenyl lipids e.g. carotenoids
  • mixed prenyl lipids e.g. chlorophylls, tocopherols and vitamin K
  • isoprenoid side chain that is linked to an aromatic nucleus.
  • the starting point for the biosynthesis of prenyl lipids are 3 x acetyl-CoA units, which via ß-hydroxymethylglutaryl-CoA (HMG-CoA) and mevalonate into the starting isoprene unit (C5), the isopentenyl pyrophosphate (IPP). It has recently been shown by in vivo feeding experiments with C 13 that in various eubacteria, green algae and plant chloroplasts a Mevalonate-independent path to the formation of IPP is followed (Figure 1).
  • Hydroxyethylthiamine which is formed by the decarboxylation of pyruvate, and glyceraldehyde-3-phosphate (3-GAP) are converted into a "transketolase” mediated by 1-deoxy-D-xylulose-5-phosphate synthase (DOXS) "Reaction first converted to l-deoxy-D-xylulose-5-phosphate (Lange et al, 1998; Schwender et al, 1997; Arigoni et al, 1997; Lichtenthaler et al, 1997; Sprenger et al, 1997).
  • DOXS 1-deoxy-D-xylulose-5-phosphate synthase
  • the mevalonate-independent route is localized plastidically and leads primarily to the formation of carotenoids and plastidic prenyl lipids (Schwender et al, 1997; Arigoni et al, 1997).
  • IPP is in equilibrium with its isomer, dimethylallyl pyrophosphate (DMAPP).
  • DMAPP dimethylallyl pyrophosphate
  • a condensation of IPP with DMAPP in head-tail attachment gives the monoterpene (C10) geranyl pyrophosphate (GPP).
  • GPP monoterpene
  • IPP units leads to the sesquiterpene (C15) farnesy pyrophosphate (FPP) and to the diterpene (C20) geranyl-geranyl pyrophosphate (GGPP). Linking two GGPP molecules leads to the formation of the C40 precursors for carotenoids.
  • the isoprene side chain of various lengths is connected to non-isoprene rings, such as a porphyrin ring in chlorophyll a and b.
  • the chlorophylls and phylloquinones contain a C20 phytyl chain in which only the first isoprene unit contains a double bond.
  • GGPP is transformed by geranylgeranyl pyrophosphate oxidoreductase (GGPPOR) into phytyl pyrophosphate (PPP), the starting material for the further formation of tocopherols.
  • the ring structures of the mixed prenyl lipids that lead to the formation of vitamins E and K are quinones, the starting metabolites of which come from the Shikimate pathway.
  • the aromatic amino acids phenylalanine and tyrosine are converted into hydroxyphenyl pyruvate, which is converted into homo- gentisic acid is transferred.
  • the chorismat is on the one hand
  • phenylalanine ammonium lyase catalyzes the breakdown of phenylalanine, i.e. it removes it from phenylpropanoid biosynthesis (BHencee et al., Proc. Natl. Acad. Sei USA 91 (16): 7608-7612 (1994); Howles et al., Plant Physiol. 112, 1617-1624 (1996)).
  • the object of the present invention was to develop a transgenic plant with an increased content of tocopherols, vitamin K, carotenoids, chlorophylls and polyterpenes.
  • the object was surprisingly achieved by overexpressing an 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXPRI) gene in the plants.
  • DXPRI 1-deoxy-D-xylulose-5-phosphate reductoisomerase
  • DXPRI 2-C-methyl-D-erythritol-4-P
  • the activity of DXPRI in transgenic plants was increased by overexpressing the DXPRI gene from Arabidopsis thaliana. In principle, this can also be achieved by expressing homologous or heterologous DXPRI genes 5.
  • a nucleotide sequence coding for a DXPRI has been described from E. coli (accession number AB 013300; Kuzuyama et al., 1998; Takahashi et al., 1998).
  • a plant DXPRI gene (Fig. 2, 10 SEQ-ID No. 1) from Arabidopsis thaliana is described for the first time and is increasingly expressed in transgenic plants.
  • the DXPRI nucleotide sequence from Arabidopsis thaliana is preceded by a transit signal sequence (Fig. 3, Fig. 4).
  • Fragment A (529 bp) in Figure 4 contains the 35S-15 promoter of the Cauliflower Mosaic Virus (nucleotides 6909 to 7437 of the Cauliflower Mosaic Virus).
  • Fragment B (259 bp) contains the transit peptide of the transketolase.
  • Fragment E contains the DXPRI gene.
  • Fragment D (192 bp) contains the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 20 1984) for transcription termination.
  • a DNA sequence which codes for a DXPRI gene which is identified by SEQ-ID No. 1 hybridizes and that comes from other organisms or from other plants.
  • the transgenic plants are produced by transforming the plants with a construct containing the DXPRI gene.
  • Tobacco and rapeseed were used as model plants for the production of tocopherols, vitamin K, carotenoids, chlorophylls and polyterpenes.
  • Fragment A (529 bp) in Figure 5 contains the 35S promoter of the Cauliflower mosaic virus (nucleotides 6909 bis
  • Fragment B (259 bp) contains the transit peptide of transketolase ( Figure 3).
  • Fragment E contains the DXPRI gene in antisense orientation.
  • Fragment D (192 bp) contains the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984)
  • the invention relates to the use of the DNA sequence SEQ-ID No. 1 from Arabidopsis thaliana, which code for a DXPRI or its functional equivalents, for producing a plant with an increased content of tocopherols, carotenoids, vitamin K, chlorophylls and polyterpenes.
  • the nucleic acid sequence can e.g. be a DNA or cDNA sequence. Coding sequences suitable for insertion into an expression cassette are, for example, those which code for a DXPRI and which give the host the ability to overproduce tocopherols, carotenoids, vitamin K, chlorophylls and polyterpenes.
  • the expression cassettes also contain regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell.
  • an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are operatively linked to the intervening coding sequence for the DXPRI gene.
  • An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.
  • sequences preferred but not limited to the operative linkage are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the cell nucleus, in oil cells or other compartments and translation enhancers such as the 5 'guiding sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).
  • the plant expression cassette can be installed in the tobacco transformation vector pBinAR-Hyg.
  • Fig. 6 shows the tobacco transformation vectors pBinAR-Hyg with 35S promoter (A) or pBinAR-Hyg with seed-specific promoter Phaseolin 796 (B):
  • any promoter which can control the expression of foreign genes in plants is suitable as promoters of the expression cassette.
  • a plant promoter or a plant virus-derived promoter is preferably used.
  • the CaMV 35S promoter from the cauliflower mosaic virus is particularly preferred (Franck et al., Cell 21 (1980),
  • this promoter contains different recognition sequences for transcriptional effectors, which in their entirety lead to permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).
  • the expression cassette can also contain a chemically inducible promoter, by means of which the expression of the exogenous DXPRI gene in the plant can be controlled at a specific point in time.
  • a chemically inducible promoter by means of which the expression of the exogenous DXPRI gene in the plant can be controlled at a specific point in time.
  • promoters as e.g. the PRPl promoter (Ward
  • 25 ethanol or cyclohexanone inducible (WO 93/21334) promoter can include be used.
  • promoters are particularly preferred which ensure expression in tissues or parts of plants in which
  • a foreign protein was able to stably express up to 0.67% of the total soluble seed protein in the seeds of transgenic tobacco plants.
  • the expression cassette can therefore, for example, be a seed-specific promoter (preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad.
  • An expression cassette is produced by fusing a suitable promoter with a suitable DXPRI-DNA sequence and preferably a DNA inserted between the promoter and DXPRI-DNA sequence, which codes for a chloroplast-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J.
  • Sequences are particularly preferred which ensure targeting in the apoplasts, in plastids, in the vacuole, in the mochondrium, in the endoplasmic reticulum (ER) or by a lack of corresponding operative sequences to ensure that they remain in the compartment of formation, the cytosol ( Kermode, Crit. Rev. Plant Sei. 15, 4 (1996), 285-423). Localization in the ER has proven to be particularly beneficial for the amount of protein accumulation in transgenic plants (Schouten et al., Plant Mol. Biol. 30 (1996), 781-792).
  • Transit peptides are preferred for the chloroplasts, which are cleaved enzymatically from the DXPRI part after translocation of the DXPRI gene into the chloroplasts.
  • Particularly preferred is the transit peptide derived from the plastid DXPRI or a functional equivalent of this transit peptide (e.g. the Rubisco small subunit transit peptide or the Ferredoxin NADP oxidoreductase).
  • DNA sequences from three cassettes of the plastid transit peptide of potato plastid transketolase in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:
  • the inserted nucleotide sequence coding for a DXPRI can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural DNA components, as well as consist of different heterologous DXPRI gene sections of different organisms.
  • synthetic nucleotide sequences are generated with codons that are preferred by plants. These codons preferred by plants can be determined from codons with the highest protein frequency, which are expressed in most interesting plant species.
  • various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame.
  • adapters or linkers can be attached to the fragments.
  • the promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence.
  • the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites.
  • the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges.
  • the promoter can be native or homologous as well as foreign or heterologous to the host plant.
  • the expression cassette contains in the 5 '-3' transcription direction the promoter, a DNA sequence which codes for a DXPRI gene and a region for the transcriptional termination. Different termination areas are interchangeable.
  • Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.
  • An expression cassette can contain, for example, a constitutive promoter (preferably the CaMV 35 S promoter), the LeB4 signal peptide, the gene to be expressed and the ER retention signal.
  • a constitutive promoter preferably the CaMV 35 S promoter
  • the amino acid sequence KDEL lysine, aspartic acid, glutamic acid, leucine
  • KDEL lysine, aspartic acid, glutamic acid, leucine
  • the fused expression cassette which codes for a DXPRI gene, is preferably cloned into a vector, for example pBin19, which is suitable for transforming Agrobacterium tumefaciens.
  • Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, such as, for example, tobacco plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
  • the transformation of plants by agrobacteria is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press, 1993, pp. 15-38. From the transformed cells of the wounded leaves or leaf pieces, transgenic plants can be regenerated in a known manner which contain a gene integrated in the expression cassette for the expression of a DXPRI genes included.
  • an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulatory signals, for example sequences for replication or integration.
  • additional functional regulatory signals for example sequences for replication or integration.
  • Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).
  • the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli.
  • suitable cloning vectors include pBR332, pUC series, M13mp series and pACYC184.
  • Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.
  • Another object of the invention relates to the use of an expression cassette containing DNA sequences SEQ-ID No. 1 or hybridizing with these DNA sequences for transforming plants, cells, tissues or parts of plants.
  • the aim of the use is preferably to increase the content of tocopherols, vitamin K, carotenoids, chlorophylls and polyterpenes of the plant.
  • the expression can take place specifically in the leaves, in the seeds or in other parts of the plant.
  • Such transgenic plants, their reproductive material and their plant cells, tissue or parts are a further subject of the present invention.
  • the expression cassette can also be used to transform bacteria, cyanobacteria, yeast, filamentous fungi and algae with the aim of increasing the content of tocopherols, vitamin K, carotenoids, chlorophyll and polyterpenes.
  • transformation The transfer of foreign genes into the genome of a plant is called transformation.
  • the methods described for the transformation and regeneration of plants from plant tissues or plant cells become transient or stable Transformation used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called particle bombardment method, electroporation, the incubation of 5 dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium .
  • the methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by SD Kung and R. Wu, Academic
  • the construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res.
  • Agrobacteria transformed with an expression cassette can also be used in a known manner to transform plants, in particular crop plants, such as cereals, corn, oats, soybeans,
  • 20 rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa, lettuce and the various tree, nut and wine species can be used, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
  • Functionally equivalent sequences which code for a DXPRI gene are those sequences which, despite the differing nucleotide sequence, still have the desired functions. Functional equivalents thus include naturally occurring variants of the
  • a functional equivalent is understood to mean, in particular, natural or artificial mutations of an originally isolated sequence coding for a DXPRI, which furthermore show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues.
  • the present invention also includes those nucleotide sequences which are obtained by modifying the DXPRI nucleotide sequence. The aim of such a modification can, for example, be to further narrow down the coding sequence contained therein or, for example, also to insert further restriction enzyme interfaces.
  • Functional equivalents are also those variants whose function is weakened or enhanced compared to the original gene or gene fragment.
  • artificial DNA sequences are suitable as long as, as described above, they impart the desired property, for example to increase the tocopherol content in the plant by overexpressing the DXPRI gene in crop plants.
  • Such artificial DNA sequences can be determined, for example, by back-translation of proteins constructed using molecular modeling which have DXPRI activity or by in vitro selection. Coding DNA sequences which are obtained by back-translating a polypeptide sequence according to the codon usage specific for the host plant are particularly suitable. The specific codon usage can easily be determined by a person skilled in plant genetic methods by computer evaluations of other, known genes of the plant to be transformed.
  • Suitable equivalent nucleic acid sequences are sequences which code for fusion proteins, part of the fusion protein being a DXPRI polypeptide or a functionally equivalent part thereof.
  • the second part of the fusion protein can e.g. be another polypeptide with enzymatic activity or an antigenic polypeptide sequence that can be used to detect DXPRI expression (e.g. myc-tag or his-tag).
  • this is preferably a regulatory protein sequence, such as e.g. a signal or transit peptide that directs the DXPRI protein to the desired site of action.
  • Increasing the content of tocopherols, vitamin K, chlorophylls, carotenoids and polyterpenes means in the context of the present invention the artificially acquired ability to increase the biosynthesis of these compounds by functional overexpression of the DXPRI gene in the plant compared to the non-genetically modified plant for the long term at least one plant generation.
  • the biosynthesis site of tocopherols is generally the leaf tissue, so that leaf-specific expression of the DXPRI gene is useful.
  • the tocopherol biosynthesis need not be limited to the leaf tissue, but can also be tissue-specific in all other parts of the plant - for example in fatty seeds.
  • constitutive expression of the exogenous DXPRI gene is advantageous.
  • inducible expression may also appear desirable.
  • the effectiveness of the expression of the transgenically expressed DXPRI gene can be determined, for example, in vitro by proliferation of the shoot meristem.
  • a change in the type and level of expression of the DXPRI gene and its effect on the tocopherol biosynthesis performance on test plants can be tested in greenhouse experiments.
  • the invention also relates to transgenic plants transformed with an expression cassette containing the sequence SEQ-ID No. 1 or hybridizing with these DNA sequences, as well as transgenic cells, tissues, parts and propagation material of such plants.
  • Transgenic crop plants such as e.g. Barley, wheat, rye, corn, oats, soy, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rape, alfalfa, lettuce and the various tree, nut and wine species.
  • Plants in the sense of the invention are mono- and dicotyledonous plants or algae.
  • DOX 1-deoxy-D-xylulose
  • ME methyllerythritol
  • cloning steps carried out in the context of the present invention such as e.g. Restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, multiplication of phages and sequence analysis of recombinant DNA were carried out as with Sambrook et al. (1989) Cold Spring Harbor Laboratory Press; ISBN 0-87969-309-6.
  • the bacterial strains used below (E. coli, XL-I Blue) were obtained from Stratagene.
  • the Agrobacterium strain used for plant transformation (Agrobacterium tumefaciens, C58C1 with the plasmid pGV2260 or pGV3850kan) was developed by Deblaere et al. in nucl. Acids Res. 13 (1985), 4777.
  • the LBA4404 agrobacterial strain (Clontech) or other suitable strains can be used.
  • the vectors pUC19 (Yanish-Perron, Gene 33 (1985), 103-119) pBluescript SK- (Stratagene), pGEM-T (Promega), pZerO (Invitro- gen), pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984),
  • the sequencing of recombinant DNA molecules was carried out using a laser fluorescence DNA sequencer from Licor (sold by MWG Biotech, Ebersbach) according to the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977), 5463 - 5467).
  • DXPRI-homologous bacterial protein sequences could be identified in gene databases.
  • a comparison of the only 400 amino acid long protein sequences showed several conserved amino acid sequence motifs. Such a motif showed homologies with a stored genomic Arabidopsis sequence (accession number AB009053).
  • RNA from Arabidopsis thaliana was isolated and cDNA (according to manufacturer's information Stratagene) generated.
  • PCR primers were derived from the sequences AB009053 and AA586087, with which a 1215 bp DNA fragment was amplified from the cDNA produced.
  • the primer ATRv3 has a BamHI cleavage site and is selected such that after restriction digestion and ligation in pBluescript or pET5b (expression plasmid; Promega) the coding sequence is ligated in from the N-terminal first conserved sequence in the reading frame of the protein translation.
  • Atrv3 5 'TCAGGATCCGGCGCCTCGTCAATCT 3' Atrrl 5 'GACGAATTCTTCTTCCAACAACCAATTCT 3'
  • the primers Atrv3 and Atrrl contained a BamHI and an EcoRI interface, respectively (underlined).
  • the PCR product (Atrv3 / Atrrl) was purified using the Gene Clean Kit (Dianova GmbH, Hilden) and digested with BamHI and EcoRI.
  • the vector pET5b was also cut with BamHI and EcoRI for ligation.
  • the ligation products were transformed into E. coli XLlBlue (Stratagene).
  • the plasmid pET5bAtr contains a gene fragment coding for DXPRI from Arabidopsis thaliana. Its sequence was determined ( Figure 2, SEQ-ID No. 1). The nucleotide sequence obtained from the plasmid pEt5bAtr can be compared with the sequences AB009053 and AA586087. Accordingly, the genomic sequence AB009053 contains 10 introns.
  • the expression vector pET5b (Promega) is an expression vector for the expression of recombinant proteins in E. coli.
  • the plasmid is derived from pBR322 and carries a bacteriophage T7 promoter for expression.
  • the plasmid is propagated in an E. coli strain which carries an inducible gene for the T7 polymerase (e.g. JM109 (DE3); Promega).
  • the expression of the recombinant protein is activated by induction of the T7 polymerase.
  • pET5bAtr codes for a fusion protein with 420 amino acids
  • Amino acids 1 to 14 are derived from pET5b (fusion peptide; Figure 3).
  • Amino acids 15 to 420 come from the cloned DXPRI fragment (Fig. 2).
  • Fig. 3 the DNA sequence for the fusion peptide is underlined.
  • a molecular weight of 45.6 KDa for the protein can be calculated from the entire sequence.
  • the transgenic strain was incubated in the culture medium "2x YT" (per 1 l: bacto-trypton 16 g, yeast extract 10 g, NaCl 5 g). The cultivation took place at 37 ° C up to an OD 560 nm . from 0.6. According to IPTG (ImM), the growth continued for another 10 min at 37 ° C, then for another 4 h at 22 ° until harvest. The cells were centrifuged off and washed in 1% NaCl.
  • a crude protein extract was used for enzyme tests (in 4 ml extraction buffer (Tris / HCl (pH 7.5) 100 mM, MgCl 2 5mM, DTT 2mM, PMSF 0.1 mM).
  • the crude extracts were frozen with 20% glycerol at -20 ° C.
  • Detection was carried out by separating the product by thin layer chromatography on silica gel 60 (Merck) with acetone / ethyl acetate / water (50 + 50 + 2) with subsequent evaluation via instant imager.
  • 1-Deoxy-D-xylulose (DOX; Rf 0.4) and methyllerythritol (ME; Rf 0.2) are obtained.
  • Figure 9 shows the thin-layer chromatographic, autoradiographic evaluation after heterologous expression of the DXPRI from Arabidopsis thaliana in E. coli and enzyme assay using different total protein concentrations ( ⁇ g protein / ⁇ l).
  • K control E. coli JM 109 (DE3) with plasmid pET5b without DXPRI.
  • DOXS cloned from Chlamydomonas reinhardtii was used for the production of DOXP (pET5b, E. coli JM109 (DE3)).
  • Enzyme extracts from induced with IPTG E. coli cells were incubated with [3- 14 C] pyruvate and DL-GAP. The reaction was stopped after 30 min. by heat denaturation of the proteins. After centrifugation, the conversion of the radioactive pyruvate was checked by TLC / autoradiography and the supernatant was used as a substrate for the reductoisomerase.
  • DOXP as a reaction product was identified according to the following criteria: 1. A radioactive product is formed which, after treatment with alkaline phosphatase, behaves less polar in DC separations. This suggests that a phosphorylated product was formed from 14 C pyruvate and GAP.
  • the dephosphorylier e product runs in the TLC (silica gel, acetone / ethyl acetate / water 50/50/2) with a synthetic sample of 1-deoxy-D-xylulose.
  • the reaction mixture contained protein extract (20 ⁇ l / 100 ⁇ l mixture), Tris / HCl (pH 7.5) 100 mM, DTT 2 mM, MgCl 2 5 mM, Na-EDTA 500 ⁇ M, PMSF 100 ⁇ M, NaF 5 mM, TPP 1 mM , Na-pyruvate 1 mM, Na [2- 14 C] pyruvate 20 KBq / 100 ul and DL-glyceraldehyde hyd 3-phosphate 3.75 mM.
  • the primers were chosen such that after restriction digestion and ligation in pBin19AR-TP (Promega), the coding sequence from the N-terminal first conserved sequence is ligated in the reading frame of the protein translation.
  • AtrvpBinl 5 TCAGGATCCGGCGCCTCGTCAATCT 3'
  • AtrrpBin2 5 GACCCCGGGTTCTTCCAACAACCAATTCT 3'
  • the primers AtrvpBinl and AtrrpBin2 contained a BamHI and a Smal interface, respectively (underlined).
  • the PCR product (AtrvpBinl / AtrrpBin2) was purified using the Gene Clean Kit (Dianova GmbH, Hilden) and digested with BamHI and Smal.
  • the vector pBinl9AR-TP was also cut with BamHI and Smal, which additionally contains the transit peptide of the transketolase from potato behind the CaMV 35S promoter. The transit peptide ensures plastid localization.
  • the construct is shown in Figure 4.
  • the following primers were selected for cloning the DXPRI into a binary vector in antisense orientation.
  • AtrvpBin3 5 TCACCCGGGGGCGCCTCGTCAATCT 3' AtrrpBin4 5 'GACGGATCCTTCTTCCAACAACCAATTCT 3'
  • the primers AtrvpBin3 and AtrrpBin4 contained a Smal and a BamHI interface, respectively (underlined).
  • the PCR product (AtrvpBin3 / AtrrpBin4) was purified using a gene clean kit (Dianova GmbH, Hilden) and digested with Smal and BamHI.
  • the vector pBinl9AR-TP was also cut with Smal and BamHI, which additionally contains the transit peptide of the transketolase from potato behind the CaMV 35S promoter. The transit peptide ensures plastid localization.
  • the construct is shown in Figure 5.
  • Tobacco plants with reduced DXPRI activity were subjected to self-cultivation and the seeds obtained were harvested. Seeds from the Fl generation were used for further analysis of the plants.
  • the biomass analysis showed a correlation between the reduction in DXPRI activity and the reduction in biomass.
  • Extraction buffer 80% ethanol, 10 mM Hepes pH 7.0, 1 mM ascorbate
  • Fluorescence detection excitation at 295 nm, emission at
  • tobacco leaf disks with sequences of DXPRI (SEQ-ID No. 1), cloned as described in Example 4, were transformed into the transformation vector pBin19AR-TP.
  • SEQ-ID No. 1 sequences of DXPRI (SEQ-ID No. 1), cloned as described in Example 4 were transformed into the transformation vector pBin19AR-TP.
  • 10 ml of an overnight culture of Agrobacterium tumefaciens grown under selection were centrifuged off, the supernatant was discarded and the bacteria were resuspended in the same volume of antibiotic-free medium.
  • Leaf disks of sterile plants (diameter approx. 1 cm) were bathed in this bacterial suspension in a sterile petri dish.
  • the leaf disks were then placed in Petri dishes on MS medium (Murashige and Skoog, Physiol. Plant (1962) 15, 473) with 2% sucrose and 0.8% Bacto agar. After 2 days incubation in the dark at 25 ° C, they were on MS medium with 100 mg / l kanamycin, 500 mg / l claforan, 1 mg / 1 benzylaminopurine (BAP), 0.2 mg / l naphthylacetic acid (NAA), 1.6% glucose and 0.8% Bacto agar transferred and cultivation continued (16 hours light / 8 hours dark). Growing rungs were growing up hormone-free MS medium with 2% sucrose, 250mg / l Claforan and
  • transgenic rapeseed plants which have an altered prenyl lipid content, was based on a protocol by Bade, J.B. and Damm, B. (in Gene Transfer to Plants, Polypus, I. and Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38), in which the compositions of the media and buffers used are specified.
  • the transformations were carried out with the Agrobacterium tumefaciens strain LBA4404 (Clontech GmbH, Heidelberg).
  • the binary construct already described in Example 4 with the entire cDNA of DXPRI from Arabidopsis thaliana (SEQ-ID No. 1) was used as binary vectors.
  • the NOS terminator sequence was replaced by the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) for transcription termination.
  • Brassica napus seeds were sterilized with 70% (v / v) ethanol, washed for 10 min at 55 ° C in H 2 0, in 1% hypochlorite solution (25% v / v Teepol, 0.1% v / v Tween 20) incubated for 20 min and washed six times with sterile H0 for 20 min each.
  • the seeds were dried on filter paper for three days and 10-15 seeds were germinated in a glass flask with 15 ml of germination medium.
  • the roots and apices were removed from several seedlings (approx. 10 cm in size) and the remaining hypocotyls in approx. 6 mm long
  • the approx. 600 explants obtained in this way are washed with 50 ml of basal medium for 30 min and transferred to a 300 ml flask. After adding 100 ml of callus induction medium, the cultures were incubated for 24 h at 100 rpm.
  • An overnight culture of the Agrobacterium strain was set up at 29 ° C. in Luria Broth medium with kanamycin (20 mg / l), of which 2 ml in 50 ml Luria Broth medium without kanamycin for 4 h at 29 ° C. up to one OD 500 incubated from 0.4-0.5. After pelleting the culture at 2000 rpm for 25 min, the cell pellet was resuspended in 25 ml of basal medium. The concentration of the bacteria in the solution was adjusted to an OD OOO of 0.3 by adding further basal medium.
  • the callus induction medium was removed from the oilseed rape explants using sterile pipettes, 50 ml of Agrobacterium solution were added, mixed gently and incubated for 20 min.
  • the Agrobacteria Suspension was removed, the oilseed rape explant washed with 50 ml callus induction medium for 1 min and then 100 ml callus induction medium added.
  • the co-cultivation was carried out on a rotary shaker at 100 rpm for 24 h.
  • the co-cultivation was stopped by removing the callus induction medium and the explants were washed twice for 1 min with 25 ml and twice for 60 min with 100 ml washing medium at 100 rpm.
  • the washing medium with the explants was transferred to 15 cm petri dishes and the medium removed with sterile pipettes.
  • Takak plants transformed with the appropriate constructs were grown in the greenhouse.
  • the ⁇ -tocopherol content of the whole plant or the seeds of the plant was then determined. In all cases, the ⁇ -tocopherol concentration was increased compared to the non-transformed plant.
  • the Arabidopsis thaliana DXPRI cDNA (SEQ-No.I) was provided with a CaMV35S promoter and overexpressed in oilseed rape using the 35S promoter.
  • the seed-specific promoter of the phaseolin gene was used to specifically increase the tocopherol content in the rapeseed.
  • Rapeseed plants transformed with the appropriate constructs were grown in the greenhouse.

Abstract

Cette invention concerne un procédé de production de plantes ayant une teneur élevée en tocophérols, vitamine K, caroténoïdes, chlorophylles et polyterpènes par surexpression d'un gène DXPRI.
EP00922642A 1999-04-27 2000-04-17 Surexpression d'une sequence d'adn codant pour une 1-desoxy-d-xylulose-5-phosphate reductoisomerase a l'interieur de plantes Withdrawn EP1180149A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE19918949 1999-04-27
DE19918949A DE19918949A1 (de) 1999-04-27 1999-04-27 Überexpression einer DNA-Sequenz codierend für eine 1-Desoxy-D-Xylulose-5-Phosphat Reduktoisomerase in Pflanzen
PCT/EP2000/003465 WO2000065036A2 (fr) 1999-04-27 2000-04-17 Surexpression d'une sequence d'adn codant pour une 1-desoxy-d-xylulose-5-phosphate reductoisomerase a l'interieur de plantes

Publications (1)

Publication Number Publication Date
EP1180149A2 true EP1180149A2 (fr) 2002-02-20

Family

ID=7905919

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00922642A Withdrawn EP1180149A2 (fr) 1999-04-27 2000-04-17 Surexpression d'une sequence d'adn codant pour une 1-desoxy-d-xylulose-5-phosphate reductoisomerase a l'interieur de plantes

Country Status (7)

Country Link
US (1) US6765129B1 (fr)
EP (1) EP1180149A2 (fr)
AR (1) AR023599A1 (fr)
AU (1) AU4296000A (fr)
CA (1) CA2372332A1 (fr)
DE (1) DE19918949A1 (fr)
WO (1) WO2000065036A2 (fr)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002541851A (ja) 1999-04-15 2002-12-10 カルジーン エルエルシー イソプレノイド合成に関与するタンパク質の核酸配列
US6872815B1 (en) 2000-10-14 2005-03-29 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
AU2001290522B2 (en) 2000-08-07 2006-11-30 Monsanto Technology Llc Methyl-D-erythritol phosphate pathway genes
US6660507B2 (en) * 2000-09-01 2003-12-09 E. I. Du Pont De Nemours And Company Genes involved in isoprenoid compound production
US7161061B2 (en) 2001-05-09 2007-01-09 Monsanto Technology Llc Metabolite transporters
ES2318004T3 (es) 2001-05-09 2009-05-01 Monsanto Technology Llc Genes tyra y usos de los mismos.
WO2003016482A2 (fr) 2001-08-17 2003-02-27 Monsanto Technology Llc Genes de methyltransferase et leurs utilisations
DE60235252D1 (de) 2001-10-25 2010-03-18 Monsanto Technology Llc Aromatische methyltransferasen und ihre verwendung
BR0308740A (pt) 2002-03-19 2007-01-09 Monsanto Technology Llc ácidos nucléicos e polipeptìdeos de homogentisado prenil transferase ("hpt"), e empregos destes
AU2003268083A1 (en) 2002-08-05 2004-02-23 Monsanto Technology, Llc Tocopherol biosynthesis related genes and uses thereof
WO2004043885A2 (fr) * 2002-11-12 2004-05-27 Purdue Research Foundation Promoteurs inductibles par du benzoate
CN114507679B (zh) * 2021-12-16 2023-06-30 南京林业大学 一种马尾松萜类物质合成相关酶基因PmDXR及其启动子的应用

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SK3922001A3 (en) * 1998-09-22 2001-09-11 Jomaa Pharmaka Gmbh Genes of the 1-desoxy-d-xylulose biosynthetic pathway
AU2163300A (en) * 1998-12-04 2000-06-26 E.I. Du Pont De Nemours And Company Plant 1-deoxy-d-xylulose 5-phosphate reductoisomerase
EP1141344A2 (fr) * 1999-01-15 2001-10-10 Syngenta Participations AG Gene cible d'herbicide et procedes correspondants
US6281017B1 (en) * 1999-02-03 2001-08-28 Washington State University Research Foundation 1-deoxy-d-xylulose-5-phosphate reductoisomerases and method of use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0065036A2 *

Also Published As

Publication number Publication date
DE19918949A1 (de) 2000-11-23
US6765129B1 (en) 2004-07-20
AU4296000A (en) 2000-11-10
AR023599A1 (es) 2002-09-04
WO2000065036A2 (fr) 2000-11-02
CA2372332A1 (fr) 2000-11-02
WO2000065036A3 (fr) 2001-04-19

Similar Documents

Publication Publication Date Title
EP1102852A1 (fr) Sequence adn codant pour une 1-deoxy-d-xylulose-5-phosphate synthase et sa surproduction dans les plantes
WO1999004021A1 (fr) Sequence d'adn codant pour une hydroxyphenylpyruvate dioxygenase et sa surproduction dans des plantes
EP1294913B1 (fr) Modification de la teneur en produits chimiques fins dans les organismes par modification genetique du chemin du shikimate
DE60129011T2 (de) Nukleinsäuresequenzen für proteine, die an der tocopherolbiosynthese beteiligt sind
WO2000065036A2 (fr) Surexpression d'une sequence d'adn codant pour une 1-desoxy-d-xylulose-5-phosphate reductoisomerase a l'interieur de plantes
WO2001062781A2 (fr) Homogentisatphytyl transferase
EP1194577A1 (fr) Identification et surexpression d'une sequence d'adn codant pour une 2-methyl-6-phytylhydroquinone-methyltransferase dans des plantes
KR20010105373A (ko) 식물의 농업경영 및 영양 가치의 개선 방법
DE10046462A1 (de) Verbesserte Verfahren zur Vitamin E Biosynthese
DE19835219A1 (de) DNA-Sequenz codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und deren Überproduktion in Pflanzen
EP1025250A2 (fr) Action sur la teneur en tocopherol dans les plantes transgeniques
WO2000044911A1 (fr) Surexpression d'une sequence d'adn codant pour une transketolase dans des vegetaux
EP1373533B1 (fr) Augmentation de la teneur en vitamine e dans des organismes par accroissement de l'activite de la tyrosine aminotransferase
Abbasi Functional analysis of tocopherol biosynthesis in plant
DE19845231A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Pphosphat Synthase, eine Hydroxyphenylpyruvat Dioxygenase und eine Geranylgeranylpyrophosphat Oxidoreduktase und deren Überproduktion in Pflanzen
DE19845216A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und eine Hydroxyphenylpyruvat Dioxygenase und deren Überproduktion in Pflanzen
DE19845224A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und eine Geranylgeranyl-Pyrosphat Oxidoreduktase und deren Überproduktion in Pflanzen
WO2003080844A2 (fr) Augmentation de la teneur en vitamine e dans des organismes par augmentation de l'activite de la 2-methyl-6-phytylhydroquinone-methyltransferase
WO2004058934A2 (fr) Procede pour produire des plantes transgeniques a teneur accrue en vitamine e par modification de la teneur en serine-acetyltransferase
DE10064454A1 (de) Veränderung des Gehalts an Feinchemikalien in Organismen durch genetische Veränderung des Shikimatweges
DE10030647A1 (de) Veränderung des Gehalts an Feinchemikalien in Organismen durch genetische Veränderung des Shikimatweges
WO2001009355A2 (fr) S-ADENOSYLMETHIONIN:Mg-PROTOPORPHYRIN-IX-O-METHYLTRANSFERASE VEGETALE, VEGETAUX A TENEUR EN CHLOROPHYLLE VARIABLE ET/OU A TOLERANCE AUX HERBICIDES VARIABLE, ET PROCEDE DE PRODUCTION

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011113

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20040803