EP1108051A2 - Induzierbares expresionssystem - Google Patents

Induzierbares expresionssystem

Info

Publication number
EP1108051A2
EP1108051A2 EP99940240A EP99940240A EP1108051A2 EP 1108051 A2 EP1108051 A2 EP 1108051A2 EP 99940240 A EP99940240 A EP 99940240A EP 99940240 A EP99940240 A EP 99940240A EP 1108051 A2 EP1108051 A2 EP 1108051A2
Authority
EP
European Patent Office
Prior art keywords
adenoviral vector
expression system
expression
transcriptional activator
receptor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99940240A
Other languages
English (en)
French (fr)
Inventor
Majid Mehtali
Tania Sorg-Guss
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Transgene SA
Original Assignee
Transgene SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Transgene SA filed Critical Transgene SA
Publication of EP1108051A2 publication Critical patent/EP1108051A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/08—Vasodilators for multiple indications
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination

Definitions

  • the present invention relates to an inducible expression system using the nucleotide sequences coding for a transcriptional activator and a recombinant adenoviral vector comprising a gene of interest placed under the control of a promoter inducible in trans by said transcriptional activator in a form activated. It also relates to a recombinant adenoviral vector carrying a first expression cassette coding for said transcriptional activator and a second cassette carrying a gene of interest placed under the control of a promoter inducible in trans by said transcriptional activator.
  • the invention also relates to an infectious viral particle, a cell, a pharmaceutical composition comprising such a vector or expression system as well as their use for therapeutic or prophylactic purposes. The invention is of particular interest for gene therapy perspectives, especially in humans.
  • Gene therapy is defined as the transfer of genetic information into a host cell or organism.
  • the first protocol applied to humans was initiated in the United States in September 1990 on a genetically immunodeficient patient due to a mutation affecting the gene coding for Adenine Deaminase (AD A). It was a question of correcting or replacing the defective gene whose dysfunction is at the origin of a genetic disease by a functional gene.
  • AD A Adenine Deaminase
  • the relative success of this first experiment encouraged the development of this technology which has since been extended to the treatment of other diseases, both genetic and acquired (cancers, infectious diseases like AIDS ...) with the aim of delivering in situ therapeutic genes that improve pathology.
  • Most strategies use vectors to convey the therapeutic gene to its cell target. Many vectors, both viral and synthetic, have been developed in recent years and have been the subject of numerous publications accessible to those skilled in the art.
  • adenoviruses as gene therapy vectors has already been mentioned in numerous documents of the prior art. They infect many cell types, both dividing and quiescent, are non-integrative and not very pathogenic. In addition, they have a natural tropism for the respiratory tract. These particular properties make adenoviruses vectors of choice for many therapeutic and even vaccine applications. As an indication, their genome consists of a linear and double-stranded DNA molecule of around 36 kb which carries around thirty genes involved in the viral cycle. The early genes (E1 to E4; E for early in English) are distributed in 4 regions dispersed in the genome.
  • the E1, E2 and E4 regions are essential for viral replication while the E3 region involved in the modulation of the anti-adenovirus immune response in the host is not.
  • the late genes (L1 to L5; L for late meaning late in English) mainly code for structural proteins and partially cover the early transcription units. They are mostly transcribed from the major late promoter MLP (for Major Late Promoter in English).
  • the adenoviral genome carries at its ends regions acting in cis essential for packaging consisting of inverted terminal sequences (ITR) located at the 5 ′ and 3 ′ ends and of an packaging region which follows the ITR 5. '.
  • the adenoviral vectors currently used in gene therapy protocols lack most of the E1 region in order to avoid their dissemination in the environment and the host organism. Additional deletions in the E3 region allow increased cloning capabilities.
  • the genes of interest are introduced into viral DNA in place of either deleted region.
  • the potential immunogenicity of the viral proteins still expressed can, in certain particular applications, oppose the persistence of the transduced cells and the stable expression of the transgene.
  • These drawbacks have justified the construction of new generation vectors which conserve the cis regions (ITRs and packaging sequences) essential for packaging but include additional genetic modifications aimed at suppressing the expression in vivo of most viral genes (see for example international application WO94 / 28152).
  • a so-called minimal vector deficient for all of the adenoviral functions, represents an alternative of choice.
  • Tissue-specific expression can be mediated through tissue-specific promoters and enhancers or inducible expression systems responding to a specific cellular or temporal event.
  • inducible expression systems currently proposed rely on the use of promoters regulated by endogenous transcription factors activated by a particular inducing ligand (steroid hormones, interferon, heavy metals, etc.).
  • a first drawback is that these systems require the presence of endogenous activating factors within the target cell.
  • the basal expression level is often high due to “background noise” activation due to endogenous cellular substances, which can generate significant side effects.
  • the tetracycline resistance operon is coded by the Tn10 transposon (Hillen et al., 1984, J. Mol. Biol. 172, 185-201). Regulation is ensured by a short nucleotide sequence called "operator" (tet O) which constitutes a binding site for various regulators.
  • tet O a short nucleotide sequence
  • tet R the binding of the tetracycline repressor
  • tetracycline antibiotic considerably decreases the level of transcription.
  • tTA tetracycline trans-activator
  • the trans-activator is supplied in trans either by infection of an established line expressing tTA with an adenoviral vector containing a gene of interest placed under the control of tetO elements and of the CMV promoter, or by co- infection of the cells by two adenoviral vectors, one containing the cassette of interest and the other expressing tTA.
  • glucocorticoid receptors (GR) (Israel and Kaufinan, 1989, Nucleic Acids Res. 17, 4589-4604)
  • PR progesterone
  • ER estrogens
  • the steroid receptor In terms of trans-activation, the steroid receptor is in its inactive form complexed with various cellular factors including certain heat shock proteins (hsp for heat shock protein in English). The binding of an agonist ligand (steroid hormone) causes a change in the conformation of the receptor. This activation is accompanied by the dissociation of cellular factors, a nuclear translocation and increases the receptor's capacity to fix a short specific DNA sequence (target sequence), which allows interaction with the transcriptional machinery and the transcription induction. To fulfill their function, these receptors are generally organized into 3 functional domains, respectively a trans-activation domain allowing activation of transcription, a DNA binding domain (target sequence) and a ligand binding domain ( DLL).
  • DLL ligand binding domain
  • Modified receptors preferentially responding to non-natural synthetic ligands are also proposed in the literature.
  • Wang et al. (1994, Proc. Natl Acad. Sci. USA 91, 8180-8184) constructed a chimera activatable by the molecule RU486 but not by endogenous progesterone, which results from the fusion of the ligand-binding domain of the truncated progesterone receptor ( ⁇ PR), the DNA binding domain of the yeast protein Gal4 and the trans-activation domain of the protein VP16.
  • ⁇ PR truncated progesterone receptor
  • the basal activity remains high and the chimeric protein can potentially interfere with cellular transcription factors.
  • ER and GR receptor variants modified in their ligand binding domains have also been described.
  • the ER T mutant obtained by substitution of glycine at position 521 of the ER receptor with an arginine is unable to fix endogenous estrogens, but can be activated by synthetic ligands such as Tamoxifen, to activate transcription regulated by the ERE target sequence (for estrogen responsive element).
  • An analogous variant has also been constructed for the GR receptor, modified at position 747 by substitution of isoleucine with a threonine (Roux et al., 1996, Molecular Endocrynology 10, 1214-1226).
  • This variant designated GR dex is unable to bind endogenous glucocorticoids, but can be activated by synthetic ligands such as Dexamethasone. Once activated, it recognizes the GRE target sequence (for glucocorticoid responsive element; Cato et al., 1986, EMBO J. 5, 2237-2240) and stimulates the transcription of the promoter associated with it.
  • EcR steroid insect receptor responding to Pecdysone
  • the receptor is activated by ecdysone and forms a heterodimer with the Drosophila ultraspiracle protein (USP) which binds to a specific target sequence (EcRE for ecdysone responsive element) to activate transcription.
  • USP Drosophila ultraspiracle protein
  • EcRE ecdysone responsive element
  • the mutant can form, in the presence of ecdysone or its muristone analog A, a heterodimer with the protein USP or its human counterpart, the receptor for retinoic acid X ( RXR), and activate the transcription of genes placed under the control of a hybrid sequence (5xE / GRE) comprising the motifs responding to the EcR and GR receptors.
  • a hybrid sequence (5xE / GRE) comprising the motifs responding to the EcR and GR receptors.
  • Another inducible expression system described in the literature uses the immunophilins. Rivera et al. (1996, Nat. Med. 2, 1028-1032) have developed a two-component system assembled in the presence of a ligand. More precisely, the first component is a fusion between the factor of transcription ZFHD1 (carrying a DNA binding domain) and the immunophilin FKBP12 and the second component is a fusion between the transactivation domain of the factor NFKB p65 and FRAP (FKBP12-rapamycin-associated protein).
  • the trans-activator is activated in the form of a heterodimer associating the two components and rapamycin linking the FKBP 12 and FRAP portions which can induce the expression of a transgene placed under the control of the target elements of ZFHD1.
  • AhR aryl hydrocarbon receptor
  • XRE for xenobiotic responsive elements
  • the binding of the heterodimer to the target elements of DNA called XRE induces the transcription of the gene sequences downstream.
  • the XRE sequence is present in the promoter region of many genes coding for enzymes involved in the metabolism of drugs, such as glutathione-S-transferase or cytochrome P4501 Al.
  • AhR and Arnt have a domain responsible for the recognition of the target sequence, heterodimerization and binding to the ligand.
  • the majority of trans-activation studies using the AhR / Arnt complex use the 2,3,7,8-tetrachlorodibenzo-p-dioxin ligand (TCDD)
  • the present invention provides an inducible expression system using an adenoviral vector comprising a gene of interest whose expression is regulated by a trans-activator activatable by the supply of exogenous pharmacological molecules.
  • This system is based more particularly on the use of a steroid receptor. Once activated, the receptor / ligand complex will bind to its target sequence and allow trans activation of expression of the therapeutic gene.
  • adenoviral vector containing, in replacement of the E1 region, an expression cassette for the GR mutant steroid receptor ex expressed constitutively by the early cytomegalovirus promoter (CMN) and, in replacement of the E3 region, a human factor IX (FIX) gene expression cassette placed downstream of the mouse mammary tumor virus (MMTN) promoter containing the GRE target sequence.
  • CPN early cytomegalovirus promoter
  • FIX human factor IX
  • the inducible FIX gene cassette is regulated by the ERE sequence associated with the minimal promoter of the TK (thymidine kinase) gene from HSN (herpes simplex virus).
  • the third system studied in the context of the present invention uses the modified NgEcR receptor and the human RXR receptor whose sequences have been introduced into the E1 region of an adenovirus.
  • the inducible cassette present in the E3 region places the AD ⁇ c of the FIX under the control of the 5xE / GRE hybrid elements.
  • the purpose of the present invention is to remedy the drawbacks of current gene therapy vectors, in particular by improving specificity (activation by non-toxic exogenous substances and not by endogenous cellular factors) and inducibility (basal activity in the absence minimal inducer and strong expression of the transgene in the activated state).
  • the object of the present invention can be applied to various gene therapy protocols requiring the expression of soluble molecules, such as antitumor molecules (antibodies, cytokines, chemokines) or in all cases where the expression of the therapeutic gene must be regulated according to the needs of the organism. It also allows the analysis of genes whose expression is cytotoxic or reduced at certain stages of development.
  • nucleotide sequences coding for a transcriptional activator of eukaryotic or viral origin and placed under the control of regulatory elements appropriate for their expression in a host cell or organism, and
  • a recombinant adenoviral vector comprising a gene of interest placed under the control of an inducible promoter capable of being activated in trans by said transcriptional activator.
  • transcriptional activator defines a polypeptide or a set of polypeptides exerting a positive action on transcription, ie having the capacity to initiate or stimulate the transcription of any gene to from appropriate regulatory elements responding to said transcriptional activator.
  • the positive effect on transcription is preferably mediated directly by the binding of the activator to the regulatory elements but can be indirectly mediated by means of cellular factor (s).
  • a ligand-dependent transcriptional activator capable of binding a characteristic DNA sequence (target sequence) and of activating the promoter associated with it.
  • the transcriptional activator can be a single polypeptide in the form of a monomer or multimer (preferably dimer) or can also result from the association of a set of polypeptides forming a heteromer (preferably a set of two polypeptides forming a heterodimer).
  • the transcriptional activator in use in the present invention may be derived from any organism of eukaryotic or viral origin, in particular from a yeast, an insect, a vertebrate or a virus or may have an origin mixed, that is to say being made up of components of various origins.
  • a transcriptional activator suitable for implementing the present invention comprises at least 3 types of functional domains, respectively a trans-activation domain, a DNA binding domain (target sequence) and a ligand binding domain (DLL).
  • the order of the different fields is immaterial.
  • they can be distributed in the amino acid sequence continuously or discontinuously (possibly with an overlap of the residues involved in each function) and localized on one or more polypeptides forming said transcriptional activator.
  • it can include several areas of the same type.
  • An adequate example is the heterodimer developed by Rivera et al. (1996, Nat. Med. 2, 1028-1032) activated by the binding of rapamycin to the FKBP12 and FRAP portions.
  • ligand binding domain refers to the portion of the transcriptional activator that interacts with an appropriate ligand-inducer.
  • the DLL-inducer interaction places the transcriptional activator in an activated state, a step necessary for transcriptional activation.
  • the DLL is preferably located at the C-terminal end of or of a polypeptide composing said transcriptional activator.
  • DNA binding domain refers to the portion of the transcriptional activator that interacts with the target DNA sequence present within the inducible promoter controlling the expression of the gene of interest and specific for the transcriptional activator chosen.
  • Said target sequence is generally placed upstream of a promoter region containing at least one TATA box and is composed of motifs recognized by the transcriptional activator. These patterns can form a particular structure (palindrome, repetitions in direction or reverse orientation ... etc).
  • the target sequences adapted to each transcriptional activator are described in the literature.
  • the GRE target sequence for glucocorticoid responsive element
  • a TGTTCT motif or its complement
  • GR ex a DNA binding domain derived from the GR receptor or from a analogous (GR ex ).
  • a preferred example is constituted by the sequence 5'GGTACANNNTGTTCT3 'where N represents any nucleotide
  • the ERE target sequence for estrogen responsive element
  • the ERE target sequence comprising a 5 ⁇ GGTCA3 'motif (or its complement) recognized by a DNA binding domain derived from the ER receptor or an analog (ER).
  • a preferred example is constituted by the sequence 5 ⁇ GGTCANNNTGACC3 'where N represents any nucleotide; - the target sequence UAS (for upstream activating sequence) of sequence 5 'CGGAGTACTGTCCTCCG3' (or its complement) recognized by a DNA binding domain derived from the Gai 4 receptor of yeast or an analog; the EcRE target sequence (for ecdysone responsive element) comprising a GACAAG motif (or its complement) recognized by a DNA binding domain derived from the EcR receptor or an analog.
  • a preferred example is constituted by the sequence 5'GACAAGGGTTCAATGCACTTGTC3 '; the 5xE / GRE sequence of sequence 5 'AGGTC AN AGAACA3' (or its complement) recognized by a hybrid DNA binding domain between EcR and GR or an analog, the target sequence 5 'TAATTANGGGNG3' where N represents a any nucleotide, recognized by the transcription factor ZFHD1 - the target sequence XRE (for xenobiotic responsive element) of sequence 5'CCTCCAGGCTTCTTCTCACGCAACTCC3 'recognized by a DNA binding domain derived from the AhR receptor or the like.
  • trans-activation domain refers to the portion of the transcriptional activator that interacts with cellular machinery to initiate or stimulate gene transcription dependent on the target sequence responding to said activator.
  • This domain can come from a conventional transcription factor (NFKB, SP-1 %) or from a ligand-dependent factor (steroid receptor, immunophilin, AhR ).
  • a domain comprising the 130 C-terminal amino acids of NP16 is particularly suitable.
  • trans-activation induced by the transcriptional activator in use in the context of the present invention can be verified simply by conventional techniques, for example by following the expression of a given gene placed under the control of the appropriate target sequence or the synthesis of its expression product (analysis according to Northern, Western, immunofluorescence, etc.) in the presence of the receptor activated by the inducer.
  • a detailed protocol is given in the examples below.
  • a difference of a factor of at least 2, advantageously of at least 5 and, preferably, of at least 10 reflects the capacity for trans-activation of the expression system according to the invention.
  • trans-activation domain is located in the N-terminal part between residues 272 and 400 (Jonat et al., 1990, Cell 62, 1189-1204), the DNA binding domain of 66 amino acids between residues 421 and 487 (Lucibello et al., 1990, EMBO J. 9, 2827-2834) and the hormone ligand binding domain of approximately 300 amino acids in the C-terminal part (Kerpolla et al., 1993, Mol Cell Biol. 13, 3782-3791).
  • the latter domain also includes the sequences responsible for the dimerization of GR, its nuclear localization and the interaction with hsp proteins. Trans-activation is mediated by the binding of a receptor dimer to the GRE target sequence.
  • the transcriptional activator included in the inducible expression system comprises all or part of a domain derived from a steroid hormone receptor chosen from the group consisting of estrogen (ER), glucocorticoid (GR), progesterone (PR), Vitamin D, ecdysone (EcR), mineralocorticoid, androgen, thyroid hormone, retinoic acid and retinoic acid X or an immunophilin or aryl receptor receptor hydrocarbon (AhR).
  • ER estrogen
  • GR glucocorticoid
  • PR progesterone
  • Vitamin D ecdysone
  • mineralocorticoid androgen
  • thyroid hormone retinoic acid and retinoic acid X
  • AhR immunophilin or aryl receptor receptor hydrocarbon
  • the modified functional domain has a sequence identity with its native equivalent of at least 70%, advantageously at least 80%, preferably at least 90% and, very preferably, at least 95%.
  • a receptor modified in its DLL so as to be activatable by an unnatural inducer.
  • Preferred examples are constituted by the mutants GR ex (I747T) and ER (G521R) already mentioned.
  • a chimeric transcriptional activator comprising various polypeptides or polypeptide fragments.
  • it results from the merger or association of functional areas of different origins.
  • a non-human receptor of viral or animal origin or lower eukaryote
  • an animal steroid receptor for example an animal steroid receptor, a yeast receptor (Gal4) ...
  • the only condition being to adapt the target sequence to the DNA binding domain selected.
  • Such an adaptation is within the reach of those skilled in the art.
  • the inducible promoter used will contain the UAS (Upstream Activating Sequences) elements responding to Gal4.
  • the trans-activation domain can come from any known transcriptional activation domain, in particular from protein 16 of the herpes simplex virus (VP16) or from p65 of factor NFKB and in particular, from its end C-terminal.
  • a transcriptional activator associating a DLL derived from a steroid receptor, a trans-activation domain derived from VP16 and a DNA binding domain from Gal4 or from a steroid receptor is suitable for the implementation of the present invention.
  • residues 1 to 74 of Gal4 will preferably be used.
  • other combinations are also possible.
  • a possible example consists of a hybrid DNA binding domain between the EcR and GR receptors, recognizing a hybrid target sequence comprising the motifs responding to ecdysone and to glucocorticoids.
  • a preferred transcriptional activator in the context of the present invention is chosen from:
  • a polypeptide designated GR ex comprising a DNA binding domain, a trans-activation domain and a DLL derived from a glucocorticoid receptor, said receptor being modified in its DLL, in particular by substitution of the isoleucine in position 747 with a threonine;
  • a polypeptide designated ER comprising a DNA binding domain, a trans-activation domain and a DLL derived from an estrogen receptor, said receptor being modified in its DLL, in particular by substitution of glycine in position 521 with an arginine;
  • a transcriptional activator comprising a first polypeptide comprising a DLL derived from the ecdysone receptor, a hybrid DNA binding domain derived from those of the EcR and GR receptors and a trans-activation domain derived from the viral protein VP 16 and a second polypeptide derived from the protein USP from Drosophila or from a homolog such as the human retinoic
  • a transcriptional activator comprising a first polypeptide comprising a DNA binding domain derived from the transcription factor ZFHD1 and a DLL derived from the immunophilin FKBP12 and a second polypeptide comprising a trans-activation domain derived from the factor NFKB p65 and a FRAP-derived DLL (FKBP12-rapamycin-associated protein); and
  • transcriptional activator comprising a first polypeptide derived from the AhR receptor and a second polypeptide derived from the Arnt protein.
  • the transcriptional activators (i) and (ii) are in the form of homodimers and (iii) (iv) and (v) are in the form of heterodimers associating the first and the second polypeptide and, optionally, the inducer .
  • the transcriptional activator is activated by binding to an unnatural inducer and is not or only slightly activated by a natural human compound.
  • unnatural inducer refers to a compound which is not found naturally in the human or animal organism for which therapy using the inducible expression system according to the invention is intended. It is preferably a synthetic inducer which is not found naturally in a human organism and whose structure is slightly different from that of a human compound (endogenous).
  • an unnatural inducer is capable of activating the transcriptional activator in use in the context of the present invention, in particular by binding to the DLL, in order to initiate or stimulate the transcription dependent on the target sequence responding to said activator.
  • the choice of an unnatural inductor adapted to the selected transcriptional activator is within the reach of those skilled in the art on the basis of the state of the art.
  • Activation of the transcriptional activator by the non-natural inducer can be done by a covalent or non-covalent interaction (electrostatic, hydrophobic, hydrogen bonding, etc.).
  • the inductor can be constituted by a single compound or by a set of molecules. It preferably belongs to the family of steroids, retinoids, fatty acids, vitamins, hormones, xenobiotics or antibiotics.
  • said unnatural inducer is a synthetic substance which can be administered orally.
  • it is chosen from the group consisting of dexamethasone, tamoxifen, muristerone A, ecdysone, rapamycin and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or any analog of these compounds, preferably little or not toxic.
  • the sequences coding for the transcriptional activator included in the inducible expression system according to the invention are placed under the control of the appropriate regulatory elements allowing expression in a host cell or organism.
  • appropriate regulatory elements groups together all of the elements allowing the transcription of said sequences into RNA and the translation into protein.
  • the promoter is of particular importance. It can be isolated from any gene of eukaryotic, prokaryotic or even viral origin. Alternatively, it may be the natural promoter of the endogenous gene. Furthermore, it can be constitutive or regulable. In addition, it can be modified so as to improve the promoter activity, to suppress a region inhibiting transcription, to make a constitutive promoter regulable or vice versa, to introduce a restriction site.
  • PGK Phospho Glycerate Kinase
  • MT metalothioneine
  • Me Ivor et al. 1987, Mol. Cell Biol. 7, 838-8082
  • MLP late adenoviral
  • El A, E2A, E3 or E4 genes promoters governing the expression of late adenoviral genes.
  • its expression can be controlled by its specific target sequence (self-activation and / or activation by the endogenous wild-type receptor activated by the endogenous ligand).
  • ERE or GRE elements for the expression of a transcriptional activator comprising a DNA binding domain derived from ER or GR (ER T or GR dcx ).
  • a regulatable promoter chosen from those of the prior art.
  • the use of a promoter stimulating expression in a tumor or cancer cell may be advantageous.
  • the promoters of the MUC-1 genes overexpressed in breast and prostate cancers Chen et al., 1995, J. Clin. Invest.
  • CMV Cytomegalovirus
  • the appropriate regulatory elements may also include additional elements improving expression (intronic sequence, transcription terminator sequence, etc.) or even maintenance in a host cell. Such elements are known to those skilled in the art.
  • the transcriptional activator in use in the context of the present invention is composed of a set of polypeptides
  • these can be produced from polycistronic nucleotide sequences (placed under the control of a single promoter) implementing a site initiation of IRES-type translation to initiate the translation of the second cistron.
  • polycistronic nucleotide sequences placed under the control of a single promoter
  • a bidirectional promoter directing the expression of two genes placed on both sides.
  • the cassettes can be carried by the same expression vector or by different vectors.
  • sequences used in the context of the present invention can be obtained by conventional molecular biology techniques, for example by bank screening using specific probes, by expression bank immuno-screening, by PCR using primers adequate or by chemical synthesis.
  • the mutants can be generated from the native sequences by substitution, deletion and / or addition of one or more nucleotides by using the techniques of site-directed mutagenesis, PCR, digestion by restriction enzymes and ligation or by synthesis chemical. The functionality of the mutants and the constructs can be verified by the techniques of the art.
  • the second component of the inducible expression system is a recombinant adenoviral vector comprising at least one gene of interest placed under the control of an inducible promoter capable of being activated in trans by said transcriptional activator.
  • a deletion from the majority of the El region is preferred.
  • it extends from nt 454 to 3328 but can also include additional sequences in 5 ′ and 3 ′ provided that it does not interfere with the packaging function.
  • the pIX gene is not included in the E1 deletion.
  • it can be combined with other modification (s) affecting in particular the E2, E4 and / or L1-L5 regions, insofar as essential defective functions are complemented in trans by means of a complementation line and / or an auxiliary virus.
  • E1 and E4 use may be made of defective second generation vectors for the functions E1 and E4. or E1 and E2 (see for example international applications WO94 / 28152 and WO97 / 04119).
  • E1 and E2 see for example international applications WO94 / 28152 and WO97 / 04119.
  • the E4 region it can be deleted in whole or in part.
  • a partial deletion of the E4 region with the exception of the sequences coding for open reading frames (ORF) 3 and / or 6/7 is advantageous insofar as it does not require complementation of the E4 function (Ketner et al ., 1989, Nucleic Acids Res. 17, 3037-3048).
  • the recombinant adenoviral vector can also be devoid of all or part of the non-essential E3 region. According to this alternative, it may nevertheless be advantageous to keep the E3 sequences coding for the polypeptides allowing escape to the immune system of the host, in particular the glycoprotein gpl9k (Gooding et al., 1990, Critical Review of Immunology 10, 53- 71).
  • the origin of the adenoviral vector of the inducible expression system according to the invention can be varied both from the point of view of the species and of the serotype. It can be derived from the genome of a human or animal adenovirus (canine, avian, bovine, murine, sheep, pig, simian, etc.) or else from a hybrid comprising fragments of the adenoviral genome from at least two different origins. Mention may more particularly be made of the adenoviruses CAV-1 or CAV-2 of canine origin, DAN of avian origin or else Bad of type 3 of bovine origin (Zakharchuk et al., Arch.
  • an adenoviral vector of human origin preferably derived from a serotype C adenovirus, will be preferred, especially type 2 or 5.
  • the gene of interest in use in the present invention can come from a eukaryotic organism, from a prokaryote from a parasite or from a virus other than an adenovirus. It can be isolated by any conventional technique in the art, for example by cloning, PCR or chemical synthesis. It can be of genomic type (comprising all or part of all the introns), of complementary DNA type (cDNA, devoid of intron) or of mixed type (minigene). Furthermore, it can code for an antisense RNA and / or a messenger RNA (mRNA) which will then be translated into the polypeptide of interest, which may be (i) intracellular, (ii) incorporated into the membrane of the host cell or (iii) secreted.
  • mRNA messenger RNA
  • the gene of interest can code for an antisense RNA, a ribozyme, or even a polypeptide of interest.
  • chemokines and cytokines interferon ⁇ , ⁇ or ⁇ , interleukin (IL), in particular IL-2, IL-6, IL-10 or else IL-12, tumor necrotizing factor (TNF), colony stimulating factor (GM-CSF, C-CSF, M-CSF ...), MEP-l ⁇ , MLP-l ⁇ , RANTES, monocyte chemoattraction protein such as MCP-1 ”), cell receptors (especially recognized by the HTV virus), receptor ligands, coagulation factors (Factor VIII, Factor IX, thrombin, protein C), growth factors (FGF for Fibroblast Growth Factor, NEGF for Vascular Endothelial Growth Factor), enzymes (urease, renin, metalloproteinase, nitric oxide synthetase NOS, SOD, catalase, lecithin cholesterol acyl transferase LCAT
  • a functional copy of the defective gene will be used, for example a gene coding for factor NIII or IX in the context of hemophilia A or B, dystrophin (or minidystrophin) in in the context of Duchenne and Becker's myopathies, insulin in the context of diabetes, the CFTR protein (Cystic Fibrosis Transmembrane Conductance Regulator) in the context of cystic fibrosis.
  • factor NIII or IX in the context of hemophilia A or B
  • dystrophin or minidystrophin
  • insulin in the context of diabetes
  • the CFTR protein Cystic Fibrosis Transmembrane Conductance Regulator
  • TK-HSN-1 simplex virus l herpes 1
  • ricin thymidine kinase of
  • an immunoprotective polypeptide for example a CD4-immunoglobulin IgG hybrid; Capon et al., 1989, Nature 337, 525-531; Byrn et al., 1990, Nature 344, 667-670
  • an immunotoxin for example fusion of the antibody 2F5 or of the immunoadhesin CD4-2F5 to angiogenin; Kurachi et al., 1985, Biochemistry 24, 5494-5499
  • a trans-dominant variant for example fusion of the antibody 2F5 or of the immunoadhesin CD4-2F5 to angiogenin
  • One of the genes of interest can also be a selection gene making it possible to select or identify the transfected or transduced cells.
  • neo genes coding for neomycin phosphotransferase which confer resistance to the antibiotic G418, dhfr (Dihydrofolate Reductase), CAT (Chloramphenicol Acetyl transferase), pac (Puromycin Acetyl-Transferase) or gpt (Xanthine Guanine Phosphoribosyl Transferase) ).
  • the selection genes are known to those skilled in the art.
  • the expression cassette for the gene of interest can, in addition, include additional elements improving its expression or its maintenance in the host cell (origins of replication, elements of integration into the cell genome, intronic sequences, sequences poly A transcription termination, tripartite leaders ). These elements are known to those skilled in the art.
  • the gene of interest can also comprise, upstream of the coding region, a sequence coding for a signal peptide allowing its secretion from the host cell.
  • the signal peptide can be that of the gene in question or heterologous (from any secreted or synthetic gene).
  • the gene of interest expression cassette can be inserted at any location in the adenoviral genome.
  • it is introduced to replace the E3 region.
  • the recombinant adenoviral vector comprises several genes of interest, these can be placed under the control of the same genetic elements (polycistronic cassette using an internal translation initiation site of the IRES type to reinitiate the translation of the second cistron) or independent elements.
  • they can be inserted into a same adenoviral region (for example in replacement of E3) or in different regions (for example in replacement of E3 and another deleted region).
  • an inducible promoter comprises at least one target sequence responding to the transcriptional activator used and operatively associated with a minimal promoter.
  • the target sequences have been defined previously and are described in the literature accessible to those skilled in the art (as a reminder, ERE, GRE, EcRE, UAS, 5xE / GRE, XRE ). It is indicated that one can use a homologous sequence modified with respect to the native sequence but exercising a similar or improved regulatory function.
  • One or more target sequences can be used, for example from 1 to 25, advantageously from 1 to 10 and, preferably, from 1 to 7, optionally placed in tandem and in any orientation relative to the TATA box. It (s) is (are) generally inserted (s) in the inducible promoter upstream of the minimal promoter, up to several hundred base pairs thereof.
  • An example of a promoter inducible by a transcriptional activator derived from GR is the LTR of the MMTV virus (mouse mammary tumor virus) which contains the GRE element and suitable promoter sequences.
  • a minimal promoter essentially comprises a TATA box and a functional transcription initiation site in a host cell or organism. These elements are classic in the field of the art concerned. Mention may more particularly be made of the minimal promoters of the TK, CMN and HSP genes (minimal promoter of the Drosophila heat shock protein gene devoid of Penhancer).
  • the inducible promoter in use in the context of this The invention may include additional elements which improve the level of transcription or limit it to certain specific tissues (of the enhancer type). These additional elements can alternatively be inserted into a non-coding gene region.
  • the nucleotide sequences coding for the transcriptional activator and their regulatory elements are carried by the recombinant adenoviral vector of the expression system according to the invention.
  • the expression cassettes of the gene of interest and of the transcriptional activator can be located in the same region of the adenoviral genome or in different places and in sense or antisense orientation relative to each other. The anti-sense orientation is preferred.
  • a preferred example is provided by an El " E3 " vector in which each of the cassettes is inserted in place of the deleted adenoviral sequences.
  • the nucleotide sequences are carried by an independent expression vector other than the recombinant adenoviral vector in use in the expression system according to the invention.
  • It can be a synthetic vector (cationic lipids, polymer liposomes, etc.), a plasmid or even a viral vector. It can optionally be combined with one or more substances improving the transfection efficiency and / or the stability of the vector. These substances are widely documented in the literature accessible to those skilled in the art (see for example Felgner et al., 1987, Proc. West. Pharmacol. Soc.
  • lipids may be polymers, in particular cationic lipids, liposomes, nuclear proteins or even neutral lipids. These substances can be used alone or in combination.
  • a possible combination is a recombinant plasmid vector associated with cationic lipids (DOGS, DC-CHOL, spermine-chol, spermidine-chol etc.) and neutral lipids (DOPE).
  • plasmids which can be used in the context of the present invention are vast. They may be cloning and / or expression vectors. In general, they are known to humans and many of them are commercially available, but it is also possible to construct or modify them by genetic manipulation techniques. Mention may be made, as examples, of the plasmids derived from pBR322 (Gibco BRL), pUC (Gibco BRL), pBluescript (Stratagene), pREP4, pCEP4 (Invitrogene) or also p Poly (Lathe et al., 1987, Gene 57, 193-201).
  • a plasmid used in the context of the present invention contains an origin of replication ensuring the initiation of replication in a producer cell and / or a host cell (for example, the ColEl origin will be retained for a plasmid intended to be produced in E. coli and the oriP / EBNAl system if it is desired to be self-replicating in a mammalian host cell, Lupton and Levine, 1985, Mol. Cell. Biol. 5, 2533-2542; Yates and al., Nature 313, 812-815). It can also comprise a selection gene making it possible to select or identify the transfected cells (complementation of an auxotrophy mutation, gene coding for resistance to an antibiotic, etc.).
  • cer sequence which promotes the monomeric maintenance of a plasmid (Summers and Sherrat, 1984, Cell 36, 1097-1103, sequences of integration into the cell genome).
  • a viral vector it is possible to envisage a vector derived from an adenovirus, a retrovirus, a virus associated with the adenovirus (AAN), a virus of the herpes, an alphavirus, a parvovirus, a poxvirus (fowlpox, canaripox, vaccinia virus, in particular of the MVA (Modified Virus Ankara) or Copenhagen strain, etc.) or a foamyvirus.
  • AAN a virus associated with the adenovirus
  • AAN virus associated with the adenovirus
  • a virus of the herpes an alphavirus
  • a parvovirus a poxvirus
  • poxvirus canaripox
  • vaccinia virus in particular of the MVA (Modified Virus Ankara) or Copenhagen strain, etc
  • Retroviruses have the property of infecting and integrating mainly in dividing cells and in this respect are particularly suitable for cancer application.
  • a retroviral vector suitable for implementing the present invention comprises the LTR terminal sequences, a region packaging and the nucleotide sequences coding for the transcriptional activator whose expression is controlled by the retroviral promoter (in the 5 ′ LTR) or by an internal promoter as mentioned above. It can be derived from a retrovirus of any origin (murine, primate, feline, human, etc.) and in particular from MoMuLV (Moloney murine leukemia virus), MNS (Murine sarcoma virus) or Friend murine retrovirus (Fb29).
  • MoMuLV Moloney murine leukemia virus
  • MNS Murine sarcoma virus
  • Fb29 Friend murine retrovirus
  • the retroviral vector according to the invention may include modifications in particular at the level of the LTRs (replacement of the promoter region by a eukaryotic promoter) or of the packaging region (replacement by a heterologous packaging region, for example of the VL30 type). (see French applications 94 08300 and 97 05203).
  • An adenoviral vector is particularly suitable for the expression of the transcriptional activator envisaged in the context of the present invention.
  • a defective vector having one of the above characteristics will be used.
  • the recombinant (carrying the inducible expression cassette for the gene of interest) and independent (carrying the expression cassette of the transcriptional activator) adenoviral vectors are preferably both deficient for the E1 function by deletion of any or part of the El region or non-functional mutation. If necessary, one or the other or both can be further deficient for at least one of the functions E2, E4, L1, L2, L3, L4 and / or L5. Similarly, a deletion of all or part of the E3 region can be envisaged for one or both of the vectors.
  • the viral vectors (recombinant adenoviral vector and, where appropriate, said independent viral vector) forming part of the expression system according to the invention can be in the form of DNA vector or of infectious viral particle.
  • the present invention also relates to a recombinant adenoviral vector comprising
  • nucleotide sequences coding for a transcriptional activator placed under the control of regulatory elements appropriate for their expression in a host cell or organism
  • the recombinant adenoviral vector according to the invention can code for a transcriptional activator having the characteristics defined above which, in the form activated by an inducer as described above, has the capacity to initiate or activate the transcription of a gene controlled by an inducible promoter comprising a target sequence specific for said transcriptional activator as described above.
  • the recombinant adenoviral vector according to the invention can code for a prokaryotic transcriptional activator and, in particular, a polypeptide comprising a DLL and a DNA binding domain derived from a repressor of the tetracycline operon (tetR) and any transcription activation domain.
  • tetR tetracycline operon
  • an unnatural inducer activating tTA will be used, such as doxycycline, tetracycline or an agonist analog.
  • the characteristics of the inducible expression cassette for the gene of interest are the same as above, apart from the presence of one or more target sequence (s) responding to the prokaryotic transcriptional activator.
  • the target sequence consists of the tetracycline operator (tetO).
  • tet O - minimum promoter is particularly preferred, giving rise to a promoter whose base level of transcription is naturally very weak but can be activated by the tTA inducer and repressible by tetracycline.
  • the present invention also relates to an infectious viral particle comprising a recombinant adenoviral vector according to the invention.
  • adenoviral vectors The techniques for preparing adenoviral vectors are widely documented in the literature.
  • the genome is reconstituted by homologous recombination in line 293 (see in particular Graham and Prevect, 1991, Methods in Molecular Biology, Vol 7, Gene Transfer and Expression Protocols; Ed EJ Murray, The Human Press Inc, Clinton, NJ) or in Escherichia coli (Charrier et al., 1996, J. Virol. 70, 4805-4810; WO96 / 17070). It is then necessary to propagate the vector in order to constitute a stock of viral particles containing it. Complementation lines are used for this purpose, providing in viral expression products for which the vector is defective.
  • viruses deleted from E1 can be propagated in line 293, established from human embryonic kidney cells (Graham et al., 1977, J. Gen. Virol. 36, 59-72).
  • second generation vectors it is possible to have recourse to lines complementing two essential viral functions, such as those described by Yeh et al. (1996, J. Virol. 70, 559-565), Krougliak and Graham (1995, Human Gene Therapy 6, 1575-1586), Wang et al. (1995 Gene Therapy 2, 775-783), Lusky et al. (1998, J. Virol. 72, 2022-2033) and in international applications WO94 / 28152 and WO97 / 04119.
  • helper virus an additional viral element, designated "helper virus” to at least partially complement the defective functions of a recombinant adenoviral vector.
  • helper viruses of the prior art consist of an adenoviral genome, possibly deleted from an essential region for which the recombinant vector does not require complementation.
  • the invention also relates to a process for preparing a viral particle, according to which:
  • a recombinant adenoviral vector according to the invention is introduced into a complementation cell capable of complementing said vector in trans, so as to obtain a transfected complementation cell,
  • the viral particle can be recovered from the culture supernatant but also from the cells.
  • One of the commonly used methods is to lyse the cells by consecutive freeze / thaw cycles to collect the virions in the lysis supernatant. These can be amplified and purified according to the techniques of the art (chromatographic process, ultracentrifugation in particular through a gradient of cesium chloride ).
  • the present invention also relates to a eukaryotic cell comprising an inducible expression system, a recombinant adenoviral vector according to the invention or infected with a viral particle according to the invention.
  • a eukaryotic cell comprising an inducible expression system, a recombinant adenoviral vector according to the invention or infected with a viral particle according to the invention.
  • a cell is constituted by any cell transfectable by a vector or infectable by a viral particle, as defined above.
  • a mammalian and in particular human cell is particularly suitable.
  • It may be a primary or tumor cell of any origin, in particular hematopoietic (totipotent stem cell, leukocyte, lymphocyte, monocyte or macrophage ...), muscle (satellite cell, myocyte, myoblast, smooth muscle ..) .), cardiac, pulmonary, tracheal, hepatic, epithelial or fibroblast.
  • hematopoietic totipotent stem cell, leukocyte, lymphocyte, monocyte or macrophage
  • muscle satellite cell, myocyte, myoblast, smooth muscle ..) .
  • cardiac pulmonary, tracheal, hepatic, epithelial or fibroblast.
  • the present invention also relates to a pharmaceutical composition, an inducible expression system, an adenoviral vector. recombinant, a viral particle or a host cell according to the invention in association with a pharmaceutically acceptable vehicle.
  • a composition according to the invention is more particularly intended for the preventive or curative treatment of diseases by gene therapy (including immunotherapy) and is more particularly intended for proliferative diseases (cancers, tumors, dysplasias, etc.), infectious diseases and especially viral (induced by hepatitis B or C viruses, HIV, herpes, retroviruses, etc.), genetic diseases (cystic fibrosis, myopathies, hemophilia, diabetes, etc.) and cardiovascular diseases (restenosis, ischemia, dislipidemia ).
  • a composition according to the invention can be manufactured in a conventional manner for administration by the local, parenteral or digestive route. In particular, a therapeutically effective amount of the therapeutic or prophylactic agent is combined with a pharmaceutically acceptable carrier.
  • routes of administration Mention may be made, for example, of the intragastric, subcutaneous, intracardiac, intramuscular, intravenous, intraarterial, intraperitoneal, intratumoral, intranasal, intrapulmonary or intratracheal route.
  • administration by aerosol or instillation is advantageous.
  • the administration can take place in single dose or repeated one or more times after a certain interval of interval.
  • the route of administration and the appropriate doses of virus vary depending on various parameters, for example, the individual, the pathology, the gene of interest to be transferred, the route of administration.
  • preparations based on viral particles can be formulated in doses of between 10 4 and 10 14 pfu (units forming plaques), advantageously 10 5 and 10 pfu and, preferably, 10 and 10 pfu.
  • doses comprising from 0.01 to 100 mg of DNA, preferably 0.05 to 10 mg and, most preferably, 0.5 to 5 mg can be considered.
  • the formulation may also include a pharmaceutically acceptable diluent, adjuvant or excipient, as well as solubilizers, stabilizers, preservatives.
  • a preferred composition is in injectable form.
  • saline phosphate, monosodium, disodium, magnesium, potassium .
  • isotonic solution It can be presented as a single dose or in multidose in liquid or dry form (powder, lyophilisate, etc.) capable of being reconstituted extamporanally with an appropriate diluent.
  • the present invention also relates to the therapeutic or prophylactic use of an inducible expression system, a recombinant adenoviral vector, a viral particle or a host cell according to the invention for the preparation of a medicament intended for the transfer and expression of said gene of interest in a cell or a host organism and, in particular, for the treatment of the human or animal body by gene therapy.
  • the medicament can be administered directly in vivo (for example by intravenous injection, in an accessible tumor, in the lungs by aerosol, in the vascular system by means of an appropriate probe ).
  • the prevention and treatment of many pathologies can be considered.
  • a preferred use is to treat or prevent cancers, tumors and diseases resulting from unwanted cell proliferation.
  • cancers of the breast, of the uterus in particular those induced by papillomas virus
  • the prostate in particular those induced by papillomas virus
  • the lung of the bladder
  • the liver in particular those induced by papillomas virus
  • the pancreas of the stomach
  • cardiovascular diseases for example to inhibit or delay the proliferation of smooth muscle cells in the vascular wall (restenosis).
  • restenosis smooth muscle cells in the vascular wall
  • the invention also extends to a method for the treatment of diseases by gene therapy, characterized in that an organism or a host cell in need of such treatment is administered an inducible expression system, a recombinant adenoviral vector, a viral particle or a host cell according to the invention.
  • the invention also relates to a transcriptional activator comprising a DLL and a trans-activation domain derived from a steroid receptor and a heterologous DNA binding domain, in particular derived from the yeast protein Gal4.
  • a transcriptional activator is obtained by exchanging by molecular biology techniques the domain of binding to the DNA of the steroid receptor by that of Gal4 (in particular carried by residues 1 to 74).
  • An ER T or GR dex and Gal4 hybrid is most preferred.
  • Figure 1 is a schematic representation of the amount of FIX produced 144 h after transient transfection of 293 cells with the plasmids pTG13064 (CMV-GR dex ), pTG6242 (LTR MMTV-FIX, sense) and pTG13063 (LTR MMTV-FIX, anti -meaning).
  • Figure 2 Evaluation of the Dexamethasone Dose / Response effect in A549 cells.
  • Dexamethasone induction is performed in varying the concentration from 10 "9 to 10 " 7 M.
  • FIG. 3 Schematic representation of the constructions AdTG13075, AdTG13088, AdTG13092 and AdTG13245.
  • Figure 4 (a, b, c and d): In vivo evaluation of the Grdex / Dexamethasone inducible system with the different constructs tested in C57B1 / 6 mice. The values presented are the means of the values measured in each of the treated mice.
  • Figure 5 (a, b, c and d): In vivo evaluation of the Grdex / Dexamethasone inducible system with the different constructs tested in SCID mice. The values presented are the means of the values measured in each of the treated mice.
  • Figure 6 Evaluation of a Dexamethasone Dose / Response effect in vivo in SCID mice.
  • Figure 7 Schematic representation of adenoviral vectors derived from the first and second generation plasmid pTg6401.
  • coli 5K (hsdR, mer A), DH5 ⁇ [(recAl, endAl, hodR17 (rm-), supE44 thi-1, gyrA (nalr)] or NM522 strains (supE, thi, ⁇ (lac-proAB), ⁇ hsd5, (rm-), (F 'proAB, lacl q , Z ⁇ M15) and those of homologous recombination in the strain E. coli BJ 5183 (Hanahan, 1983, J. Mol. Biol. 166, 557-580). restriction site repair, the technique used consists of filling the protruding 5 'ends with the large fragment of DNA polymerase I of E.
  • adenoviral genome fragments used in the various constructions described below are indicated precisely according to their position in the nucleotide sequence of the Ad5 genome as disclosed in the Genebank database under the reference M73260.
  • cell lines 293 (Graham et al, 1977, supra; available from ATCC under reference CRL1573), A549 E1 + (WO94 / 28152), A549 (ATCC CCL-185) and Vero (ATCC CCL-81). It is understood that other cell lines can be used.
  • the cells are maintained in culture at 37 ° C. in a humid atmosphere enriched with 5% CO 2 in DMEM medium (Dulbecco's Modified Eagle Medium, Gibco BRL) supplemented with 1 mM glutamine, 1% amino acids (Gibco BRL) , 40 ⁇ g / l gentamycin and 10% fetal calf serum (SVF, Gibco BRL).
  • DMEM medium Dulbecco's Modified Eagle Medium, Gibco BRL
  • 1 mM glutamine 1 mM glutamine
  • 1% amino acids Gibco BRL
  • 40 ⁇ g / l gentamycin 40 ⁇ g / l gentamycin
  • EXAMPLE 1 Construction of an adenoviral vector coexpressing the t'raacctivivatateuurr ttrraannscriptionnel ER T and the FIX gene regulated by the ERE sequences.
  • the cDNA of the wild-type ER gene is contained in the plasmid pSG1-HEO (Tora et al., 1989, EMBO J. 8, 1981-1989).
  • the estrogen binding domain is contained in the plasmid pSG1-HEO (Tora et al., 1989, EMBO J. 8, 1981-1989).
  • ER sequences are inserted in the EcoKI site of the transfer vector pTG6600.
  • pTG6600 is a polyll p vector (Lathe et al., 1987, Gene 57, 193-201) into which are inserted the Ad5 sequences 1 to 458, the CMN early promoter, the hybrid splicing sequences found in the plasmid pCI (Promega Corp, comprising the splice donor site of the intron 1 of the human ⁇ -globin gene and the splice acceptor site of the mouse immunoglobulin gene), the polyadenylation sequences of the SN40 virus and the sequences Ad5 3328-5788.
  • the vector thus obtained pTG6237 contains the CMN-ER expression cassette present in the E1 region.
  • pTG6246 The final construction designated pTG6246 is reconstituted by homologous recombination (Charrier et al., 1996, J. Nirol. 70, 4805-4810) between the Pacl-Bst EU fragment isolated from the preceding vector and pTG4656 linearized by ClaI.
  • the latter is an adenoviral plasmid El " E3 " containing in El the LacZ gene under the control of the MLP promoter (described in application FR97 06757).
  • the adenoviral genome carried by pTG6246 comprises the CMN-ER cassette in the E 1 region and is deleted from the E3 region.
  • the AD ⁇ c of human FIX (Anson et al, 1984, EMBO J. 3, 1053-1060) is cloned in the form of a Bam ⁇ l fragment isolated from a plasmid of the anterior part (for example described in patent 88 14635) and inserted downstream of the minimal promoter TK-HSN preceded by the ERE sequence (Klein-Hitpass et al, 1986, Cell 46, 1053-1061).
  • the cassette is introduced into the BglI site of pTG4664 in sense and antisense orientation (giving pTG13227 and pTG13228 respectively).
  • Plasmid pTG4664 comprises nucleotides 25838 to 320004 of PAd5 deleted from nucleotides 27871 to 30748 of the E3 region. Homologous recombination with the plasmid pTG6401 digested by Sfr1 (comprising the genome Ad5 deleted from the regions El and E3) makes it possible to generate the adenoviral vectors El " E3 " carrying the inducible cassette ERE / TKp-FIX in sense and antisense orientation in the region E3 .
  • the construction sense (corresponding to the sense of transcription of E3) is called pTG13235 and the anti-sense construction pTG13236.
  • CMN-ER and ERE / TKp-FIX in place of the regions El and E3 respectively are generated by homologous recombination between the fragments carrying the inducible FIX cassette isolated from the vectors pTGl 3227 and pTGl 3228 and the vector pTG6246.
  • PTG13233 and pTG13234 are obtained according to the orientation of the inducible cassette.
  • EXAMPLE 2 Construction of an adenoviral vector co-expressing the t'raaccttiivvaatteeuurr ttrraannsscc ⁇ riptionnel GR ex and the FIX gene regulated by the GRE sequences.
  • the AD ⁇ c of the GR receptor ex carried by the EcoRI fragment (2.7Kb) of the plasmid pHGl (Kumar et al, 1987, Cell 51, 941-951) is cloned in the Ec ⁇ KL site of the vector pTG6600, to give pTG13064.
  • the adenoviral vector pTG13075 containing the expression cassette CMNp-GR ex in replacement of the El region and deleted from the majority of the E3 region is obtained by homologous recombination between the Pacl-Bst EU fragment isolated from the preceding vector and pTG4656 linearized by CM .
  • the BamHI fragment containing P AD ⁇ c of human FIX is inserted downstream of the LTR of MMTV containing the sequence GRE (Cato et al, 1986, EMBO J. 5, 2237-2240).
  • the cassette is then introduced in sense and antisense orientation into the BgH1 site of pTG4664 bordering on the deleted E3 sequences.
  • the transfer vectors are designated pTG6242 (sense) and pTG13063 (antisense).
  • Homologous recombination with the plasmid pTG13075 makes it possible to generate the adenoviral vectors El " E3 " carrying the inducible LTR cassette MMTV-FIX in sense and antisense orientation in the E3 region and the CMV-GR ex cassette in the El region.
  • the sense construction (identical to the transcription direction of E3) is called pTG13083 and the antisense construction pTG13092 (reverse transcription direction for FIX and GR ex cassettes).
  • EXAMPLE 3 Construction of an adenoviral vector co-expressing the transcriptional activator VgEcR and the FTX gene regulated by the 5xE / GRE sequences.
  • the plasmid pNgRXR (In Nitrogen) comprises the two subunits composing the transcriptional activator activatable by ecdysone or its analog muristerone A.
  • the first is composed of the receptor of ecdysone (VgEcR) modified at the level of three amino acids P DNA binding domain so as to obtain a sequence analogous to that of the GR receptor and fused in phase to the trans-activation domain of VP16 and the second of the human retinoic acid receptor RXR (No et al, 1996, Proc Natl. Acad. Sci. USA 93, 3346-3351).
  • the two cDNAs coding for VgEcR and RXR directed by the promoters CMV and RSV respectively are modified by the introduction of an intron at 5 ′ of the coding sequences (pCI intron for CMVp-VgEcR and rabbit ⁇ -globin intron for RSVp-RXR) and are introduced into the El region of an adenoviral vector according to the preceding technique.
  • the sequences coding for human FIX are introduced downstream of an inducible promoter comprising the target sequence 5xE / GRE coupled to the minimal promoter ⁇ hsp (pIND; In Vitogen).
  • the cassette is introduced in the two orientations into the BgU1 site of pTG4664.
  • the homologous recombination with pTG6401 digested with Sfr1 makes it possible to generate the plasmids carrying the inducible cassette in the E3 region in sense or antisense orientation.
  • the doubly recombinant adenoviral vector is obtained by homologous recombination with the transfer vector containing the sequences VgEcR and RXR.
  • the recombinant adenoviral vectors containing the activator and / or FIX expression cassettes are released from the corresponding plasmids (pTG13083, pTG13092, pTG13233, pTG13234 ...) by Pacl digestion before being transfected into the complementation line 293.
  • Le cell lysate is harvested, subjected to three successive stages of freezing / thawing in order to release the viral particles then clarified by centrifugation at 3500 rpm for 5 min.
  • the virions present in the supernatant can optionally be amplified by passage over a permissive line (293 or A 549-E 1+) and purified on a cesium chloride gradient according to Part techniques.
  • the adenoviral stock is dialyzed in an appropriate formulation buffer as described in WO98 / 02522 (for example IM sucrose, 150 mM NaCl, MgCl 2 ImM, 10 mM Tris-HCl and 0.1% Tween 80).
  • the viral titer is determined in infectious units by assaying the DBP protein by immunofluorescence (Lusky et al, 1998, J. Virol. 72, 2022-2032) or in number of viral particles by spectrophotometric measurement at 260 nm.
  • a control vector is constructed by inserting P cDNA of human TX factor under the control of the CMV promoter isolated from the plasmid pCI (Proméga).
  • the constitutive expression cassette is introduced into the E3 region, giving pTG13231 (sense orientation) and pTG13232 (antisense orientation). Virions are produced according to the same methodology as above.
  • EXAMPLE 5 In vitro evaluation of the system inducible by GR dex .
  • the transfer vectors pTG13064, pTG6242 and pTG13063 carrying respectively the CMN-GR dex , LTR MMTV-FIX (sense) and LTR MMTV-FLX (antisense) cassettes are transiently transfected in 293 cells (5 ⁇ g of DNA for 10 6 cells).
  • the plasmid pTG13064 is cotransfected with either pTG6242 or pTG13063.
  • Cultures are continued in the presence of dexamethasone (10 M) or in its absence. Cell supernatants are removed 48, 96, 120 and 144 hours after transfection and the quantity of FIX produced is determined by ELISA (Asserachrom kit; Diagnostica Stago). The results presented in FIG.
  • the receptor expressed by pTG13064 is therefore functional insofar as in the activated state (in the presence of dexamethasone), it can bind to the GRE motifs of MMTV and induce the transcription of the FIX gene.
  • the basal activity of the system is very low. In fact, the quantity of FLX produced in the absence of dexamethasone or pTG13064 is low, even negligible.
  • the kinetics of expression of the FIX as a function of time show that the maximum production level is reached 120 h after the transfection.
  • the non-permissive Vero or A549 host cells are infected with the AdTG13083 or AdTG13092 virions carrying the CMV-GR ex and MMTN-FIX cassettes (sense for the first virus and antisense for the second) or co-infected with the adenovirus AdTG13075 ( CMV-GR dex) and AdTG13082 (MMTV-FIX sense) or AdTG13088 (MMTV-FIX anti-sense).
  • MOI multipleplicity of infection
  • 100 is used for the infection experiments and 50 for each of the viruses in the case of co-infection.
  • the quantity of FLX produced in the culture supernatants is assayed by ELISA.
  • Vero cells the expression of FIX can only be quantified after infection with the AdTG13092 virions carrying the two cassettes and in the presence of the inducer. No induction takes place in the absence of dexamethasone or the GR dex receptor. It should be noted that these cells do not express wild GR.
  • FIX is produced in the presence of dexamethasone in cells infected with AdTG13088 or AdTG13092. It should be noted that these cells express wild GR. However, the level of FIX is delayed over time in the absence of GR dex (virion AdTG13088).
  • the inducible system using the GR dex receptor and dexamethasone is functional in constructions in which the inducible MMTV-FIX cassette is in antisense orientation (AdTG13088 and AdTG13092).
  • the cis induction system (cassettes carried by a single virus) is significantly more productive than a trans system using two viruses, in particular in Vero cells.
  • Vero cells are infected with the AdTG13092 virus at an MOI of 10, 50 or 100.
  • PAdTG13075 is used as a control.
  • the FIX assay is performed 48 and 72 hours after infection. A production of FIX is observed whatever the MOI used, but the optimal level of expression is obtained for an MOI of 50.
  • the inducer concentration was also varied from 10 "9 to 10 " 5 M. At high concentration, dexamethasone proves to be cytotoxic, resulting in a lesser expression of the FIX. At low concentration (10 " M and above), the induction ⁇ is not effective. The optimum is located at 10 M.
  • induction of the reporter gene can be carried out in a controlled and selective manner, including in the presence of the wild-type GR receptor, using lower doses of ligand. This aspect is important for in vivo applications, natural conditions for which the wild-type GR receptor is expressed.
  • EXAMPLE 6 In vivo evaluation of the system inducible by GR eg .
  • the AdTG13092 virus is injected intravenously into immunocompetent C57B1 / 6 mice at the rate of 4x10 8 or 8x108 iu.
  • Dexamethasone is administered to animals intraperitoneally at a concentration of 100 ⁇ g for 3 consecutive days (D0, D1 and D2).
  • the serums are collected regularly from the 3rd day following infection and the quantity of FIX produced is evaluated by ELISA. Under these conditions, a significant production of FIX is observed.
  • EXAMPLE 7 In vivo evaluation of the inducible GR dex system in immunocompetent mice.
  • the AdTG13092, AdTG13088 and AdTG13245 viruses are injected intravenously into immunocompetent C57BI / 6 mice at the rate of 5 ⁇ 10 8 iu.
  • the viruses AdTG13088 and AdTG13075 ( Figure 3) are also co-injected at the rate of 5 ⁇ 10 8 iu each.
  • the induction phase is carried out by intraperitoneally injecting 100 ⁇ g of Dexamethasone for 3 consecutive days (D0-D1-D2, D21-D22-D23 and D42-D43-D44).
  • This induction is carried out through the wild-type GR receptor, expressed by murine cells and activatable by Dexamethasone.
  • the level of expression of the FIX is 10 times lower than that obtained in the case of mice expressing the modified GR ex receptor;
  • the viruses AdTG13092, AdTG13088 and AdTG13245 are injected intravenously into immunodeficient scid / scid mice at the rate of 5 ⁇ 10 8 iu.
  • the AdTG13088 and AdTG13075 viruses are also co-injected at the rate of 5 ⁇ 10 8 iu each.
  • Induction is carried out by injecting 100 ⁇ g of Dexamethasone intraperitoneally for 3 consecutive days (D0-D1-D2, D21-D22-D23 and D42-I43-D44).
  • mice sera are taken at different times in order to evaluate the production of FIX by the ELISA technique.
  • - FIX expression is induced by Dexamethasone after injection of the vector AdTG13088, through the wild-type GR receptor.
  • the induction level is stable over time;
  • the level of induction in the presence of GR dex is comparable to the expression of the gene linked to the constitutive promoter CMN (at least during the first induction);
  • the vectors AdTG13092 and AdTG13088 are injected intravenously into immunodeficient sciaVscid mice at the rate of 5 ⁇ 10 8 iu.
  • the induction is carried out by injecting 50 or 5 ⁇ g of Dexamethasone intraperitoneally for 3 consecutive days (D0-D1-D2 and D21-D22-D23). The sera are taken at different times in order to evaluate the production of FIX by ELISA.
  • EXAMPLE 10 Development of an inducible expression system capable of preventing the development of an immune response after in vivo administration of adenoviral vector.
  • Adenoviral vectors represent a system of choice for transferring a therapeutic gene to a patient.
  • expression of the transgene is generally transient. For this reason, it is necessary to repeat the administrations of the adenoviral vector in order to ensure prolonged expression of the therapeutic gene.
  • a first injection of adenovirus frequently leads to the development of an immune response which prevents any further administration.
  • the inventors have developed a new approach based on the expression of an immunosuppressive molecule capable of preventing the establishment of this anti-adeno virus immune response. For this, the inventors have inserted the gene coding for interleukin-10 (DL-10) in an inducible expression system carried by an adenoviral vector.
  • DL-10 interleukin-10
  • the deletions of the E4 or E2a regions make any residual expression of viral protein disappear. However, the toxicity is not reduced by eliminating the E2a region. On the other hand, the deletion of the E4 region leads to a significant reduction in hepatic toxicity after intravenous injection. Despite DNA persistence, however, expression of the transgene is often significantly reduced.
  • Interleukin-10 is known to have immunosuppressive properties and has shown promising results in transplant rejection and in anti-inflammatory treatments.
  • IL-10 is secreted by many cells (monocytes / macrophages, T cells, B cells after activation by an antigen) and has many target cells (including monocytes
  • Human and rat interleukins-10 are very homologous, 84% homology at the nucleotide level and 73% at the protein level.
  • IL-10 has an immunosuppressive effect on monocytes / macrophages.
  • EL-10 stimulates the viability, the secretion of antibodies and the expression of MHC class II of B lymphocytes. It also has a stimulating role on mast cells and on CD8 + T cells. Overall, PE - 10 however has a very strong immunosuppressive effect.
  • the anti-inflammatory and immunosuppressive properties of PIL-10 could be involved in suppressing the production of neutralizing antibodies against recombinant adenovirus. Indeed, the co-injection of adenovirus coding for IL-10 and for ⁇ -galactosidase prevents the induction of the immune response against the virus and the production of CTL, thus allowing prolonged expression of the reporter gene.
  • the system we have developed is based on induction by hormones. Indeed, these will bind to their nuclear receptor, consisting of a hormone binding domain, a DNA binding domain and a transactivation domain. After conformational change and fixation on the target elements located at the DNA level, the transcription of the gene located downstream of the regulatable promoter will thus be activated.
  • the inventors have chosen to use modified receptors at the level of the hormone binding domain. These mutated receptors such as estrogen or progesterone receptors are able to respond to synthetic exogenous ligands, but not to endogenous hormones.
  • the inventors have developed a system based on the modified glucocorticoid receptor, GR dex , capable of inducing the expression of the transgene located downstream of the GRE elements (Glucocortico ⁇ d Responsive Element) after activation by dexamethasone, but not by endogenous glucocorticoids.
  • GRE elements Glucocortico ⁇ d Responsive Element
  • dexamethasone Glucocortico ⁇ d Responsive Element
  • adenoviral vectors derive from the plasmid pTg6401 comprising the genome of the human adenovirus type 5 deleted from nucleotides 459 to 3327 (region) E1) and from nucleotides 28 592 to 30 470 (region) E3).
  • the modified GR dex gene is introduced into the El region of the genome of the adenovirus type 5 by homologous recombination between the plasmid pTg6401 and the transfer plasmid containing the GR d6X cDNA under the control of CMN promoter (Cytomegalovirus), a chimeric intron (pCI, Promega) and a polyadenylation signal of SN40.
  • CMN promoter Cytomegalovirus
  • pCI chimeric intron
  • Promega polyadenylation signal of SN40.
  • the cDNA is placed downstream of 4 elements of response to glucocorticoids GRE (Glucocortico ⁇ d Responsive Element) contained in the LTR promoter of MMTV (Mouse Mammary Tumor Virus).
  • GRE Glucocortico ⁇ d Responsive Element
  • MMTV Mouse Mammary Tumor Virus
  • Ad-GR dex or ⁇ Tg6401 Homologous recombination of this transfer vector with the adenoviral vectors Ad-GR dex or ⁇ Tg6401 makes it possible to generate either a vector carrying the expression cassette of the activator in El and the inducible cassette in E3 in antisense orientation (Ad-GR dex -MMTV / TL-10-E4 wild) or a vector containing only the E3 induction cassette (Ad- ⁇ El-MMTV / TL10-E4 wild).
  • the rat EL-10 cDNA was also placed under the control of the CMV promoter.
  • This constitutive expression cassette was inserted into the E3 region of pTg6401 in antisense orientation (Ad- ⁇ EI-CMV / TLIO). All the second generation constructs are obtained by homologous recombination between the transfer plasmid containing the reading frames 3 and 4 (ORF3.4) of the E4 region and the preceding first generation vectors.
  • the 293 cells are transfected with the transfer plasmids containing the expression cassettes of rat interleukin-10 in the presence or not of the expression cassette of the GR dex activator. They are cultured in the presence or absence of dexamethasone (10 "7 M) in DMEM 10% FCS. The supernatants are removed at different times in order to analyze the expression of the transgene.
  • the A549 and VERO cells are seeded the day before at 3.10 5 cells in 6-well plates.
  • the cells are infected at an MOI of 50 with the various viral preset in 250 ⁇ l DMEM 2% SVF. After 30 minutes of adsorption at 37 ° C., 3 ml of DMEM 2% FCS are added to the cells in the presence or absence of 10 "7 M dexamethasone. The supernatants are removed at different times in order to analyze the expression of the transgene.
  • Detection of rat PIL-10 is carried out using the OptEIA TM kit (Pharmingen). The kits are used according to manufacturers' specifications.
  • the induction of IL-10 by dexamethasone was evaluated by transient transfection of the transfer plasmids in 293 cells.
  • the induction capacity is analyzed by co-transfecting the transfer vector MMTV-ILIO with the vector expressing the GR dex trans-activator.
  • the transfection of the plasmid MMTV-IL10 alone will indicate the level of expression of IL-10 in the absence of the trans-activator.
  • the level of induction is compared with the constitutive expression of PIL-10 under control of the CMN promoter, by also transfecting this plasmid into 293 cells. Induction is carried out in the presence or not of dexamethasone at a concentration of 10 7 M.
  • the culture supernatants are removed 72 and 120 hours after transfection in order to quantify PIL-10 per ELIS A kit.
  • the co-transfection of the MMTN-ILIO and GR dex plasmids in the presence of dexamethasone allows the induction of PIL-10 (50 ng / ml at 120 H post-transfection).
  • the inventors have demonstrated that the contribution of the GR dex trans-activator and of the dexamethasone ligand allows an induction of the expression of IL-10 under the control of the inducible promoter MMTV.
  • the efficacy of induction of IL-10 by dexamethasone coupled to GR dex was evaluated in vitro by infection of human A549 cells and simian VERO cells with the vectors Ad-MMTV-ILIO ⁇ AdGR dex or Ad-GR dex - MMTV-IL10. These two types of infection make it possible to evaluate the efficiency of induction in trans or in cis.
  • the cell cultures are carried out in the presence or not of dexamethasone 10 "7 M.
  • IL-10 obtained will be compared with that obtained after infection with Ad-CMNIL-10 expressing this cytokine constitutively.
  • the PE -IO induction is compared to that of human factor IX inserted in the same constructions, evaluated in vitro beforehand. The supernatants are removed at 24, 48, 72 and 96 hours post-infection in order to quantify IL-10. and factor IX produced, using ELIS A kits.
  • the expression of P IL-10 is induced when the cells are co-infected with Ad-MMTV-ILIO + Ad-CMV-GR dex in the presence of dexamethasone, to reach 50.8 ng / ml 96 hours after infection.
  • IL-10 is barely detectable (1.2 ng / ml).
  • the GR dex trans-activator no significant induction of the expression of IL-10 can be noted (3 ng / ml in the presence of dexamethasone, corresponding to the residual expression obtained in transient transfection; 0.7 ng / ml in the absence of dexamethasone).
  • the inventors were therefore able to demonstrate that in VERO cells, the expression PIL-10 can be induced by dexamethasone coupled to GR dex in "trans", when the two expression cassettes are carried by two different adenoviral vectors.
  • A549 cells they were also able to verify the functionality of the “trans” inducible system. Indeed, the concentration of EL-10 reaches 32.3 ng / ml in the presence of dexamethasone after co-infection with the vectors Ad-MMTV-ILIO + Ad-CMV-GR dex . In the absence of a ligand, the cytokdne is undetectable. The expression of PIL-10 is also induced by dexamethasone after infection with the vector Ad-MMTV-ILIO alone. This activation takes place through the wild-type GR receptor expressed by A549 cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Diabetes (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Cardiology (AREA)
  • Hematology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP99940240A 1998-08-28 1999-08-27 Induzierbares expresionssystem Withdrawn EP1108051A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9810842A FR2782732A1 (fr) 1998-08-28 1998-08-28 Systeme d'expression inductible
FR9810842 1998-08-28
PCT/FR1999/002051 WO2000012741A2 (fr) 1998-08-28 1999-08-27 Systeme d'expression inductible

Publications (1)

Publication Number Publication Date
EP1108051A2 true EP1108051A2 (de) 2001-06-20

Family

ID=9529972

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99940240A Withdrawn EP1108051A2 (de) 1998-08-28 1999-08-27 Induzierbares expresionssystem

Country Status (6)

Country Link
EP (1) EP1108051A2 (de)
JP (1) JP2002523106A (de)
AU (1) AU5426299A (de)
CA (1) CA2341775A1 (de)
FR (1) FR2782732A1 (de)
WO (1) WO2000012741A2 (de)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU3642601A (en) * 1999-11-05 2001-05-30 Avigen, Inc. Ecdysone-inducible adeno-associated virus expression vectors
EP1274464B1 (de) * 2000-03-13 2011-09-21 Engene, Inc. Zusammensetzungen und verfahren zur regulierten proteinexpression im darm
WO2003072744A2 (en) * 2002-02-25 2003-09-04 University Of Rochester Dna construct for inducible expression of angiogenic protein and use thereof
DK1531666T3 (da) * 2002-05-29 2014-01-13 Regeneron Pharma Inducerbart eukaryot-ekspressionssystem
US8673589B2 (en) 2002-05-29 2014-03-18 Regeneron Pharmaceuticals, Inc. Inducible eukaryotic expression system
CN1705744A (zh) * 2002-10-14 2005-12-07 豪夫迈－罗氏公司 具有免疫调节剂的可移植细胞
AU2004263274B2 (en) 2003-07-21 2009-11-05 Transgene S.A. Novel multifunctional cytokines
WO2008020318A2 (en) 2006-03-30 2008-02-21 Engene, Inc. Non-viral compositions and methods for transfecting gut cells in vivo
WO2014066443A1 (en) 2012-10-23 2014-05-01 Emory University Gm-csf and il-4 conjugates, compositions, and methods related thereto
EP3221456B1 (de) * 2014-11-21 2021-09-22 University of Florida Research Foundation, Inc. Genommodifizierte rekombinante adeno-assoziierte virusvektoren

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1309044C (en) * 1987-11-09 1992-10-20 Toshiya Takano Method of producing foreign gene products
FR2732348B1 (fr) * 1995-03-31 1997-04-30 Rhone Poulenc Rorer Sa Systeme d'expression conditionnel
FR2745008A1 (fr) * 1996-02-20 1997-08-22 Ass Pour Le Dev De La Rech En Recepteur nucleaire de glucocorticoides modifie, fragments d'adn codant pour ledit recepteur et procedes dans lesquels ils sont mis en oeuvre
IL126418A0 (en) * 1996-04-05 1999-05-09 Salk Inst For Biological Studi Hormone-mediated methods for modulating expression of exogenous genes and pharmaceutical compositions for modulating the same
FR2748753B1 (fr) * 1996-05-20 1998-08-14 Transgene Sa Nouveaux vecteurs adenoviraux pour la therapie genique
WO1998037185A2 (en) * 1997-02-20 1998-08-27 The Board Of Regents Of The University Of Texas System Vectors for controlled gene expression

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0012741A2 *

Also Published As

Publication number Publication date
WO2000012741A2 (fr) 2000-03-09
FR2782732A1 (fr) 2000-03-03
AU5426299A (en) 2000-03-21
WO2000012741A3 (fr) 2000-05-04
JP2002523106A (ja) 2002-07-30
CA2341775A1 (fr) 2000-03-09
WO2000012741A9 (fr) 2001-03-29

Similar Documents

Publication Publication Date Title
EP0784693B1 (de) Virale vektoren für die gentherapie
KR102049161B1 (ko) 치료적 단백질을 조건부로 발현하는 벡터，상기 벡터를 포함하는 숙주 세포 및 이의 용도
EP0842279B1 (de) Hilfsvirus für die herstellung von rekombinanten virusvektoren
EP1016711B1 (de) Verfahren zur Inaktivierung vom umhüllten Viren in einem Viruspräparat mit Adenoviren
EP0988391B1 (de) Rekombinante adenovirale vektoren, die eine spleissequenz enthalten
EP1108051A2 (de) Induzierbares expresionssystem
EP1002120B1 (de) Chimäre adenovirale vektoren
EP1078094B1 (de) Methoden und zusammensetzungen für die produktion von viruspartikeln
WO1998049334A1 (fr) Nouveau site interne d'entree des ribosomes et vecteur le contenant
US6132989A (en) Methods and compositions for enhanced stability of non-adenoviral DNA
WO1997044475A1 (fr) Vecteurs adenoviraux pour la therapie genique
FR2737221A1 (fr) Nouveaux vecteurs viraux pour la therapie genique
EP1115857A1 (de) Benutzung von spezifischen hybridpromotoren zur kontrolle der gewebeexpression
TW201207108A (en) Vectors conditionally expressing therapeutic proteins, host cells comprising the vectors, and uses thereof
FR2783839A1 (fr) Utilisation de promoteurs specifiques hybrides pour controler l'expression tissulaire

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010319

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040302