AU5426299A - Inducible expression system - Google Patents

Description

WO 00/12741 PCT/FR99/02051 INDUCIBLE EXPRESSION SYSTEM The present invention relates to an inducible expression system which uses the nucleotide sequences 5 encoding a transcriptional activator and a recombinant adenoviral vector comprising a gene of interest placed under the control of a promoter inducible in trans by said transcriptional activator in an activated form. It also relates to a recombinant adenoviral vector 10 carrying a first expression cassette encoding said transcriptional activator and a second cassette carrying a gene of interest placed under the control of a promoter inducible in trans by said transcriptional activator. The invention also relates to an infectious 15 viral particle, to a cell, to a pharmaceutical composition comprising such a vector or expression system and to their use for therapeutic or prophylactic purposes. The present invention is of most particular value for gene therapy prospects, in particular in 20 humans. Gene therapy is defined as the transfer of genetic information into a host cell or organism. The first protocol used in humans was initiated in the United States in September 1990 on a patient 25 genetically immunodeficient due to a mutation affecting the gene encoding adenine deaminase (ADA) . It involves correcting or replacing the defective gene, the dysfunction of which is the cause of a genetic disease, with a functional gene. The relative success of this 30 first experiment has encouraged the development of this technology which has since been extended to the treatment of other diseases, both genetic and acquired (cancers, infectious diseases such as AIDS, etc.), for the purpose of delivering, in situ, therapeutic genes 35 which improve the pathology. Most strategies use vectors to vehicle the therapeutic gene toward its cellular target. Many vectors, both viral and synthetic, have been developed over recent years, and -2 have been the subject of numerous publications accessible to those skilled in the art. The advantage of adenoviruses as gene therapy vectors has already been mentioned in many documents of 5 the prior art. They infect many cell types, both cells in division and quiescent cells, do not integrate and are relatively nonpathogenic. In addition, they possess a natural tropism for the respiratory tract. These specific properties make adenoviruses choice vectors 10 for many therapeutic and even vaccinal applications. By way of indication, their genome consists of a linear and a double-stranded DNA molecule of approximately 36 kb which carries about thirty genes involved in the viral cycle. The early genes (El to E4; E for early) 15 are distributed in 4 regions dispersed in the genome. The El, E2 and E4 regions are essential to viral replication, whereas the E3 region involved in the modification of the anti-adenovirus immune response in the host is not. The late genes (L1 to L5; L for late) 20 encode mainly the structural proteins and cover, in part, the early transcription units. They are mostly transcribed from the major late promoter MLP. In addition, the adenoviral genome carries, at its ends, cis-acting regions essential to encapsidation, 25 consisting of inverted terminal sequences (ITRs) located at the 5' and 3' ends and of an encapsidation region which follows the 5' ITR. The adenoviral vectors currently used in gene therapy protocols lack the major portion of the El 30 region in order to avoid their dissemination in the environment and the host organism. Further deletions in the E3 region make it possible to increase cloning capacities. The genes of interest are introduced into the viral DNA in place of one or other deleted region. 35 However, the potential immunogenicity of the viral proteins still expressed can, in certain particular applications, oppose the persistence of the cells transduced and the stable expression of the transgene. These drawbacks have justified the construction of new - 3 generation vectors which conserve the regions in cis (ITRs and encapsidation sequences) essential to encapsidation, but comprise further genetic modifications aimed at suppressing the expression in 5 vivo of most of the viral genes (see, for example, international application WO 94/28152). In this respect, a so-called minimal vector, deficient for all adenoviral functions, represents a choice alternative. Most of the vectors developed at the current 10 time are based on constitutive expression of the transgene. However, it may be desirable to limit the expression of the therapeutic gene to a small number of cell types. Tissue-specific expression can be mediated via tissue-specific promoters and enhancers or 15 inducible expression systems which respond to a specific temporal or cellular event. Many inducible expression systems currently provided are based on the use of promoters regulated by endogenous transcription factors activated by a 20 specific inducer ligand (steroid hormones, interferon, heavy metals, etc.). A first drawback is that these systems require the presence of the endogenous activating factors in the target cell. In addition, the basal level of expression is often high because of 25 "background noise" activation due to the endogenous cellular substances, which can generate not insignificant side effects. A certain number of expression systems based on the use of prokaryotic factors have been demonstrated 30 in recent years. Mention may be made, for example, of those of the tetracycline (Gossen and Bujard, 1992, Proc. Natl. Acad. Sci. USA 89, 5547-551), lactose (Miller and Reznikoff (Eds), The operons, Cold Spring Harbor Laboratory) or tryptophan (Yanofsky et al., 35 1981, Nucleic acids Res. 9, 6647-6668) bacterial operons, of the herpes simplex virus protein 16 (VP16 trans-activating protein) or of the yeast Gal4 protein (Webster et al., 1988, Cell 52, 169-178).

-4 In general, the tetracycline resistance operon is encoded by the TnlO transposon (Hillen et al., 1984, J. Mol. Biol. 172, 185-201). The regulation is carried out by a short nucleotide sequence termed "operator" 5 (tet 0) which constitutes a binding site for diverse regulators. Thus, the binding of the tetracycline repressor (tet R) or of the antibiotic tetracycline considerably decreases the level of transcription. On the other hand, an activation effect is obtained using 10 a protein, designated in the literature "tetracycline trans-activator (tTA)", which results from the fusion between tet R and the 130 C-terminal amino acids of the activation domain of the herpes simplex virus VP16 protein. The expression of a reporter gene placed under 15 the control of several copies of tet 0 upstream of basic transcription sequences (TATA box, transcription initiation site, etc.) is detectable by coexpression of tTA and inhibited by adding tetracycline. The tetracycline binds the tTA and thus prevents the 20 transcription. This system is functional in a retroviral (Paulus et al., 1996, J. Virol. 70, 62-67) and adenoviral (Neering et al., 1996, Blood 4, 1147 1155; Yoshida and Hamada, 1997, Biochem. Biophy. Comm. 230, 426-430; Massie et al., 1998, J. Virol, 72, 2289 25 2296) vector context. In the latter case, the trans activator is provided in trans either by infection of an established line expressing tTA with an adenoviral vector containing a gene of interest placed under the control of tetO elements and of the CMV promoter, or by 30 coinfection of the cells with two adenoviral vectors, one containing the cassette of interest and the other expressing the tTA. A reverse system in which the expression of the transgene is activated in the presence of tetracycline has been developed by mutating 35 the tTA fusion protein (Gossen et al., 1995, Science 268, 1766-1769). The rtTA modified protein in fact binds the tetO elements only in the presence of tetracycline. Another variant according to which the expression is controlled at two levels (in the absence -5 of tetracycline and in the presence of estradiol) is obtained by fusing the tTA to the ligand-binding domain of the estrogen receptor (Iida et al., 1996, J. Virol. 70, 6054-6059) . 5 Another inducible system is based on the use of endogenous receptors in order to find a remedy for the potential immunogenicity of the prokaryotic trans activators. In this respect, steroid hormone receptors have been the subject of many publications. Mention may 10 be made more particularly of glucocorticoid receptors (GRs) (Israsl and Kaufman, 1989, Nucleic Acids Res. 17, 4589-4604), the progesterone receptor (PR) (Gronemeyer et al., 1987, EMBO J, 6, 3985-3994) and estrogen receptors (ERs) (Klein-Hitpass et al., 1986, Cell 46, 15 1053-1061; Koike et al., 1987, Nucleic Acids Res. 15, 2499-2513). Their mode of action is variable since they are capable of trans-activating or of trans-repressing transcription depending on the target cell, the hormonal ligand and the regulation elements used. With 20 regard to the trans-activation, the steroid receptor is in its inactive form complexed to diverse cellular factors, including certain heat shock proteins (hsps). The binding of an agonist ligand (steroid hormone) causes a change in the conformation of the receptor. 25 This activation is accompanied by the dissociation of the cellular factors and by nuclear translocation, and increases the capacity of the receptor to bind a specific short DNA sequence (target sequence), which allows the interaction with the transcriptional 30 machinery and the induction of the transcription. In order to carry out their function, these receptors are generally organized into 3 functional domains; respectively a trans-activation domain allowing the activation of the transcription, a DNA- (target 35 sequence) binding domain and a ligand-binding domain (LBD) . Modified receptors which respond preferentially to unnatural synthetic ligands are also provided in the literature. For example, Wang et al. (1994, Proc. Natl.

- 6 Acad. Sci. USA 91, 8180-8184) have constructed a chimera which can be activated by the RU486 molecule but not by endogenous progesterone, and which results from the fusion of the ligand-binding domain of the 5 truncated progesterone receptor (APR), of the DNA binding domain of the yeast Gal4 protein and of the trans-activation domain of the VP16 protein. However, the basal activity remains high and the chimeric protein may potentially interfere with cellular 10 transcriptional factors. Variants of the ER and GR receptors, modified in their ligand-binding domains, have also been described. Thus, the ERT mutant, obtained by substituting the glycine at position 521 of the ER receptor with an arginine, is incapable of 15 binding endogenous estrogens, but can be activated with synthetic ligands such as Tamoxifen, so as to activate the transcription regulated by the ERE (estrogen responsive element) target sequence. A similar variant has also been constructed for the GR receptor, modified 20 at position 747 by substituting the isoleucine with a threonine (Roux et al., 1996, Molecular Endocrinology 10, 1214-1226) . This variant, designated GRde, is incapable of binding endogenous glucocorticoids, but can be activated with synthetic ligands such as 25 Dexamethasone. Once activated, it recognizes the GRE (glucocorticoid responsive element; Cato et al., 1986, EMBO J. 5, 2237-2240) target sequence and stimulates the transcription from the promoter associated with it. Another inducible expression system uses the 30 insect steroid receptor which responds to ecdysone (EcR) . The receptor is activated by ecdysone and forms a heterodimer with the ultraspiracle protein (USP) of Drosophila, which binds to a specific target sequence (EcRE for ecdysone responsive element) so as to 35 activate the transcription. No et al. (1996, Proc. Natl. Acad. Sci. USA 93, 3346-3351) have created a VgEcR mutant receptor obtained by fusing the LBD of the EcR receptor, a hybrid between the DNA-binding domain of the EcR and GR receptors and the trans-activation domain of VP16. The mutant can form, in the presence of ecdysone or of its analog muristone A, a heterodimer with the USP protein or its human homologue, the retinoic acid X receptor (RXR), and activate the 5 transcription of genes placed under the control of a hybrid sequence (5xE/GRE) comprising the motifs which respond to the EcR and GR receptors. Such a system avoids possible endogenous activation. Another inducible expression system described 10 in the literature uses immunophilins. Rivera et al. (1996, Nat. Med, 2, 1028-1032) have developed a system with two components assembled in the presence of a ligand. More specifically, the first component is a fusion between the ZFHD1 transcription factor (carrying 15 a DNA-binding domain) and the FKBP12 immunophilin, and the second component is a fusion between the trans activation domain of the NFKB p65 factor and FRAP (FKBP12-rapamycin-associated protein). The trans activator is activated in the form of a heterodimer 20 associating the two components and rapamycin linking the FKBP12 and FRAP portions, which can induce the expression of a transgene placed under the control of the ZFHD1 target elements. Finally, Dolwick et al. (1993, Mol. Pharmacol. 25 44, 911-917) have identified the aryl hydrocarbon receptor (AhR) involved in the metabolism of the xenobiotics and of the chemical substances developed by humans. The AhR, in the inactive form, is complexed to diverse cellular factors including the hsp90 chaperone 30 protein. The binding of a xenobiotic ligand induces the dissociation of the complex, the translocation of the AhR into the nucleus and the formation of a heterodimer with the Arnt protein (aryl hydrocarbon receptor nuclear translocator; Hoffman et al., 1991, Science 35 252, 954-958) . The binding of the heterodimer to the target elements of the DNA, named XREs (for xenobiotic responsive elements), induces the transcription of the gene sequences downstream. The XRE sequence is present in the promoter region of many genes encoding enzymes - 8 involved in the metabolism of drugs, such as glutathione-S-transferase or cytochrome P4501A1. AhR and Arnt have a domain responsible for the recognition of the target sequence, for the heterodimerization and 5 for the binding to the ligand. The majority of the studies of trans-activation via the AhR/Arnt complex use the 2,3,7,8-tetrachlorodibenzo-p-dioxine (TCDD) ligand. The present invention provides an inducible 10 expression system which uses an adenoviral vector comprising a gene of interest the expression of which is regulated by a trans-activator which can be activated by providing exogenous pharmacological molecules. This system is based more particularly on 15 the use of a steroid receptor. Once activated, the receptor/ligand complex will bind to its target sequence and allow activation in trans of the expression of the therapeutic gene. A recombinant adenoviral vector has now been constructed, containing, 20 as a replacement for the El region, a cassette for expression of the GRdeX mutant steroid receptor expressed constitutively by the cytomegalovirus (CMV) early promoter and, as a replacement for the E3 region, a cassette for expression of the human factor IX (FIX) 25 gene placed downstream of the MMTV (mouse mammary tumor virus) promoter containing the GRE target sequence. The following experiments show the functionality of such an inducible system in vitro and in vivo. Similarly, the ERT receptor has also been inserted into the El region 30 of an adenovirus, under the control of the CMV promoter. In this case, the inducible cassette of the FIX gene is regulated by the ERE sequence associated with the minimal promoter of the HSV (herpes simplex virus) TK (thymidine kinase) gene. The third system 35 studied in the context of the present invention uses the VgEcR modified receptor and the human RXR receptor, the sequences of which have been introduced into the El region of an adenovirus. The inducible cassette present -9 in the E3 region places the FIX cDNA under the control of the 5xE/GRE hybrid elements. The purpose of the present invention is to remedy the drawbacks of the current gene therapy 5 vectors by improving, in particular, the specificity (activation by nontoxic exogenous substances and not by endogenous cellular factors) and the inducibility (minimum basal activity in the absence of inducer and high expression of the transgene in the activated 10 state) . The subject of the present invention can be applied to diverse gene therapy protocols requiring the expression of soluble molecules, such as antitumor molecules (antibodies, cytokines, chemokines), or in all cases in which the expression of the therapeutic 15 gene will have to be regulated as a function of the needs of the organism. It also enables the analysis of genes the expression of which is cytotoxic or reduced at certain stages of development. This is why a subject of the present invention 20 is an inducible expression system comprising: (i) the nucleotide sequences encoding a transcriptional activator of eukaryotic or viral origin, and placed under the control of the regulation elements suitable for their 25 expression in a host cell or organism, and (ii) a recombinant adenoviral vector comprising a gene of interest placed under the control of an inducible promoter capable of being activated in trans by said transcriptional 30 activator. For the purposes of the present invention, the term "transcriptional activator" defines a polypeptide, or a set of polypeptides, exerting a positive action on transcription, i.e. having the capacity to initiate or 35 to stimulate the transcription of any gene using suitable regulation elements which respond to said transcriptional activator. The positive effect on the transcription is preferably mediated directly by the binding of the activator to the regulation elements, - 10 but can be mediated indirectly via one or more cellular factors. Preferably, use is made of a ligand-dependent transcriptional activator capable of binding a characteristic DNA sequence (target sequence) and of 5 activating the promoter which is associated with it. Such transcriptional activators are described in the state of the art. It is also indicated that, in the context of the present invention, the transcriptional activator can be a single polypeptide in the form of a 10 monomer or of a multimer (preferably a dimer), or can result from the association of a set of polypeptides forming a heteromer (preferably a set of two polypeptides forming a heterodimer). The transcriptional activator in use in the present 15 invention can be derived from any organism of eukaryotic or viral origin, in particular from a yeast, from an insect, from a vertebrate or from a virus, or can have a mixed origin, i.e. be formed of components of diverse origins. 20 A transcriptional activator suitable for the use of the present invention comprises at least 3 types of functional domain, respectively a trans-activation domain, a DNA- (target sequence) binding domain and a ligand-binding domain (LBD). In the context of the 25 present invention, the order of the various domains has no importance. In addition, they can be distributed in the amino acid sequence continuously or discontinuously (optionally with overlapping of the residues involved in each function), and located on a or the 30 polypeptide(s) forming said transcriptional activator. Moreover, it can comprise several domains of the same type. A suitable example consists of the heterodimer developed by Rivera et al. (1996, Nat. Med. 2, 1028 1032), which is activated by the binding of rapamycin 35 to the FKBP12 and FRAP portions. The term "ligand-binding domain" refers to the portion of the transcriptional activator which interacts with a suitable inducer-ligand. The LBD inducer interaction places the transcriptional - 11 activator in the activated state, this being a step required for transcriptional activation. The LBD is preferably located at the C-terminal end of the or of a polypeptide composing said transcriptional activator. 5 The term "DNA-binding domain" refers to the portion of the transcriptional activator which interacts with the target DNA sequence present in the inducible promoter which controls the expression of the gene of interest and which is specific for the 10 transcriptional activator chosen. Said target sequence is generally placed upstream of a promoter region containing at least one TATA box, and is composed of motifs recognized by the transcriptional activator. These motifs can form a specific structure (palindrome, 15 repeats in the sense or inverted orientation, etc.). The target sequences suitable for each transcriptional activator are described in the literature. By way of illustration, mention may be made of: - the GRE (for glucocorticoid responsive element) 20 target sequence comprising a TGTTCT motif (or its complementary sequence) recognized by a DNA-binding domain derived from the GR receptor or from an analog (GRdex) . A preferred example consists of the sequence 5'GGTACANNNTGTTCT3' in 25 which N represents any nucleotide; - the ERE (for estrogen responsive element) target sequence comprising a 5'AGGTCA3' motif (or its complementary sequence) recognized by a DNA-binding domain derived from the ER receptor 30 or from an analog (ERT) . A preferred example consists of the sequence 5'AGGTCANNNTGACC3' in which N represents any nucleotide; - the UAS (for upstream activating sequence) target sequence of sequence 35 5'CGGAGTACTGTCCTCCG3' (or its complementary sequence) recognized by a DNA-binding domain derived from the yeast Gal 4 receptor or from an analog; - 12 - the EcRE (for ecdysone responsive element) target sequence comprising a GACAAG motif (or its complementary sequence) recognized by a DNA-binding domain derived from the EcR 5 receptor or from an analog. A preferred example consists of the sequence 5' GACAAGGGTTCAATGCACTTGTC3'; - the 5xE/GRE sequence of sequence 5'AGGTCANAGAACA3' (or its complementary 10 sequence) recognized by a DNA-binding domain which is hybrid between EcR and GR or of an analog; - the target sequence 5'TAATTANGGGNG3' in which N represents any nucleotide, recognized by the 15 ZFHDl transcription factor; - the XRE (for xenobiotic responsive element) target sequence of sequence 5'CCTCCAGGCTTCTTCTCACGCAACTCC3', recognized by a DNA-binding domain derived from the AhR 20 receptor or from an analog. The term "trans-activation domain" refers to the portion of the transcriptional activator which interacts with the cellular machinery so as to initiate or stimulate the gene transcription dependent on the 25 target sequence which responds to said activator. This domain can be derived from a conventional transcription factor (NFKB, SP-1, etc.) or from a ligand-dependent factor (steroid receptor, immunophilin, AhR, etc.). A domain comprising the 130 C-terminal amino acids of 30 VP16 is most particularly suitable. The trans-activation induced by the transcriptional activator in use in the context of the present invention can be verified simply using conventional techniques, for example by following the 35 expression of a given gene placed under the control of the suitable target sequence or the synthesis of its expression product (Northern, Western, immuno fluorescence, etc. analysis), in the presence of the inducer-activated receptor. A detailed protocol is - 13 given in the examples hereinafter. An at least 2-fold, advantageously at least 5-fold, and, preferably at least 10-fold difference reflects the trans-activation capacity of the expression system according to the 5 invention. These definitions can be illustrated using the example of the GR receptor. Its trans-activation domain is located in the N-terminal portion between residues 272 and 400 (Jonat et al., 1990, Cell 62, 1189-1204), 10 the 66-amino acid DNA-binding domain is located between residues 421 and 487 (Lucibello et al., 1990, EMBO J. 9, 2827-2834) and the approximately 300-amino acid hormonal-ligand-binding domain is located in the C-terminal portion (Kerpolla et al., 1993, Mol. Cell. 15 Biol. 13, 3782-3791). The latter domain also comprises the sequences responsible for the dimerization of the GR, its nuclear location and the interaction with the hsp proteins. The trans-activation is mediated by the binding of a receptor dimer to the GRE target sequence. 20 Advantageously, the transcriptional activator included in the inducible expression system according to the invention comprises all or part of a domain derived from a steroid hormone receptor chosen from the group consisting of the estrogen (ER), glucocorticoid 25 (GR), progesterone (PR), vitamin D, ecdysone (EcR), mineralocorticoid, androgen, thyroid hormone, retinoic acid and retinoic acid X receptors, or from an immunophilin or from an aryl hydrocarbon receptor (AhR). 30 In the context of the present invention, a modified receptor can be used. Advantageously, the modified receptor has lost its capacity for activation by a natural inducer and acquired a capacity for activation by an unnatural inducer, and retains the 35 trans-activation capacity of the native receptor. Those skilled in the art know the modification(s) to carry out in this respect. They can be diverse (deletion, substitution and/or addition of one or more residues of the natural receptor) and concern one or more domains.

- 14 Preferably, the modified functional domain has a sequence identity with its native equivalent of at least 70%, advantageously of at least 80%, preferably of at least 90%, and most preferably of at least 95%. 5 According to a first embodiment, use is made of a receptor modified in its LBD so that it can be activated by an unnatural inducer. Preferred examples consist of the GRdex (1747T) and ERT (G521R) mutants already mentioned. 10 It is also possible to envisage using a chimeric transcriptional activator comprising varied polypeptides or polypeptide fragments. Advantageously, it results from the fusion or from the association of functional domains of different origins. Specifically, 15 it is possible to exchange the functional domains between the various receptors, and all the possible combinations fall within the context of the present invention. For example, in order to reduce the interference with the endogenous receptor/ligand 20 complexes, it is possible to envisage replacing the DNA-binding domain of a steroid receptor with that of a nonhuman receptor (of viral or animal origin or of a lower eukaryote), for example an animal steroid receptor, a yeast receptor (Gal4), etc., the only 25 condition being to adapt the target sequence to the DNA-binding domain selected. Such an adaptation is within the scope of those skilled in the art. By way of indication, when the DNA-binding domain is derived from Gal4, the inducible promoter used will contain the UAS 30 (Upstream Activating Sequences) elements which respond to Gal4. Moreover, the trans-activation domain can be derived from any known transcriptional activation domain, especially from the herpes simplex virus protein 16 (VP16) or from NFKB factor p65, and in 35 particular from its C-terminal end. A transcriptional activator combining an LBD derived from a steroid receptor, a trans-activation domain derived from VP16 and a DNA-binding domain from Gal4 or from a steroid receptor is suitable for the use of the present - 15 invention. In this respect, use will preferably be made of residues 1 to 74 of Gal4. However, other combinations can also be envisaged. Moreover, it is possible to use a functional 5 domain which is a hybrid between different polypeptide fragments. One possible example consists of a DNA binding domain which is a hybrid between the EcR and GR receptors, and which recognizes a hybrid target sequence comprising the motifs which respond to 10 ecdysone and to glucocorticoids. A preferred transcriptional activator in the context of the present invention is chosen from: (i) a polypeptide, designated GRex, comprising a DNA-binding domain, a trans-activation domain 15 and an LBD derived from a glucocorticoid receptor, said receptor being modified in its LBD, in particular by substitution of the isoleucine at position 747 with a threonine; (ii) a polypeptide, designated ERT, comprising a 20 DNA-binding domain, a trans-activation domain and an LBD derived from an estrogen receptor, said receptor being modified in its LBD, in particular by substitution of the glycine at position 521 with an arginine; 25 (iii) a transcriptional activator comprising a first polypeptide comprising an LBD derived from the ecdysone receptor, a hybrid DNA-binding domain derived from those of the EcR and GR receptors and a trans-activation domain derived from the 30 VP16 viral protein, and a second polypeptide derived from the Drosophila USP protein or from a homologue such as the human retinoic acid X receptor (RXR); (iv) a transcriptional activator comprising a first 35 polypeptide comprising a DNA-binding domain derived from the ZFHD1 transcription factor and an LBD derived from the FKBP12 immunophilin, and a second polypeptide comprising a trans activation domain derived from the NFKB p65 - 16 factor and an LBD derived from FRAP (FKBPl2 rapamycin-associated protein); and (v) a transcriptional activator comprising a first polypeptide derived from the AhR receptor and a 5 second polypeptide derived from the Arnt protein. Preferably, the transcriptional activators (i) and (ii) are in the form of homodimers, and (iii) (iv) and (v) are in the form of heterodimers associating the 10 first and second polypeptide and, optionally, the inducer. According to one entirely advantageous embodiment, the transcriptional activator is activated by binding to an unnatural inducer, and is not, or 15 poorly, activated by a natural human compound. The term "unnatural inducer" refers to a compound which is not naturally found in the human or animal organism for which the therapy using the inducible expression system according to the invention 20 is intended. It is preferably a synthetic inducer which is not naturally found in a human organism and the structure of which is slightly different from that of a human (endogenous) compound. For the purposes of the present invention, an unnatural inducer is capable of 25 activating the transcriptional activator in use in the context of the present invention, in particular by binding to the LBD, in order to initiate or stimulate the transcription dependent on the target sequence which responds to said activator. The choice of an 30 unnatural inducer suitable for the transcriptional activator selected is within the scope of those skilled in the art, based on the state of the art. The activation of the transcriptional activator by the unnatural inducer can take place via a covalent or 35 noncovalent (electrostatic, hydrophobic, hydrogen bonding, etc.) interaction. Moreover, the inducer can consist of a single compound or of a set of molecules. Preferably, it belongs to the steroid, retinoid, fatty - 17 acid, vitamin, hormone, xenobiotic or antibiotic family. According to one advantageous embodiment, said unnatural inducer is a synthetic substance which can be 5 administered orally. Preferably, it is chosen from the group consisting of dexamethasone, tamoxifen, muristerone A, ecdysone, rapamycin and 2,3,7,8 tetrachlorodibenzo-p-dioxine (TCDD), or any analog of these compounds, preferably nontoxic or relatively 10 nontoxic. The sequences encoding the transcriptional activator included in the inducible expression system according to the invention are placed under the control of the suitable regulation elements which allow the 15 expression in a host cell or organism. The term "suitable regulation elements" includes all of the elements which allow the transcription of said sequences into RNA and the translation into protein. Among these, the promoter is of particular importance. 20 It can be isolated from any gene of eukaryotic, prokaryotic or even viral origin. Alternatively, it can be the natural promoter of the endogenous gene. Moreover, it can be constitutive or regulatable. In addition, it can be modified so as to improve the 25 promoter activity, delete a transcription-inhibiting region, render a constitutive promoter regulatable, or vice versa, introduce a restriction site, etc. By way of example, mention may be made of the eukaryotic promoters of the PGK (Phosphoglycerate Kinase) and MT 30 (metallothionein; McIvor et al., 1987, Mol. Cell Biol. 7, 838-848) genes, the SV40 virus (Simian Virus) early promoter, the RSV (Rous Sarcoma Virus) LTR, the TK-HSV 1 promoter, the CMV virus (Cytomegalovirus) early promoter and the promoters governing the expression of 35 the late adenoviral genes (MLPs) and early adenoviral genes (ElA, E2A, E3 or E4). Moreover, it may also be advantageous to regulate the expression of the transcriptional activator. In a first variant, its expression can be controlled by its specific target - 18 sequence (selfactivation and/or activation by the endogenous wild-type receptor activated by the endogenous ligand) . For example, use will be made of the ERE or GRE elements for the expression of a 5 transcriptional activator comprising a DNA-binding domain derived from ER or GR (ERT or GR ex) . Another possibility is the use of a regulatable promoter chosen from those of the prior art. In this respect, the use of a promoter which stimulates expression in a tumor or 10 cancerous cell may be advantageous. Mention may be made, in particular, of the promoters of the MUC-1 gene overexpressed in breast and prostate cancers (Chen et al., 1995, J. Clin. Invest 96, 2775-2782), the CEA (for carcinoma embryonic antigen) gene overexpressed in 15 colon cancers (Schrewe et al., 1990, Mol. Cell. Biol. 10, 2738-2748), the tyrosinose gene overexpressed in melanomas (Vile et al., 1993, Cancer Res. 53, 3860 3864), the ERB-2 gene overexpressed in breast cancers and cancers of the pancreas (Harris et al., 1994, Gene 20 Therapy 1, 170-175) and the a-fetoprotein gene overexpressed in liver cancers (Kanai et al., 1997, Cancer Res. 57, 461-465). It is indicated that the cytomegalovirus (CMV) early promoter is most particularly preferred. 25 Of course, the suitable regulation elements can also comprise additional elements which improve the expression (intronic sequence, transcription terminating sequence, etc.) or the persistence in a host cell. Such elements are known to those skilled in 30 the art. When the transcriptional activator in use in the context of the present invention consists of a set of polypeptides, these polypeptides can be produced from polycistronic nucleotide sequences (placed under 35 the control of a single promoter) using an IRES-type translation initiation site to initiate the translation of the second cistron. It is also possible to use a bidirectional promoter which directs the expression of two genes placed on either side. It is also possible to - 19 generate independent expression cassettes each comprising suitable regulation elements such as those cited previously. The cassettes can be carried by the same expression vector or by different vectors. 5 The sequences used in the context of the present invention can be obtained by conventional molecular biology techniques, for example by library screening using specific probes, by immunoscreening of expression libraries, by PCR using suitable primers or 10 by chemical synthesis. The mutants can be generated from the native sequences by substitution, deletion and/or addition of one or more nucleotides using the techniques of site-directed mutagenesis, of PCR, and of digestion with restriction enzymes and ligation, or 15 alternatively by chemical synthesis. The functionality of the mutants and of the constructs can be verified using the techniques of the prior art. The second component of the inducible expression system according to the invention is a 20 recombinant adenoviral vector comprising at least one gene of interest placed under the control of an inducible promoter capable of being activated in trans by said transcriptional activator. Use will preferably be made of an adenoviral 25 vector lacking all or part of at least one region essential for replication, selected from the El, E2, E4 and Li to L5 regions, in order to avoid its propagation in the host organism or in the environment. A deletion of most of the El region is preferred. Advantageously, 30 it stretches from nts 454 to 3328, but can also encompass additional sequences in 5' and 3', on the condition that there is no interference with the encapsidation function. Preferably, the pIX gene is not included in the El deletion. In addition, it can be 35 combined with other modification(s) affecting in particular the E2, E4 and/or Ll-LS regions, since the defective essential functions are complemented in trans by means of a complementation line and/or of an auxiliary virus. In this respect, use can be made of - 20 second generation vectors defective for the El and E4 or El and E2 functions (see, for example, international applications WO 94/28152 and WO 97/04119). In order to illustrate this embodiment, mention may be made of a 5 vector which combines a deletion in the El region and a heat-sensitive mutation affecting the DBP (for DNA Binding Protein) gene of the E2A region (Ensinger et al., 1972, J. Virol. 10, 328-339). With regard to the E4 region, it can be totally or partially deleted. A 10 partial deletion of the E4 region, with the exception of the sequences encoding open reading frames (ORFs) 3 and/or 6/7, is advantageous since it does not require any complementation of the E4 function (Ketner et al., 1989, Nucleic Acids Res. 17, 3037-3048). With the aim 15 of increasing the cloning capacities, the recombinant adenoviral vector can also lack all or part of the nonessential E3 region. According to this alternative, it may be advantageous to conserve, however, the E3 sequences encoding the polypeptides which allow the 20 immune system of the host to be avoided, in particular the gpl9k glycoprotein (Gooding et al., 1990, Critical Review of Immunology 10, 53-71) . According to another alternative, use can be made of a minimum adenoviral vector which retains essentially the 5' and 3' ITRs 25 (Inverted Terminal Repeats) and the encapsidation region, and which is defective for all viral functions. Moreover, the origin of the adenoviral vector of the inducible expression system according to the invention can be varied, from the point of view of both 30 the species and the serotype. It can derive from the genome of a human or animal (canine, avian, bovine, murine, ovine, porcine, simian, etc.) adenovirus or from a hybrid comprising fragments of adenoviral genome of at least two different origins. Mention may be made, 35 more particularly, of the CAV-1 or CAV-2 adenovirus of canine origin, the DAV adenovirus of avian origin or the type 3 Bad adenovirus of bovine origin (Zakharchuk et al., Arch. Virol. 1993, 128: 171-176; Spibey and Cavanagh, J. Gen. Virol., 1989, 70: 165-172; Jouvenne - 21 et al., Gene, 1987, 60: 21-28; Mittal et al., J. Gen. Virol., 1995, 76: 93-102). However, preference will be given to an adenoviral vector of human origin deriving preferably from a serotype C adenovirus, in particular 5 a type 2 or 5 adenovirus. The gene of interest in use in the present invention can be derived from a eukaryotic organism, from a prokaryote, from a parasite or from a virus other than an adenovirus. It can be isolated by any 10 conventional technique in the prior art, from example by cloning, PCR or chemical synthesis. It can be of genomic type (comprising all or part of the set of introns), of complementary DNA type (cDNA, lacking introns) or of mixed type (minigene) . Moreover, it can 15 encode an antisense RNA and/or a messenger RNA (mRNA) which will then be translated into a polypeptide of interest, this polypeptide possibly being (i) intracellular, (ii) incorporated into the membrane of the host cell or (iii) secreted. It can be a 20 polypeptide such as is found in nature (native), a portion of this polypeptide (truncated), a mutant having in particular improved or modified biological properties, or a chimeric polypeptide originating from the fusion of sequences of diverse origins. Moreover, 25 the gene of interest can encode an antisense RNA, a ribozyme, or a polypeptide of interest. Among the polypeptides of interest which can be used, mention may be made more particularly of chemokines and cytokines (a-, $- or y-interferon, 30 interleukin (IL) , in particular IL-2, IL-6, IL-10 or IL-12, tumor necrosis factor (TNF), colony stimulating factor (GM-CSF, C-CSF, M-CSF, etc.), MIP-la, MIP-1l, RANTES, monocyte chemoattractant protein such as MCP-1, etc.), cellular receptors (in particular recognized by 35 the HIV virus), receptor ligands, clotting factors (Factor VIII, Factor IX, thrombin, protein C), growth factors (FGF, for Fibroblast Growth Factor, VEGF, for Vascular Endothelial Growth Factor), enzymes (urease, renin, metalloproteinase, nitric oxide synthetase, NOS, - 22 SOD, catalase, lecithin cholesterol acyltransferase LCAT, etc.), enzyme inhibitors (al-antitrypsin, antithrombin III, viral protease inhibitor, PAI-1, for plasminogen activator inhibitor), class I or II major 5 histocompatibility complex antigens or polypeptides acting on the expression of the corresponding genes, polypeptides capable of inhibiting a viral, bacterial or parasitic infection or its development, polypeptides acting positively or negatively on apoptosis (Bax, 10 Bcl2, BclX, etc.), cytostatic agents (p 2 l, p 16, Rb), whole or partial (Fab, ScFv, etc.) immunoglobulins, toxins, immunotoxins, apolipoproteins (ApoAI, ApoAIV, ApoE, etc.), angiogenesis inhibitors (angiostatin, endostatin, etc.), markers (P-galactosidase, 15 luciferase, etc.) or any other polypeptide having a therapeutic effect for the targeted disorder. More specifically, for the purpose of treating a hereditary dysfunction, use will be made of a functional copy of the defective gene, for example a 20 gene encoding factor VIII or IX in the context of hemophilia A or B, dystrophin (or minidystrophin) in the context of Duchenne and Becker myopathies, insulin in the context of diabetes, and the CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) protein 25 in the context of cystic fibrosis. With regard to inhibiting the initiation or progression of tumors or cancers, use will preferably be made of a gene of interest encoding an antisense RNA, a ribozyme, a cytotoxic product (herpes simplex virus-1 thymidine 30 kinase (TK-HSV-1), ricin, cholera toxin, diphtheria toxin, product of the FCYl and FURl yeast genes encoding uracyl phosphoribosyl transferase and cytosine deaminase, etc.), an immunoglobulin, an inhibitor of cell division or of transduction signals, a tumor 35 suppresser gene expression product (p5 3 , Rb, p 7 3 , DCC, etc.), an immune system-stimulating polypeptide, a tumor-associated antigen (MUC-1, BRCA-1, early or late antigens (E6, E7, L1, L2, etc.) of an HPV papilloma virus, etc.), optionally in combination with a cytokine - 23 gene. Finally, in the context of an anti-HIV therapy, use may be made of a gene encoding an immunoprotective polypeptide, an antigenic epitope, an antibody (2F5; Buchacher et al., 1992, Vaccines 92, 191-195), the 5 extracellular domain of the CD4 receptor (sCD4; Traunecker et al., 1988, Nature 331, 84-86) an immunoadhesin (for example, a CD4-IgG-immunoglobulin hybrid; Capon et al., 1989, Nature 337, 525-531; Byrn et al., 1990, Nature 344, 667-670), an immunotoxin (for 10 example, fusion of the 2F5 antibody or of the CD4-2F5 immunoadhesin to angiogenin; Kurachi et al., 1985, Biochemistry 24, 5494-5499), a trans-dominant variant (EP 0614980, WO 95/16780), a cytotoxic product, such as one of those mentioned above, or an a-or p-IFN. 15 One of the genes of interest can also be a selection gene which makes it possible to select or identify the cells transfected or transduced. Mention may be made of the neo gene (encoding neomycin phosphotransferase) which confers resistance to the 20 antibiotic G418, the dhfr (dihydrofolate reductase) gene, the CAT (chloramphenicol acetyltransferase) gene, the pac (puromycin acetyltransferase) gene or the gpt (xanthine guanine phosphoribosyl transferase) gene. In general, the selection genes are known to those skilled 25 in the art. Moreover, the cassette for expression of the gene of interest can also include additional elements which improve its expression or its persistence in the host cell (origins of replication, elements for 30 integration into the cellular genome, intronic sequences, transcription termination poly A sequences, tripartite leaders, etc.). These elements are known to those skilled in the art. In addition, the gene of interest can also comprise, upstream of the coding 35 region, a sequence encoding a signal peptide enabling its secretion from the host cell. The signal peptide can be that of the gene in question or heterologous (derived from any secreted or synthetic gene).

- 24 The cassette for expression of the gene of interest can be inserted at any place in the adenoviral genome. Advantageously, it is introduced as a replacement for the E3 region. When the recombinant 5 adenoviral vector comprises several genes of interest, they can be placed under the control of the same genetic elements (polycistronic cassette using one IRES-type internal translation initiation site to reinitiate the translation of the second cistron) or of 10 independent elements. In this case, they can be inserted into the same adenoviral region (for example, as a replacement for E3) or into different regions (for example as a replacement for E3 and for another deleted region) . 15 In the context of the present invention, the expression of the gene of interest is controlled by a promoter inducible by a transcriptional activator as defined above. For the purpose of the present invention, an inducible promoter comprises at least one 20 target sequence which responds to the transcriptional activator used and which is functionally associated with a minimum promoter. The target sequences have been defined previously and are described in the literature, which is accessible to those skilled in the art (as a 25 reminder, ERE, GRE, EcRE, UAS, 5xE/GRE, XRE, etc.). It is indicated that use can be made of a homologous sequence which is modified with respect to the native sequence, but which exerts a similar or improved regulation function. These modifications can result 30 from the addition, from the deletion and/or from the substitution of one or more nucleotides, or from fusion between two different target sequences. It is possible to use one or more target sequences, for example from 1 to 25, advantageously from 1 to 10, and preferably from 35 1 to 7, optionally placed in tandem and in any orientation with respect to the TATA box. It (they) is (are) generally inserted into the inducible promoter upstream of the minimum promoter, up to several hundreds of base pairs from it. An example of a - 25 promoter inducible by a transcriptional activator derived from the GR is the MMTV (mouse mammary tumor virus) LTR which contains the GRE element and suitable promoter sequences. 5 A minimum promoter comprises essentially a TATA box and a transcription initiation site, functional in a host cell or organism. These elements are conventional in the prior art concerned. Mention may be made more particularly of the minimum promoters of the 10 TK gene, CMV genes and HSP gene (minimum promoter of the Drosophila heat shock protein gene lacking the enhancer). In addition, the inducible promoter in use in the context of the present invention can comprise 15 additional elements which improve the level of transcription or limit it to certain specific tissues (enhancer-type elements). These additional elements can alternatively be inserted into a noncoding gene region. According to a first embodiment, the nucleotide 20 sequences encoding the transcriptional activator and their regulation elements are carried by the recombinant adenoviral vector of the expression system according to the invention. The cassettes for expression of the gene of interest and of the 25 transcriptional activator can be located in the same region of the adenoviral genome or in different places, and in sense or antisense orientation with respect to one another. The antisense orientation is preferred. A preferred example is provided by an E1~E3~ vector in 30 which each of the cassettes is inserted in place of the deleted adenoviral sequences. According to another variant, the nucleotide sequences are carried by an independent expression vector other than the recombinant adenoviral vector in 35 use in the expression system according to the invention. It can be a synthetic vector (cationic lipids, polymeric liposomes, etc.), a plasmid or a viral vector. It can be optionally combined with one or more substances which improve the efficiency of - 26 transfection and/or the stability of the vector. These substances are widely documented in the literature accessible to those skilled in the art (see, for example, Felgner et al., 1987, Proc. West. Pharmacol. 5 Soc. 32, 115-121; Hodgson and Solaiman, 1996, Nature Biotechnology 14, 339-342; Remy et al., 1994, Bioconjugate Chemistry 5, 647-654). By way of nonlimiting illustration, they can be polymers, lipids, in particular cationic lipids, liposomes, nuclear 10 proteins or neutral lipids. These substances can be used alone or in combination. A conceivable combination is a recombinant plasmid vector combined with cationic lipids (DOGS, DC-CHOL, spermine-chol, spermidine-chol, etc.) and neutral lipids (DOPE). 15 The choice of plasmids which can be used in the context of the present invention is vast. They can be cloning and/or expression vectors. In general, they are known to those skilled in the art and many of them are commercially available, but it is also possible to 20 construct them or modify them using the techniques of genetic manipulation. By way of examples, mention may be made of the plasmids derived from pBR322 (Gibco BRL), pUC (Gibco BRL), pBluescript (Stratagene), pREP4, pCEP4 (Invitrogen) or p Poly (Lathe et al., 1987, Gene 25 57, 193-201). Preferably, a plasmid used in the context of the present invention contains an origin of replication which ensures the initiation of the replication in a producer cell and/or a host cell (for example, the ColEl origin will be selected for a 30 plasmid intended to be produced in E. coli, and the oriP/EBNA1 system will be selected if the desire is for it to be selfreplicating in a mammalian host cell, Lupton and Levine, 1985, Mol. Cell. Biol. 5, 2533-2542; Yates et al., Nature 313, 812-815). It can also 35 comprise a selection gene which makes it possible to select or identify the transfected cells (complement ation of an auxotrophy mutation, gene encoding resistance to an antibiotic, etc.). Of course, it can comprise additional elements which improve its - 27 persistence and/or its stability in a given cell (cer sequence which promotes the monomeric persistence of a plasmid (Summers and Sherrat, 1984, Cell 36, 1097-1103, sequences for integration into the cellular genome). 5 With regard to a viral vector, it is possible to envisage a vector deriving from an adenovirus, from a retrovirus, from an adeno-associated virus (AAV), from a herpesvirus, from an alphavirus, from a parvovirus, from a poxvirus (fowlpox, canarypox, 10 vaccinia virus, in particular the MVA (Modified Virus Ankara) or Copenhagen strain, etc.) or from a foamyvirus. Use will preferably be made of a nonreplicating and, optionally, nonintegrating vector. Retroviruses have the property of infecting and 15 of integrating mainly in dividing cells and, in this respect, are particularly suitable for the cancer application. A retroviral vector suitable for the use of the present invention comprises the LTR terminal sequences, an encapsidation region and the nucleotide 20 sequences encoding the transcriptional activator the expression of which is controlled by the retroviral promoter (in the 5' LTR) or by an internal promoter as mentioned above. It can derive from a retrovirus of any origin (murine, primate, feline, human, etc.), and in 25 particular from MoMuLV (Moloney murine leukemia virus), MVS (murine sarcoma virus) or Friend murine retrovirus (Fb29). It is propagated in an encapsidation line capable of providing, in trans, the gag, pol and/or env viral polypeptides required for the constitution of a 30 viral particle. Such lines are described in the literature (PA317, Psi CRIP GP + Am-12, etc.). The retroviral vector according to the invention can comprise modifications in particular in the LTRs (replacement of the promoter region with a eukaryotic 35 promoter) or in the encapsidation region (replacement with a heterologous encapsidation region, for example of VL30 type) (see French applications 94/08300 and 97/05203).

- 28 An adenoviral vector is most particularly suitable for the expression of the transcriptional activator envisaged in the context of the present invention. Use will preferably be made of a defective 5 vector having one of the abovementioned characteristics. In particular, the recombinant adenoviral vector (carrying the cassette for inducible expression of the gene of interest) and the independent adenoviral vector (carrying the cassette for expression 10 of the transcriptional activator) are preferably both deficient for the El function by deletion of all or part of the El region or nonfunctional mutation. Where appropriate, one or other or both can also be deficient for at least one of the E2, E4, L1, L2, L3, L4 and/or 15 L5 functions. Similarly, a deletion of all or part of the E3 region can be envisaged for one or both vectors. According to an advantageous embodiment, the viral vectors (recombinant adenoviral vector and, where appropriate, said independent viral vector) forming 20 part of the expression system according to the invention can be in the form of DNA vectors or of infectious viral particles. The present invention also relates to a recombinant adenoviral vector comprising 25 (i) the nucleotide sequences encoding a transcriptional activator, placed under the control of the regulation elements suitable for their expression in a host cell or organism, and (ii) a gene of interest placed under the control 30 of an inducible promoter capable of being activated in trans by said transcriptional activator. The recombinant adenoviral vector according to the invention can encode a transcriptional activator 35 having the characteristics defined previously, which, in the form activated by an inducer as described above, has the capacity to initiate or to activate the transcription of a gene controlled by an inducible - 29 promoter comprising a target sequence specific for said transcriptional activator as described above. Alternatively, the recombinant adenoviral vector according to the invention can encode a 5 prokaryotic transcriptional activator and, in particular, a polypeptide comprising an LBD and a DNA binding domain derived from a tetracycline operon repressor (tetR), and any transcription activation domain. It is preferably the polypeptide designated in 10 the literature "tetracycline trans-activator" tTA (Gossen and Bujard, 1992, Proc. Natl. Acad. Sci, USA 89, 5547-551), in which the tetR isolated from the TnlO transposon is fused in frame to the 130 C-terminal amino acids of the VP16 viral protein. In this case, an 15 unnatural inducer which activates the tTA, such as doxycycline, tetracycline or an agonist analog will be used. Of course, the characteristics of the cassette for inducible expression of the gene of interest are the same as above, except for the presence of one or 20 more target sequence(s) which respond(s) to the prokaryotic transcriptional activitor. With regard to tTA, the target sequence consists of the tetracycline operator (tetO). In the context of the present invention, preference is given most particularly to the 25 "tetO-minimum promoter" combination which gives rise to a promoter which has a naturally very low basic level of transcription, but which can be activated by the tTA inducer and repressed by tetracycline. It is not necessary to go back over the 30 backbone of the recombinant adenoviral vector according to the invention since it satisfies the characteristics already mentioned. The present invention also relates to an infectious viral particle comprising a recombinant 35 adenoviral vector according to the invention. The techniques for preparing adenoviral vectors are widely documented in the literature. Initially, the genome is reconstituted by homologous recombination in the 293 line (see in particular Graham and Prevect, - 30 1991, Methods in Molecular Biology, Vol 7, Gene Transfer and Expression Protocols; Ed E.J. Murray, The Human Press Inc, Clinton, NJ) or in Escherichia coli (Chartier et al., 1996, J. Virol. 70, 4805-4810; 5 WO 96/17070). It is then necessary to propagate the vector in order to constitute a stock of viral particles containing it. For this purpose, complementation lines are used which provide, in trans, the viral expression products for which the vector is 10 defective. For example, the viruses deleted of El can be propagated in the 293 line, which was established from human embryonic cells (Graham et al., 1977, J. Gen. Virol. 36, 59-72). With regard to second generation vectors, use can be made of lines which 15 complement two essential viral functions, such as those described by Yeh et al. (1996, J. Virol. 70, 559-565), Krougliak and Graham (1995, Human Gene Therapy 6, 1575-1586), Wang et al. (1995 Gene Therapy 2, 775-783) and Lusky et al. (1998, J. Virol. 72, 2022-2033) and in 20 international applications WO 94/28152 and WO 97/04119. Another alternative is based on the use of an additional viral element, designated "auxiliary virus", to complement, at least in part, the defective functions of a recombinant adenoviral vector. The 25 auxiliary viruses of the prior art consist of an adenoviral genome, optionally deleted of an essential region for which the recombinant vector does not require complementation. The invention also relates to a method for 30 preparing a viral particle, according to which: (i) a recombinant adenoviral vector according to the invention is introduced into a complementation cell capable of complementing in trans said vector, so as 35 to obtain a transfected complementation cell, (ii) said transfected complementation cell is cultured under conditions suitable for - 31 allowing the production of said viral particle, and (iii) said viral particle is recovered from the cell culture. 5 Of course, the viral particle can be recovered from the culture supernatant, but also from the cells. One of the methods commonly used consists in lysing the cells with consecutive cycles of freezing/thawing in order to harvest the virions in the lysis supernatant. 10 These virions can be amplified and purified according to the techniques of the prior art (chromatographic method, ultracentrifugation in particular through a cesium chloride gradient, etc.). The present invention also relates to a 15 eukaryotic cell comprising an inducible expression system or a recombinant adenoviral vector according to the invention, or infected with a viral particle according to the invention. For the purposes of the present invention, such a cell consists of any cell 20 which can be transfected with a vector or infected with a viral particle, as defined above. A mammalian, and in particular human, cell is most particularly suitable. It can be a primary or tumor cell of any origin, in particular hematopoietic (totipotent stem cell, 25 leukocyte, lymphocyte, monocyte or macrophage, etc.), muscle (satellite cell, myocyte, myoblast, smooth muscle cell, etc.), cardiac, pulmonary, tracheal, hepatic, epithelial or fibroblast origin. A subject of the present invention is also a 30 pharmaceutical composition [lacuna] an inducible expression system, a recombinant adenoviral vector, a viral particle or a host cell according to the invention in combination with a vehicle which is acceptable from a pharmaceutical point of view. 35 A composition according to the invention is more particularly intended for the preventive or curative treatment of diseases by gene therapy (including immunotherapy) and is directed more particularly at proliferative diseases (cancers, - 32 tumors, dysplasias, etc.), at infectious and in particular viral diseases (induced by the hepatitis B or C viruses, HIV, herpesvirus, retroviruses, etc.), at genetic diseases (cystic fibrosis, myopathies, 5 hemophilia, diabetes, etc.) and at cardiovascular diseases (restenosis, ischemia, dislipidemia, etc.). A composition according to the invention can be manufactured conventionally with a view to local, parenteral or digestive administration. In particular, 10 a therapeutically effective amount of the therapeutic or prophylactic agent is combined with a support which is acceptable from a pharmaceutical point of view. Many routes of administration can be envisaged. Mention may be made, for example, of the intragastric, 15 subcutaneous, intracardiac, intramuscular, intravenous, intra-arterial, intraperitoneal, intratumoral, intra nasal, intrapulmonary or intratracheal route. For the three latter embodiments, administration by aerosol or instillation is advantageous. The administration can 20 take place as a single dose or as a dose repeated one or more times after a certain time interval. The suitable route of administration and doses of virus vary as a function of diverse parameters, for example of the individual, of the pathology, of the gene of 25 interest to be transferred, of the route of administration. By way of indication, the preparations based on viral particles can be formulated in the form of doses of between 10' and 1014 pfu (plaque forming units), advantageously 105 and 1013 pfu, and preferably 30 10' and 101 pfu. When one or more vector(s) is (are) used, doses comprising from 0.01 to 100 mg of DNA, preferably 0.05 to 10 mg, and most preferably 0.05 to 5 mg can be envisaged. The formulation can also include a diluent, 35 adjuvant or excipient which is acceptable from a pharmaceutical point of view, as well as solubization, stabilization and preservation agents. A preferred composition is in injectable form. It can be formulated in aqueous, saline (monosodium, disodium, magnesium, - 33 potassium, etc. phosphate) or isotonic solution. It can be as single dose or as multidoses, in liquid form or dry form (powder, lyophilizate, etc.) capable of being reconstituted extemporaneously with a suitable diluent. 5 The present invention also relates to the therapeutic or prophylactic use of an inducible expression system, of a recombinant adenoviral vector, of a viral particle or of a host cell according to the invention, for preparing a medicinal product intended 10 for the transfer and for the expression of said gene of interest in a host cell or organism, in particular for the treatment of the human or animal body by gene therapy. According to a first possibility, the medicinal product can be administered directly in vivo 15 (for example, by intravenous injection, into an accessible tumor, into the lungs by aerosol, into the vascular system using a suitable probe, etc.). It is also possible to adopt the ex vivo approach, which consists in removing cells from the patient (bone 20 marrow stem cells, peripheral blood lymphocytes, muscle cells, etc.), in transfecting or infecting them in vitro according to the techniques of the prior art and in readministering them to the patient after an optional amplification step. The prevention and the 25 treatment of many pathologies can be envisaged. A preferred use consists in treating or preventing cancers, tumors and diseases resulting from undesired cell proliferation. Among the uses which can be envisaged, mention may be made of cancers of the 30 breast, of the uterus (in particular those induced by papilloma viruses), of the prostate, of the lung, of the bladder, of the liver, of the colon, of the pancreas, of the stomach, of the esophagus, of the larynx, of the central nervous system and of the blood 35 (lymphomas, leukemia, etc.). It is also useful in the context of cardiovascular diseases, for example for inhibiting or delaying the proliferation of the smooth muscle cells of the vascular wall (restenosis).

- 34 Finally, with regard to infectious diseases, use in AIDS can be envisaged. The invention also extends to a method for treating diseases by gene therapy, characterized in 5 that an inducible expression system, a recombinant adenoviral vector, a viral particle or a host cell according to the invention is administered to a host cell or organism needing such a treatment. Finally, the invention also relates to a 10 transcriptional activator comprising an LBD and a trans-activation domain derived from a steroid receptor and a heterologous DNA-binding domain, in particular derived from the Gal4 yeast protein. Such a transcriptional activator is obtained by exchanging, 15 using molecular biology techniques, the DNA-binding domain of the steroid receptor with that of Ga14 (in particular carried by residues 1 to 74) . An ERT or GRdex and Gal4 hybrid is absolutely preferred. It is indicated that all of the names used in 20 the present application are conventional in the field of the prior art and that the scope also includes the functional equivalents, i.e. any polypeptide, domain, gene or compound obtained by modification of a native polypeptide, domain, gene or compound, and having 25 activity of the same, or even noticeably increased, nature. Figure 1 is a schematic representation of the amount of FIX produced 144 h after transient 30 transfection of the 293-cells with the plasmids pTG13064 (CMV-GR d*), pTG6242 (LTR MMTV-FIX, sense) and pTG13063 (LTR MMTV-FIX, antisense). Figure 2: Evaluation of the dexamethasone dose/response effect in A549 cells. The infection of 35 the cells is carried out with an MOI = 50, with AdTG13092 or AdTG13088. The induction with dexamethasone is carried out while varying the concentration from 10~9 to 10~7 M.

- 35 Figure 3: Schematic representation of the constructs AdTG13075, AdTG13088, AdTG13092 and AdTG13245. Figure 4 (a, b, c and d): Evaluation in vivo of 5 the Grdex/dexamethasone inducible system with the various constructs tested in C57B1/6 mice. The values given are the means of the values measured in each of the mice treated. Figure 5 (a, b, c and d): Evaluation in vivo of 10 the Grdex/dexamethasone inducible system with the various constructs tested in SCID mice. The values given are the means of the values measured in each of the mice treated. Figure 6: Evaluation of a dexamethasone 15 dose/response effect in vivo in SCID mice. Figure 7: Schematic representation of first and of second generation adenoviral vectors deriving from the plasmid pTg6401. The present invention is illustrated, though 20 without being limited, by the following examples. EXAMPLES The constructs described below are prepared according to the general techniques of genetic 25 engineering and of molecular cloning, detailed in Maniatis et al., (1989, Laboratory Manual, Cold Spring Harbor, Laboratory Press, Cold Spring Harbor, NY or a more recent edition), or according to the recommendations of the manufacturer when a commercial 30 kit is used. The cloning steps are carried out in the E. coli strains 5K (hsdR, mcrA) , DH5a [ (recAl, endAl, hodR17 (r-m-), supE44, thi-1, gyrA (nalr)] or NM522 (supE, thi, A(lac-proAB), Ahsd5, (r-m-), (F' proAB, lacI, ZAM15) and those of homologous recombination are 35 carried out' in the E. coli strain BJ 5183 (Hanahan, 1983, J. Mol. Biol. 166, 577-580) . With regard to the repair of the restriction sites, the technique used consists in filling the 5' protruding ends using the large fragment of E. coli DNA polymerase I (Klenow, - 36 Boehringer Mannheim). The DNA fragments are purified using the GeneCleanIIR DNA purification kit (Biol0lInc.). Moreover, the fragments of adenoviral genome used in the various constructs described below 5 are precisely indicated according to their position in the nucleotide sequence of the genome of Ad5, as disclosed in the Genebank database under the reference M73260. With regard to the cell biology, use is made of 10 the 293-cell line (Graham et al, 1977, above; available at the ATCC under the reference CRL1573), A549 El+ cell line (WO 94/28152), A549 cell line (ATCC CCL-185) and Vero cell line (ATCC CCL-81). It is understood that other cell lines can be used. The cells are maintained 15 in culture at 37*C in a humid atmosphere enriched in

CO

2 at 5%, in DMEM (Dulbecco's Modified Eagle Medium, Gibco BRL) medium supplemented with 1 mM of glutamine, 1% of amino acids (Gibco BRL), 40 gg/l of gentamycin and 10% of fetal calf serum (FCS, Gibco BRL). The 20 transfection and transduction of the cells is carried out according to the techniques of the prior art (calcium phosphate precipitation, etc.). EXAMPLE 1: Construction of an adenoviral vector 25 coexpressing the ERT transcriptional activator and the FIX gene regulated by the ERE sequences. The cDNA of the wild-type ER gene is contained in the plasmid pSG1-HEO (Tora et al., 1989, EMBO J. 8, 30 1981-1989). The estrogen-binding domain of the ER receptor (BamHI-XbaI fragment) is replaced with that of the ERT mutant (G521R) carried by the NotI-XbaI fragment of pCre-ER T (Feil et al., 1996, Proc. Natl. Acad. Sci. USA 93, 10887-10890) . The ERT sequences are 35 inserted into the EcoRI site of the transfer vector pTG6600. By way of indication, pTG6600 is a p polyII vector (Lathe et al., 1987, Gene 57, 193-201) into which the Ad5 sequences 1 to 458, the CMV early promoter, the hybrid splicing sequences found in the - 37 plasmid pCI (Promega Corp, comprising the donor splicing site of intron 1 of the human $-globin gene and the acceptor splicing site of the mouse immunoglobulin gene), the SV40 virus polyadenylation 5 sequences and the Ad5 sequences 3328-5788 are inserted. Such a construct is within the scope of those skilled in the art. The vector thus obtained, pTG6237, contains the CMV-ER T expression cassette, present in the El region. The final construct, designated pTG6246, is 10 reconstituted by homologous recombination (Chartier et al., 1996, J. Virol. 70, 4805-4810) between the PacI Bst EII fragment isolated from the previous vector and pTG4656 linearized with ClaI. The latter is an E1~E3~ adenoviral plasmid containing, in El, the LacZ gene 15 under the control of the MLP promoter (described in application FR 97/06757). Thus, the adenoviral genome carried by pTG6246 comprises the CMV-ERT cassette in the El region and is deleted of the E3 region. The human FIX cDNA (Anson et al, 1984, EMBO J. 20 3, 1053-1060) is cloned in the form of a BamHI fragment isolated from a plasmid of the prior art (for example, described in patent 88 14635) and inserted downstream of the TK-HSV minimum promoter preceded by the ERE sequence (Klein-Hitpass et al., 1986, Cell 46, 25 1053-1061). The cassette is introduced into the BglII site of pTG4664 in the sense and antisense orientation (giving pTG13227 and pTG13228, respectively). The plasmid pTG4664 comprises nucleotides 25838 to 320004 of the Ad5, deleted of nucleotides 27871 to 30748 of 30 the E3 region. A homologous recombination with the plasmid pTG6401 digested with SfrI (comprising the Ad5 genome deleted of the El and E3 regions) makes it possible to generate the E1~E3 adenoviral vectors carrying the ERE/TKp-FIX inducible cassette in the 35 sense and antisense orientation in the E3 region. The sense construct (corresponding to the direction of transcription of E3) is named pTG13235, and the antisense construct is named pTG13236.

- 38 The doubly recombinant vectors containing the CMV-ERT and ERE/TKp-FIX expression cassettes in place of the El and E3 regions, respectively, are generated by homologous recombination between the fragments 5 carrying the FIX inducible cassette which are isolated from the vectors pTG13277 and pTG13228, and the vector pTG6246. pTG13233 and pTG13234 are obtained, depending on the orientation of the inducible cassette. 10 EXAMPLE 2: Construction of an adenoviral vector coexpressing the GRd*" transcriptional activator and the FIX gene regulated by the GRE sequences. The GRdex receptor cDNA carried by the EcoRI 15 fragment (2.7Kb) of the plasmid pHG1 (Kumar et al., 1987, Cell 51, 941-951) is cloned into the EcoRI site of the vector pTG6600, to give pTG13064. The adenoviral vector pTG13075 containing the CMVp-GR"' expression cassette as a replacement for the El region, and 20 deleted of most of the E3 region, is obtained by homologous recombination between the PacI-Bst EII fragment isolated from the previous vector and pTG4656 linearized with ClaI. The BamHI fragment containing the human FIX 25 cDNA is inserted downstream of the MMTV LTR containing the GRE sequence (Cato et al., 1986, EMBO J. 5, 2237-2240) . The cassette is then introduced, in the sense and antisense orientation, into the BglII site of pTG4664, bordering the deleted E3 sequences. The 30 transfer vectors are designated pTG6242 (sense) and pTG13063 (antisense) . A homologous recombination with the plasmid pTG6401 digested with SfrI (comprising the adenoviral genome deleted of the El and E3 regions) makes it possible to generate the E1~E3 adenoviral 35 vectors carrying the LTR MMTV-FIX inducible cassette in the sense and antisense orientation in the E3 region. The sense construct (identical to the direction of transcription of E3) is named pTG13082, and the antisense construct is named pTG13088.

- 39 A homologous recombination with the plasmid pTG13075 makes it possible to generate the E1~E3~ adenoviral vectors carrying the LTR MMTV-FIX inducible cassette in the sense and antisense orientation in the 5 E3 region and the CMV-GRdex cassette in the El region. The sense construct (identical to the direction of transcription of E3) is named pTG13083, and the antisense construct is named pTG13092 (reverse direction of transcription for the FIX and GRde" 10 cassettes). EXAMPLE 3: Construction of an adenoviral vector coexpressing the VgEcR transcriptional activator and the FIX gene regulated by the 15 5xE/GRE sequences. The plasmid pVgRXR (In Vitrogen) comprises the two subunits composing the transcriptional activator which can be activated by ecdysone or its analog muristerone A. The first is composed of the ecdysone 20 receptor (VgEcR), modified at three amino acids of the DNA-binding domain so as to obtain a sequence analogous to that of the GR receptor and fused in frame to the trans-activation domain of VP16, and the second is composed of the human retinoic acid receptor RXR (No et 25 al., 1996, Proc. Natl. Acad. Sci. USA 93, 3346-3351). The two cDNAs encoding VgEcR and RXR, directed by the CMV and RSV promoters, respectively, are modified by introducing an intron, positioned 5' of the coding sequences (pCI intron for CMVp-VgEcR and rabbit 30 P-globin intron for RSVp-RXR), and are introduced into the El region of an adenoviral vector according to the previous technique. The sequences encoding human FIX are introduced downstream of an inducible promoter comprising the 35 5xE/GRE target sequence coupled to the Ahsp minimum promoter (pIND; In Vitrogen). As previously, the cassette is introduced, in both orientations, into the BglII site of pTG4664. The homologous recombination with pTG6401 digested with SfrI makes it possible to - 40 generate the plasmids carrying the inducible cassette in the E3 region in the sense or antisense orientation. The doubly recombinant adenoviral vector is obtained by homologous recombination with the transfer 5 vector containing the VgEcR and RXR sequences. EXAMPLE 4: Production of adenoviruses. The recombinant adenoviral vectors containing the cassettes for expression of the activators and/or 10 of FIX are released from the corresponding plasmids (pTG13083, pTG13092, pTG13233, pTG13234, etc.) by PacI digestion, before being transfected into the 293 complementation line. The cellular lysate is harvested, subjected to three successive steps of freezing/thawing 15 in order to release the viral particles, and then clarified by centrifugation at 3500 rpm for 5 min. The virions present in the supernatant can be optionally amplified by subculturing on a permissive line (293 or A 549-El+) and purified on a cesium chloride gradient 20 according to the techniques of the prior art. The adenoviral stock is dialyzed in a suitable formulation buffer as described in WO 98/02522 (for example, 1M sucrose, 150 mM NaCl, 1 mM MgCl 2 , 10 mM Tris-HCl and 0.1% Tween 80). The viral titer is determined in 25 infectious units by assaying the DBP protein by immunofluorescence (Lusky et al., 1998, J. Virol. 72, 2022-2032), or a number of. viral particles by spectrophotometric measurement at 260 nm. A control vector is constructed by inserting 30 the human factor IX cDNA under the control of the CMV promoter isolated from the plasmid pCI (Promega). The constitutive expression cassette is introduced into the E3 region, giving pTG13231 (sense orientation) and pTG13232 (antisense orientation). The virions are 35 produced according to the same methodology as above. A homologous recombination between the plasmids pTG13231 and pTG13232 and the plasmid pTG6401 linearized with SrfI makes it possible to obtain the plasmids pTG13244 and pTG13245, respectively, carrying - 41 the CMV-FIX constitutive expression cassette in the sense and antisense orientation in the E3 region. EXAMPLE 5: Evaluation in vitro of the GRd"-inducible 5 system. The transfer vectors pTG13064, pTG6242 and pTG13063 carrying, respectively, the CMV-GRdex, LTR MMTV-FIX (sense) and LTR MMTV-FIX (antisense) cassettes are transiently transfected into the 293-cells (5 ptg of 10 DNA per 106 cells) . In addition, the plasmid pTG13064 is cotransfected with either pTG6242 or pTG13063. The cultures are maintained in the presence of dexamethasone (10-6 M) or in its absence. The cell supernatants are removed 48, 96, 120 and 144 hours 15 after transfection and the amount of FIX produced is determined by ELISA (Asserachrom kit; Diagnostica Stago). The results given in Figure 1 show induction of FIX production in the presence of the dexamethasone activated GRde' activator. The receptor expressed by 20 pTG13064 is therefore functional since, in the activated state (in the presence of dexamethasone), it can bind to the GRE motifs of the MMTV and induce the transcription of the FIX gene. The basal activity of the system is very low. Specifically, the amount of FIX 25 produced in the absence of dexamethasone or of pTG13064 is low, or even insignificant. The kinetics of FIX expression as a function of time show that the maximum level of production is reached 120 h after transfection. Beyond this, the 30 concentration stagnates, which can be explained by the state of the cells (at confluence) and a depletion of the medium, probably a depletion in dexamethasone. The effectiveness of the system was also evaluated by adenoviral infection in the presence or 35 absence of dexamethasone. The Vero or A549 nonpermissive host cells are infected with the virions AdTG13083 or AdTG13092 carrying the CMV-GRdex and MMTV FIX cassettes (sense for the first virus and antisense for the second), or coinfected with the adenoviruses - 42 AdTGl3075 (CMV-GR d") and AdTG13082 (sense MMTV-FIX) or AdTG13088 (antisense MMTV-FIX) . An MOI (multiplicity of infection) of 100 is used for the infection experiments and an MOI of 50 is used for each of the viruses in the 5 case of coinfection. The amount of FIX produced in the culture supernatants is assayed by ELISA. In the Vero cells, the expression of the FIX is quantifiable only after infection with the virions AdTG13092 carrying both cassettes and in the presence 10 of the inducer. No induction takes place in the absence of dexamethasone or of the GRdex receptor. It should be noted that these cells do not express the wild-type GR. In A549 cells, the FIX is produced in the presence of dexamethasone in the cells infected with 15 AdTG13088 or AdTG13092. It should be noted that these cells express the wild-type GR. However, the level of FIX is shifted in time in the absence of GRdex (virion AdTG13088). In conclusion, the inducible system using the 20 GRd" receptor and dexamethasone is functional in the constructs in which the MMTV-FIX inducible cassette is in the antisense orientation (AdTG13088 and AdTG13092) Moreover, the system of induction in cis (cassettes carried by a single virus) is noticeably more 25 productive than a system in trans using two viruses, in particular in the Vero cells. Moreover, the study was reproduced while varying the MOIs. The Vero cells are infected with the virus AdTG13092 at an MOI of 10, 50 or 100. AdTG13075 30 is used by way of a control. The FIX is assayed 48 and 72 h after infection. FIX production is observed whatever the MOI used, but the optimum level of expression is obtained for an MOI of 50. The concentration of inducer was also varied 35 from 10-1 to 10-5 M. At high concentration, dexamethasone proves to be cytotoxic, causing lower expression of FIX. At low concentration (10-8 M and lower), the induction is not effective. The optimum is at 10~' M.

- 43 A more detailed analysis of the "dose-response" effect was performed while varying the dexamethasone concentration from 109 to 10-7 M. This study was carried out in A549 cells expressing the wild-type GR 5 receptor. Activation can, consequently, take place via this receptor which can be activated by dexamethasone. In reality, it is observed that, for a dexamethasone concentration of 10~8 M, the expression of the Factor IX can be induced only after infection with the vector 10 AdTG13092 encoding the GRdex modified receptor. This concentration is, moreover, too low to allow the activation of the endogenous GR receptor (Figure 1). Consequently, we have shown that the induction of the reporter gene can take place in a controlled and 15 selective way, including in the presence of the wild type GR receptor, using lower doses of ligand. This aspect is important with a view to uses in vivo under natural conditions in which the wild-type GR receptor is expressed. 20 EXAMPLE 6: Evaluation in vivo of the GRd"-inducible system. The virus AdTG13092 is injected intravenously into immunocompetent C57B1/6 mice in a proportion of 25 4 x 108 or 8 X 108 iu. The dexamethasone is administered to the animals intraperitoneally at a concentration of 100 pig for 3 consecutive days (on DO, Dl and D2) . The sera are sampled regularly from the 3rd day following infection, and the amount of FIX produced is evaluated 30 by ELISA. Under these conditions, significant FIX production is observed. EXAMPLE 7: Evaluation in vivo of the GRd*x inducible system in immunocompetent mice 35 The viruses AdTG13092, AdTG13088 and AdTG13245 are injected intravenously into immunocompetent C57BI/6 mice in a proportion of 5 x 108 iu. The viruses AdTG13088 and AdTG13075 (Figure 3) are also coinjected in a proportion of 5 x 108 iu each.

- 44 The induction phase is carried out by injecting 100 pg of dexamethasone intraperitoneally for 3 consecutive days (on DO-Dl-D2, D21-D22-D23 and D42-D43-D44). 5 The sera of the treated mice are sampled at various times in order to evaluate the Factor IX production by the ELISA technique. The results (Figures 4a, b, c and d) show that: - the expression of the Factor IX reporter gene 10 is induced by the dexamethasone both after injection of the vector AdTGl3092 containing the cassette for expression of the GRd" trans-activator as well as the MMTV-FIX inducible cassette, and after coinjection of 15 two vectors each carrying one of these expression cassettes; - the expression of the FIX is also induced by the dexamethasone after injection of the vector AdTG13088 alone. In this case, the 20 level of expression of the FIX remains stable during the three inductions. This induction is carried out via the wild-type GR receptor which is expressed by the murine cells and which can be activated by the dexamethasone. 25 However, it may be noted that, at the first induction, the level of expression of the FIX is 10 times lower than that obtained in the case of the mice expressing the GRdex modified receptor; 30 - no expression is detected in the absence of dexamethasone, whatever the vector injected. It may be validly concluded therefrom that the amounts of endogenous glucocorticoids are too low to allow the activation of the MMTV 35 promoter via the wild-type GR receptor; - in the presence of the GRd* modified receptor, the level of expression of the FIX is comparable to the CMV constitutive promoter.

- 45 EXAMPLE 8: Evaluation in vitro of the GRdex-inducible system in immunodeficient mice. The viruses AdTG13092, AdTG13088 and AdTG13245 5 (see Figure 3) are injected intravenously into scid/scid immunodeficient mice in a proportion of 5 x 108 iu. The viruses AdTG13088 and AdTG13075 are also coinjected in a proportion of 5 x 108 iu each. The induction is carried out by injecting 100 pg of 10 dexamethasone intraperitoneally for 3 consecutive days (on DO-D1-D2, D21-D22-D23 and D42-D43-D44). The sera of the mice are sampled at various times in order to evaluate the FIX production by the ELISA technique. 15 The results (Figures 5a, b, c and d) are comparable to those observed in the case of immunocompetent mice: - the expression of the FIX is induced after injection of dexamethasone in the mice 20 expressing the GRd" modified receptor (AdTG13092 or AdTG13088+AdTG13075 injection). The level of induction falls by a log after the second and third injections of ligand, and then remain stable for the duration of 25 the experiment (7 months). The levels of induction are comparable in cis (injection of a single adenoviral vector) and in trans (injecction of two adenoviral vectors); - the expression of the FIX is induced by the 30 dexamethasone after injection of the vector AdTG13088, via the wild-type GR receptor. The level of induction is stable over time; - no basal expression of the FIX is detected in the absence of dexamethasone, whatever the 35 vector injected; - the level of induction in the presence of the GRde is comparable to the expression of the gene linked to the CMV constitutive promoter (at least during the first induction); - 46 - further studies made it possible to show the presence of the viral DNA by Southern blot, and the expression of the GRd" by Northern blot, after injection of the vector AdTG13092 5 or AdTG13075 (at least up to 56 days after injection of the adenoviral vectors). EXAMPLE 9: Evaluation of a dose-response in vivo in immunodeficient mice . 10 The vectors AdTG13092 and AdTG13088 are injected intravenously into scid/scid immunodeficient mice in a proportion of 5 x 108 iu. The induction is carried out by injecting 50 or 5 pg of dexamethasone intraperitoneally for 3 consecutive days (on DO-D1-D2 15 and D21-D22-D23). The sera are sampled at various times in order to evaluate the FIX production by ELISA. Prior studies made it possible to show that the injection of 3 x 100 jig, 3 x 50 pg or 3 x 20 pg of dexamethasone makes it possible to obtain equivalent 20 levels of induction. In this study, the inventors have identified a dose of ligand which makes it possible to activate the expression of the reporter gene via the GRdex modified receptor provided by an adenoviral vector (AdTG13092), but which is incapable of activating this 25 expression via the endogenous GR (AdTG13088 injection). The injection of 3 x 5 pg of dexamethasone makes it possible to activate the expression of the FIX in the presence of the GRdex, but is incapable of activating this expression via the endogenous GR 30 (Figure 6). Consequently, this dose makes it possible to activate the expression of the transgene in a controlled and selective way, even in the presence of the wild-type receptor.

- 47 EXAMPLE 10: Perfecting an inducible expression system capable of preventing the development of an immune response after administration in vivo of adenoviral vector. 5 Adenoviral vectors represent a system of choice for transferring a therapeutic gene into a patient. However, the expression of the transgene is generally transient. For this reason, it is necessary to repeat the administrations of the adenoviral vector in order 10 to ensure sustained expression of the therapeutic gene. Unfortunately, a first injection of adenovirus often leads to the development of an immune response which prevents any new administration. In the context of the present invention, the inventors have developed a novel 15 approach based on the expression of an immunosuppressive molecule capable of preventing the setting-up of this anti-adenovirus immune response. For this, the inventors inserted the gene encoding interleukin-10 (IL-10) into an inducible expression 20 system carried by an adenoviral vector. The regulated and controlled expression of the IL-10 thus enables the development of protocols in which the readministration of vectors carrying the therapeutic gene is possible. a) involvement of the immune response in the 25 persistence of recombinant adenoviruses - Cellular immune response: Vector deleted of the El and E3 regions The importance of the immune response has been demonstrated in experiments carried out in 30 immunocompetent or immunodeficient mice (Yang Y., F.A. Nunes, K. Berencsi, E.E. Furth, E. Ganczal and J.M. Wilson. 1994, Proc. Natl. Acad. Sci. USA 91: 4407-4411). Thus, the expression of the lacZ reporter gene is transient after injection of the adenoviral 35 vector into immunocompetent mice, but stable in immunodeficient mice. These studies suggest, therefore, that the cells transduced are destroyed by cytotoxic T lymphocytes (CTLs) . In addition, it has been shown that the generation of CTLs is induced by the viral - 48 particles injected and not only by newly-synthesized viral particles. Vector deleted of the El, E3 and E4 or E2a regions 5 The deletions of the E4 or E2a regions cause all residual expression of viral protein to disappear. However, toxicity is not decreased by eliminating the E2a region. On the other hand, the deletion of the E4 region leads to a significant decrease in hepatic 10 toxicity after intravenous injection. Despite persistence of the DNA, the expression of the transgene is, however, often considerably reduced. - Humoral immune response More than 85% of the worldwide population is 15 immunized against the adenovirus and has anti adenovirus antibodies directed against serotypes 2 or 5. If no re-infection occurs, the neutralizing antibody titer drops so as to reach an undetectable level after 2 years. These antibodies can prevent the binding of 20 the virus to the membrane receptor and its translocation into the cytoplasm. Whatever the deletions of the adenoviral genome, the humoral immune system is capable of recognizing the proteins of the viral capsid and of 25 producing anti-adenovirus neutralizing antibodies. Immunosuppression strategies are, therefore, required in order to allow readministration. b) Strategy of immunosuppression of the humoral immune response. 30 Interleukin-10 is known to have immuno suppressive properties and has shown promising results in the case of graft rejection and in anti-inflammatory treatments. IL-10 is secreted by many cells (monocytes/macrophages, T cells, B cells after 35 activation by an antigen) and has many target cells (including monocytes/macrophages, B cells, T cells, neutrophils and endothelial cells). It has a pleiotropic effect and has immunostimulating or immunosuppressive activities according to the cell - 49 type. Human and rat interleukins-10 are very homologous, 84% homology at the nucleotide level and 73% homology at the protein level. IL-10 has an immunosuppressive effect on 5 monocytes/macrophages. It inhibits the production of pro-inflammatory cytokines and of chemokines, and the expression of the class II MHC and of the costimulation molecules. It also limits the duration of the inflammatory response of granulocytes and of 10 eosinophils. On the other hand, IL-10 stimulates the viability of, the secretion of antibodies by and the expression of the class II MHC by B lymphocytes. It also has a stimulation role on mastocytes and on CD8' T 15 cells. Overall, IL-10 has, however, a very strong immunosuppressive effect. The anti-inflammatory and immunosuppressive properties of IL-10 might be involved in the suppression of the production of neutralizing 20 antibodies against the recombinant adenovirus. Specifically, the coinjection of adenoviruses encoding IL-10 and P-galactosidase prevents the induction of the immune response against the virus and the production of CTLs, thus allowing sustained expression of the 25 reporter gene. However, sustained immunosuppression is associated with not insignificant side effects; it is therefore desirable to obtain a transient and regulatable immunosuppression. 30 c) Inducible system according to the invention The system that we have developed is based on induction by hormones. Specifically, these hormones will bind to their nuclear receptor, consisting of a hormone-binding domain, of a DNA-binding domain and of 35 a trans-activation domain. After confirmational change and binding to the target elements located on the DNA, the transcription of the gene located downstream of the regulatable promoter will thus be activated. In order to avoid, however, activation by the endogenous - 50 hormones, elements which cannot be controlled, the inventors have chosen to use receptors modified in the hormone-binding domain. These mutated receptors, such as the estrogen or progesterone receptors, are capable 5 of responding to synthetic exogenous ligands, but not to the endogenous hormones. The inventors have developed a system based on the modified glucocorticoid receptor, GRdex, capable of inducing the expression of the transgene located 10 downstream of the GRE elements (Glucocorticoid Responsive Element) after activation by dexamethasone, but not by the endogenous glucocorticoids. In the course of this study, various adenoviral vectors inducibly expressing IL-10 were generated, in order to 15 evaluate their effects on the anti-adenovirus immune response. d) Generation of the adenoviral vectors All the adenoviral vectors derive from the plasmid pTg6401 comprising the genome of the type 5 20 human adenovirus deleted of nucleotides 459 to 3327 (El region) and of nucleotides 28 592 to 30 470 (E3 region). Insert in El: The GRdex modified gene is introduced into the El region of the genome of the 25 type 5 adenovirus by homologous recombination between the plasmid pTg6401 and the transfer plasmid containing the GRdex cDNA under the control of the CMV (Cytomegalovirus) promoter, of chimeric intron (pCI, Promega) and of an SV40 polyadenylation signal. 30 Insert in E3: The rat IL-10 cDNA (Feng L., W.W. Tang, J.C. Chang and C.B. Wilson. 1993. Biochem. Biophys Res. Commun.. 192: 452-45) was obtained by reverse PCR on the total mRNAs of rat cells using the oligonucleotides OTG12237 (CTAGTCTAGA CCACCATGCT 35 TGGCTCAGCA CTGCT=SEQ ID No. 1) and OTG12243 (TTTATAGCGG CCGCTCAATT TTTCATTTTG AGTG=SEQ ID No. 2), with 30 cycles of denaturation (1 minute at 950C), hybridization of the primers (1 minute at 650C) and extension (1 minute at 72*C) . The cDNA is placed - 51 downstream of 4 glucocorticoid responsive elements, GREs, contained in the MMTV (Mouse Mammary Tumor Virus) LTR promoter. This expression cassette is introduced into the transfer plasmid deleted of the E3 region, in 5 the antisense orientation with respect to the wild-type E3 region of the adenovirus. A homologous recombination of this transfer vector with the adenoviral vectors Ad-GRd*" or pTg6401 makes it possible to generate, respectively, either a 10 vector carrying the cassette for expression of the activator in El and the inducible cassette in E3 in the antisense orientation (Ad-GRdex -MMTV/IL-10-wild-type E4), or a vector containing only the induction cassette in E3 (Ad-AE1-MMTV/IL10-wild-type-E4). 15 The rat IL-10 cDNA was also placed under the control of the CMV promoter. This constitutive expression cassette was inserted into the E3 region of pTg6401 in the antisense orientation (Ad-AEl-CMV/IL10). All the second generation constructs are 20 obtained by homologous recombination between the transfer plasmid containing reading frames 3 and 4 (ORFs 3,4) of the E4 region and the preceding first generation vectors. All of the first and second generation 25 constructs are illustrated in Figure 7. e) Evaluation of the expression of IL-10 in vitro Transient transfection in 293-cells The 293-cells are transfected with the transfer 30 plasmids containing the cassettes for expression of rat interleukin-10 in the presence or absence of the cassette for expression of the GRdex activator. They are cultured in the presence or absence of dexamethasone (10-1 M) in DMEM 10% FCS. The supernatants are removed 35 at various times in order to analyze the expression of the transgene. Validation in vitro of the recombinant adenoviruses in A549 and VERO cells - 52 The A549 and VERO cells are seeded on the previous day at 3 x 10 5 cells in 6-well plates. The cells are infected at an MOI of 50 with the various viral prestocks in 250 pl of DMEM 2% FCS. After 30 5 minutes of adsorption at 37*C, 3 ml of DMEM 2% FCS are added to the cells in the presence or absence of 10- M dexamethasone. The supernatants are removed at various times in order to analyze the expression of the transgene. 10 Quantification of the expression of the rat IL-10 by ELISA (Enzyme Linked Immunosorbent Assay) test The detection of the rat IL-10 is carried out using the OptEIA kit (Pharmingen) . The kits are used according to the manufacturers' specifications. 15 The induction of the IL-10 by dexamethasone was evaluated by transient transfection of the transfer plasmids into 293-cells. The induction capacity is analyzed by cotransfecting the transfer vector MMTV-IL10 with the vector expressing the GR e trans 20 activator. The transfection of the plasmid MMTV-IL10 alone will indicate the level of expression of the IL-10 in the absence of the trans-activator. In addition, the level of induction is compared with the constitutive expression of the IL-10 under the control 25 of the CMV promoter, by also transfecting this plasmid into the 293-cells. The induction is carried out in the presence or absence of dexamethasone at a concentration of 107 M. The culture supernatants are removed 72 and 120 hours after transfection, in order to quantify the 30 IL-10 using an ELISA kit. The cotransfection of the plasmids MMTV-IL10 and GRdex in the presence of dexamethasone allows the induction of the IL-10 (50 ng/ml at 120 h post-transfection). The inventors have demonstrated that providing 35 the GR e trans-activator and the dexamethasone ligand allows induction of the expression of the IL-10 under the control of the MMTV inducible promoter. The effectiveness of induction of the IL-10 by dexamethasone coupled to the GRd* was evaluated in - 53 vitro by infection of the A549 human cells and of the VERO simien cells with the vectors Ad-MMTV-IL10 + AdGRdex or Ad-GRdex-MMTV-IL10. These two types of infection make it possible to evaluate the 5 effectiveness of induction in trans or in cis. The cell cultures are prepared in the presence or absence of 10- M dexamethasone. The amounts of IL-10 obtained will be compared with that obtained after infection with Ad-CMVIL-10 expressing this cytokine constitutively. In 10 addition, the induction of the IL-10 is compared with that of the human factor IX inserted into the same constructs, evaluated in vitro beforehand. The supernatants are removed at 24, 48, 72 and 96 hours post-infection in order to quantify the IL-10 and 15 factor IX produced, using ELISA kits. In VERO cells, the expression of the IL-10 is induced when the cells are coinfected with Ad-MMTV-IL10 + Ad-CMV-GRdex in the presence of dexamethasone, so as to reach 50.8 ng/ml 96 hours after infection. In the 20 absence of the ligand, the IL-10 is barely detectable (1.2 ng/ml) . On the other hand, in the absence of the GRd* trans-activator, no significant induction of the expression of the IL-10 can be noted (3 ng/ml in the presence of dexamethasone, corresponding to the 25 residual expression obtained in transient transfection; 0.7 ng/ml in the absence of dexamethasone. The inventors have therefore been able to demonstrate that, in VERO cells, the expression of the IL-10 can be induced by dexamethasone coupled to the 30 GRdex, in "trans", when the two expression cassettes are carried by two different adenoviral vectors. In A549 cells, they have also been able to verify the functionality of the system inducible in "trans". Specifically, the IL-10 concentration reaches 35 32.3 ng/ml in the presence of dexamethasone after coinfection with the vectors Ad-MMTV-IL10 + Ad-CMV GRd*x. In the absence of ligand, the cytokine is undetectable. The expression of the IL-10 is also induced by dexamethasone after infection with the - 54 vector Ad-MMTV-ILl0 alone. This activation occurs via the wild-type GR receptor expressed by the A549 cells.

Claims (34)

1. Inducible expression system comprising: (i) the nucleotide sequences encoding a 5 transcriptional activator of eukaryotic or viral origin, placed under the control of the regulation elements suitable for their expression in a host cell or organism, and (ii) a recombinant adenoviral vector 10 comprising a gene of interest placed under the control of an inducible promoter capable of being activated in trans by said transcriptional activator.

2. Expression system according to Claim 1, 15 characterized in that said transcriptional activator comprises at least one trans-activation domain, one DNA-binding domain and one ligand-binding domain (LBD).

3. Expression system according to Claim 2, characterized in that said transcriptional activator 20 comprises all or part of a domain derived from a steroid hormone receptor chosen from the group consisting of the estrogen (ER) , glucocorticoid (GR) , progesterone (PR), vitamin D, ecdysone (EcR), mineralocorticoid, androgen, thyroid hormone, retinoic 25 acid and retinoic acid X receptors, or from an immunophilin or from an aryl hydrocarbon receptor (AhR).

4. Expression system according to Claim 3, characterized in that said transcriptional activator is 30 chosen from: (i) a polypeptide, designated GRd*X, comprising a DNA-binding domain, a trans-activation domain and an LBD derived from a glucocorticoid receptor, said receptor being modified in its 35 LBD, in particular by substitution of the isoleucine at position 747 with a threonine; (ii) a polypeptide, designated ERT, comprising a DNA-binding domain, a trans-activation domain - 56 and an LBD derived from an estrogen receptor, said receptor being modified in its LBD, in particular by substitution of the glycine at position 521 with an arginine; 5 (iii) a transcriptional activator comprising a first polypeptide comprising an LBD derived from the ecdysone receptor, a hybrid DNA-binding domain derived from those of the EcR and GR receptors and a trans-activation domain derived from the 10 VP16 viral protein, and a second polypeptide derived from the Drosophila USP protein or from a homologue such as the human retinoic acid X receptor (RXR); (iv) a transcriptional activator comprising a first 15 polypeptide comprising a DNA-binding domain derived from the ZFHD1 transcription factor and an LBD derived from the FKBPl2 immunophilin, and a second polypeptide comprising a trans activation domain derived from the NFKB p65 20 factor and an LBD derived from FRAP (FKBP12 rapamycin-associated protein); and (v) a transcriptional activator comprising a first polypeptide derived from the AhR receptor and a second polypeptide derived from the Arnt 25 protein (aryl hydrocarbon receptor nuclear translocator).

5. Expression system according to one of Claims 1 to 4, characterized in that said transcriptional activator comprises an LBD and a trans-activation 30 domain derived from a steroid receptor and a heterologous DNA-binding domain, in particular derived from the Gal4 yeast protein.

6. Expression system according to one of Claims 1 to 5, characterized in that said transcriptional 35 activator is activated by binding of an unnatural inducer, and is not, or poorly, activated by a natural human compound. - 57

7. Expression system according to Claim 6, characterized in that said unnatural inducer is a synthetic substance which can be administered orally.

8. Expression system according to Claim 7, 5 characterized in that said inducer is chosen from the group consisting of dexamethasone, tamoxifen, muristerone A, ecdysone, rapamycin and 2,3,7,8 tetrachlorodibenzo-p-dioxine, or an analog of these compounds. 10

9. Expression system according to one of Claims 1 to 8, characterized in that said gene of interest encodes an antisense RNA, a ribozyme, or a polypeptide of interest.

10. Expression system according to Claim 9, 15 characterized in that said polypeptide of interest is chosen from the group consisting of chemokines, cytokines, cellular receptors, ligands, clotting factors, the CFTR protein, insulin, dystrophin, growth factors, enzymes, enzyme inhibitors, polypeptides with 20 an antitumor effect, polypeptides capable of inhibiting a bacterial, parasitic or viral infection, polypeptides which act on apoptosis, cytostatic agents, immunoglobulins, apolipoproteins, cytotoxic products, tumor suppressor gene expression products, tumor 25 associated antigens, immunotoxins, angiogenesis inhibitors and markers.

11. Expression system according to one of Claims 1 to 10, characterized in that said inducible promoter comprises one or more target sequence(s) which 30 respond(s) to a transcriptional activator as defined in one of claims 2 to 8.

12. Expression system according to Claim 11, characterized in that said target sequence is an ERE, GRE, EcR, UAS, 5xE/GRE, or XRE sequence or a target 35 sequence which responds to the ZFDH-1 transcription factor.

13. Expression system according to one of Claims 1 to 12, characterized in that said nucleotide sequences - 58 and their regulation elements are carried by said recombinant adenoviral vector.

14. Expression system according to one of Claims 1 to 12, characterized in that said nucleotide sequences 5 and their regulation elements are carried by an independent expression vector other than said recombinant adenoviral vector.

15. Expression system according to Claim 14, characterized in that said independent vector is a 10 synthetic vector, a plasmid or a viral vector, in particular derived from an adenovirus, from a retrovirus, from an adeno-associated virus (AAV), from a herpesvirus, from an alphavirus, from a parvovirus, from a poxvirus (fowlpox, canarypox, vaccinia virus, 15 etc.) or from a foamyvirus.

16. Expression system according to one of Claims 13 to 15, characterized in that said recombinant adenoviral vector and, where appropriate, said independent adenoviral vector are deficient for the El 20 function by deletion of all or part of the El region or nonfunctional mutation of the latter.

17. Expression system according to Claim 16, characterized in that said recombinant adenoviral vector and/or said independent adenoviral vector is/are 25 also deficient for at least one of the E2, E4, L, L2, L3, L4 and/or L5 functions.

18. Expression system according to Claim 16 or 17, characterized in that said recombinant adenoviral vector and/or said independent adenoviral vector is/are 30 also lacking all or part of the E3 nonessential region.

19. Expression system according to one of Claims 1 to 18, characterized in that said recombinant adenoviral vector and, where appropriate, said independent vector are in the form of infectious viral 35 particles.

20. Recombinant adenoviral vector comprising (i) the nucleotide sequences encoding a transcriptional activator, placed under the - 59 control of the regulation elements suitable for their expression in a host cell or organism, and (ii) a gene of interest placed under the control of an inducible promoter capable of being 5 activated in trans by said transcriptional activator.

21. Recombinant adenoviral vector according to Claim 20, characterized in that said nucleotide sequences encode a transcriptional activator according 10 to one of claims 2 to 6 or a prokaryotic transcriptional activator, in particular a polypeptide comprising an LBD and a DNA-binding domain derived from a tetracycline operon repressor.

22. Recombinant adenoviral vector according to 15 Claim 21, characterized in that said nucleotide sequences encode the tTA polypeptide comprising a tetracycline operon repressor (tetR) fused in frame to a transcription activation domain derived from the VP16 viral protein. 20

23. Recombinant adenoviral vector according to one of Claims 20 to 22, characterized in that said unnatural inducer is as defined in claim 7 or 8, or consists of doxycycline or tetracycline.

24. Recombinant adenoviral vector according to one 25 of Claims 20 to 23, characterized in that said gene of interest is as defined in claim 9 or 10.

25. Recombinant adenoviral vector according to one of Claims 20 to 24, characterized in that said inducible promoter is as defined in claim 11 or 12, or 30 comprises one or more tetO target sequence(s).

26. Recombinant adenoviral vector according to one of Claims 20 to 25, characterized in that said recombinant adenoviral vector is as defined in one of Claims 16 to 18. 35

27. Infectious viral particle comprising a recombinant adenoviral vector according to one of Claims 20 to 26.

28. Method for preparing a viral particle according to Claim 27, in which: - 60 (i) a recombinant adenoviral vector according to one of claims 20 to 26 is introduced into a complementation cell capable of complementing in trans said vector, so as 5 to obtain a transfected complementation cell, (ii) said transfected complementation cell is cultured under conditions suitable for allowing the production of said viral 10 particle, and (iii) said viral particle is recovered from the cell culture.

29. Eukaryotic cell comprising an expression system according to one of Claims 1 to 19, a recombinant 15 adenoviral vector according to one of claims 20 to 26 or an infectious viral particle according to claim 27.

30. Pharmaceutical composition comprising an expression system according to one of Claims 1 to 19, a recombinant adenoviral vector according to one of 20 Claims 20 to 26, an infectious viral particle according to Claim 27 or a eukaryotic cell according to Claim 29, and a vehicle which is acceptable from a pharmaceutical point of view.

31. Pharmaceutical composition according to 25 Claim 30, characterized in that it is in injectable form.

32. Use of an expression system according to one of Claims 1 to 19, of a recombinant adenoviral vector according to one of Claims 20 to 26, of an infectious 30 viral particle according to Claim 27 or of a eukaryotic cell according to Claim 29, for preparing a medicinal product intended for the transfer and for the expression of said gene of interest in a host cell or organism. 35

33. Use of an expression system according to one of Claims 1 to 19, of a recombinant adenoviral vector according to one of Claims 20 to 26, of an infectious viral particle according to Claim 27 or of a eukaryotic cell according to Claim 29, for preparing a medicinal - 61 product intended for the treatment of diseases by gene therapy.

34. Transcriptional activator comprising an LBD and a trans-activation domain derived from a steroid 5 receptor and a heterologous DNA-binding domain, in particular derived from the Gal4 yeast protein.