EP0918767A1 - Produit pharmaceutique pour le traitement de troubles neurologiques et neuropsychiatriques - Google Patents

Produit pharmaceutique pour le traitement de troubles neurologiques et neuropsychiatriques

Info

Publication number
EP0918767A1
EP0918767A1 EP97926837A EP97926837A EP0918767A1 EP 0918767 A1 EP0918767 A1 EP 0918767A1 EP 97926837 A EP97926837 A EP 97926837A EP 97926837 A EP97926837 A EP 97926837A EP 0918767 A1 EP0918767 A1 EP 0918767A1
Authority
EP
European Patent Office
Prior art keywords
compound
ring
substituted
alkyl
nitrogen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97926837A
Other languages
German (de)
English (en)
Other versions
EP0918767A4 (fr
Inventor
Vassil Iliya Ognayanov
Laurence Borden
Stanley Charles Bell
Jing Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Allelix Neuroscience Inc
Original Assignee
Trophix Neuroscience Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Trophix Neuroscience Inc filed Critical Trophix Neuroscience Inc
Publication of EP0918767A1 publication Critical patent/EP0918767A1/fr
Publication of EP0918767A4 publication Critical patent/EP0918767A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/06—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with radicals, containing only hydrogen and carbon atoms, attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/10—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms
    • C07D211/14—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/18—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D211/20—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by singly bound oxygen or sulphur atoms
    • C07D211/22—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by singly bound oxygen or sulphur atoms by oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/40—Oxygen atoms
    • C07D211/42—Oxygen atoms attached in position 3 or 5
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/68—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member
    • C07D211/70—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/04—Ortho-condensed systems

Definitions

  • the present invention relates to a class of substituted cyclic amines, pharmaceutical compositions and methods of treating neurological and neuropsychiatric disorders
  • Synaptic transmission is a complex form of intercellular communication that involves a considerable array of specialized structures in both the pre- and post-synaptic neuron
  • High- affinity neurotransmitter transporters are one such component, located on the pre-synaptic terminal and surrounding glial cells (Kanner and Schuldiner, CRC Critical Reviews in Biochemistry, 22, 1032 (1987))
  • Transporters sequester neurotransmitter from the synapse, thereby regulating the concentration of neurotransmitter in the synapse, as well as its duration therein, which together influence the magnitude of synaptic transmission Further, by preventing the spread of transmitter to neighboring synapses, transporters maintain the fidelity of synaptic transmission Last, by sequestering released transmitter into the presynaptic terminal, transporters allow for transmitter
  • Neurotransmitter transport is dependent on extracellular sodium and the voltage difference across the membrane, under conditions of intense neuronal firing, as, for example, during a seizure, transporters can function in reverse, releasing neurotransmitter in a calcium- independent non-exocytotic manner (Attwell et al , Neuron. H, 401-407 (1993))
  • Pharmacologic modulation of neurotransmitter transporters thus provides a means for modifying synaptic activity, which provides useful therapy for the treatment of neurological and psychiatric disturbances
  • the ammo acid glycine is a major neurotransmitter in the mammalian central nervous system, functioning at both inhibitory and excitatory synapses By nervous system, both the central and peripheral portions of the nervous system are intended
  • These distinct functions of glycine are mediated by two different types of receptor, each of which is associated with a different class of glycine transporter
  • the inhibitory actions of glycine are mediated by glycine receptors that are sensitive to the convulsant alkaloid strychnine, and are thus referred to as "strychnine-sensitive"
  • Such receptors contain an intrinsic chloride channel that is opened upon binding of glycine to the receptor, by increasing chloride conductance, the threshold for firing of an action potential is increased
  • Strychnine-sensitive glycine receptors are found predominantly in the spinal cord and brainstem, and pharmacological agents that enhance the activation of such receptors will thus increase inhibitory neurotransmission in these regions
  • Glycine functions in excitatory transmission by modulating the actions of giutamate, the major excitatory neurotransmitter in the central nervous system See Johnson and Ascher,
  • NMDA N-methyl-D-aspartate
  • GlyT-1 is found predominantly in the forebrain, and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al., Neuron. ⁇ , 927-935 (1992)).
  • GlyT-1a is found predominantly in the forebrain, and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al., Neuron. ⁇ , 927-935 (1992)).
  • GlyT-1a is three variants of GlyT-1, termed GlyT-1a, GlyT-1b and GlyT-1c (Kim, et al., Molecular Pharmacology. 45, 608-617 (1994)), each of which displays a unique distribution in the brain and peripheral tissues.
  • GlyT-2 in contrast, is found predominantly in the brain stem and spinal cord, and its distribution corresponds closely to that of strychnine-sensitive glycine receptors (Liu et al., 1 Biological Chemistry. 268. 22802-22808 (1993); Jursky and Nelson, J. Neurochemistrv. 64, 1026-
  • GlyT-2 can be used to diminish the activity of neurons having strychnine-sensitive glycine receptors via increasing synaptic levels of glycine, thus diminishing the transmission of pain-related (i.e., nociceptive) information in the spinal cord, which has been shown to be mediated by these receptors.
  • pain-related i.e., nociceptive
  • enhancing inhibitory glycinergic transmission through strychnine-sensitive glycine receptors in the spinal cord can be used to decrease muscle hyperactivity, which is useful in treating diseases or conditions associated with increased muscle contraction, such as spasticity, myoclonus, and epilepsy (Truong et al., Movement Disorders. 3, 77-87 (1988); Becker, FASEB J.. 4, 2767-2774 (1990)).
  • Spasticity that can be treated via modulation of glycine receptors is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury, dystonia, and other conditions of illness and injury of the nervous system.
  • NMDA receptors are critically involved in memory and learning (Rison and Stanton, Neurosci. Biob ⁇ hav. Rev.. 19_, 533-552 (1995); Danysz et al., Behavioral Pharmacol.. ⁇ , 455-474 (1995)); and, furthermore, decreased function of NMDA-mediated neurotransmission appears to underhe, or contribute to, the symptoms of schizophrenia (Olney and Farber, Archives General Psychiatry.
  • agents that inhibit GlyT-1 and thereby increase glycine activation of NMDA receptors can be used as novel antipsychotics and anti-dementia agents, and to treat other diseases in which cognitive processes are impaired, such as attention deficit disorders and organic brain syndromes
  • over-activation of NMDA receptors has been implicated in a number of disease states, in particular the neuronal death associated with stroke and possibly neurodegenerative diseases, such as Alzheimer's disease, multi-infarct dementia, AIDS dementia, Huntington's disease, Parkinson's disease, amyotrophtc lateral sclerosis or other conditions in which neuronal cell death occurs, such as stroke or head trauma Coyle & Puttfarcken, Science. 2S2, 689-695 (1993), Lipton and Rosenberg, New Enol J of Medicine. 330.
  • the present invention provides a class of compounds that inhibit glycine transport via the GlyT-1 or GlyT-2 transporters, are precursors, such as pro-drugs, to compounds that inhibit such transport, or are synthetic intermediates for preparing compounds that inhibit such transport
  • the invention provides a class of compounds formulas
  • the present invention provides compound of one of the following formulas I and II
  • R 2 is hydrogen, (C1-C6) alkyl, (C1-C6) alkoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R 1 is not -0-R 8 or -S-R 8" ) hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R 1 , R xb or R yb , (d) is oxygen forming an oxa linkage with R 1 or integrated into ring E (see, for example, Compound C6) or (e) is R 2a linked by R 26 to X, (2') R x is a ring-containing structure R x
  • R xa , R ya and R 2a are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring having from 0 to 2 heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, wherein
  • aryl is phenyl or naphthyl
  • heteroaryl comprises a five-membered ring, a six-membered ring, a six- membered ring fused to a five-membered ring, a five-membered ring fused to a six-membered ring, or a six-membered ring fused to a six-membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon,
  • each of R xa , R ya and R 2a can be independently substituted with one of R q , R r O- or R S S-, wherein Rq, Rr and Rs are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring as these structures are defined for R xa , and
  • R xa , R ya , R 2a , R q , R r and R s can be additionally substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, tnfluoromethyl, amidosulfonyl which can have up to two independent
  • ring D is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring D there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ring nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring D can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, t ⁇ fluoromethyl, (C1-
  • ring E is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring E there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ⁇ ng nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring E can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, t ⁇ fiuoro
  • R 4 and R 4' are independently hydrogen or (C1-C6) alkyl, or one of R 4 and R 4" can be (C1-C6) hydroxyalkyl, and
  • R5 is (CO)NR 13 R 14 , (CO)OR 15 , (CO)SR 16 , (S0 2 )NR 17 R 18 , (PO)(OR 19 )(OR 20 ), (CR 22 )(OR 23 )(OR 24 ), CN or tetrazol-5-yl, wherein R 13 , R 14 , R 15 , R 16 , R 17 , R 18 , R 19 and R 20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and , (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the ammo can be substituted with up to two independent (C1-C6) alkyls, arylalkyl wherein the alkyl is C1-C6, heteroarylalkyl wherein the alkyl is C1 to
  • R xa , R ya and R 2a is substituted with fluoro, trifluoromethyl, tnfluoromethoxy, nitro, cyano, or (C3-C8) alkyl
  • at least one of R xa , R ya and R 2a is substituted with R q , R r O-, or R S S-.
  • an aryl or heteroaryl of at least one of R xa , R ya and R 2a is phenyl.
  • R yb is oxa, methyleneoxy, thia, methylenethia.
  • R yb is oxa or thia.
  • R 5 is (CO)NR 13 R 14 , (CO)OR 15 or (CO)SR 16
  • R 15 is (C2-C6) alkyl, (C2-C4) hydroxyalkyl, phenyl, phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the ammo can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted.
  • n is zero.
  • R 15 is hydrogen.
  • R 4 is hydrogen, methyl or hydroxymethyl and R 4" is hydrogen.
  • R xa , R ya and R 2a is a heteroaryl comprising diazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, thiolyl, diazmyl, t ⁇ azinyl, benzoazolyl, benzodiazolyl, benzothiazolyl, benzoxazolyl, benzoxolyl, benzothiolyl, quinolyl, isoquinolyl, benzodiazinyl, benzotriazmyl, py ⁇ dyl, thienyl, furanyl, pyrrolyl, indolyl, isoindoyl or py ⁇ midyl.
  • R 1 is -O-R 8 or -S-R 8"
  • the second bridge between two of R xa , R ya and R 2a is L, and satisfies the following formula:
  • the alkylenedioxy substitution of R xa , R ya or R 2a is as follows:
  • ring D is according to one of formulas A' and B':
  • the ring system comprising G * is according to one of formulas C and D'
  • ring D or ring E is substituted with up to three substituents.
  • R xa and R ya together can be substituted with up to six substituents
  • R 2a , R q , R r and R s can each be substituted with up to 3 substituents, and wherein the presence of each of R q , R r or R s is considered a substitution to the respective ring structure of R xa , R ya and R 2a
  • the aryl, heteroaryl, aryl of arylalkyl or the heteroaryl of heteroarylalkyl of R 13 , R 14 , R 15 , R 16 R 17 , R 18 R 19 or R 20 is substituted with up to three substituents
  • the compound is an optically pure enantiomer
  • the compound is an optically pure enantiomer (i e , at least about 80% ee, preferably at least about 90% ee, more preferably at least about 95% ee)
  • the invention provides a pharmaceutical composition comprising the compound and a pharmaceutically acceptable excipient
  • the compound of the invention is present in an effective amount for (1) treating or preventing schizophrenia, (2) enhancing treating or preventing dementia, (3) treating or preventing epilepsy, (4) treating or preventing spasticity, (5) treating or preventing muscle spasm, (6) treating or preventing pain, (7) preventing neural cell death after stroke, (8) preventing neural cell death in an animal suffering from a neurodegenerative disease, (9) treating or preventing mood disorders such as depression, (10) enhancing memory or learning, or (11) treating or preventing learning disorders
  • the invention further provides a method (1) of treating or preventing schizophrenia comprising administering a schizophrenia treating or preventing effective amount of a compound, (2) of treating or preventing dementia comprising administering a dementia treating or preventing effective amount of a compound, (3) of treating or preventing epilepsy comprising administering an epilepsy treating or preventing effective amount of a compound, (4) of treating or preventing spasticity comprising administering a spasti
  • the invention also provides a method of synthesizing a compound of the invention comprising reductively alkylating R d NH 2 with a compound of the formula
  • R c and R are independently the same as defined for R x
  • R r has the same definition as R 1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds conjugated with the above-illustrated carbonyl
  • the invention also provides a method of synthesizing a compound of the invention comprising reacting R f OH or R r SH with a compound of the formula
  • the method further comprises synthesizing the compound of formula
  • the method comprises reacting a compound of formula
  • the invention also provides a method of synthesizing a compound of the invention comprising reacting R e M with a compound of the formula
  • R e is independently the same as defined for R x , wherein M is a metal-containing substituent such that R e M is a organometallic reagent
  • the invention also provides a method of synthesizing a compound of the invention comprising dehydrating a compound of the formula
  • C * (the tertiary carbon marked with an adjacent " * ") has a double bond with an adjacent carbon
  • R 27 and R 27" have the same definition as R 1 except that R 27 and R 27" do not include a nitrogen, oxygen or sulfur
  • the invention also provides a method of synthesizing a compound of the invention comprising reducing a compound of the formula
  • the invention also provides a method of synthesizing a compound of the invention comprising reducing a compound of one of the following formulas
  • ring C" or ring C ⁇ x can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring C" or ring C' x can be substituted with up to two substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl, and wherein I is a negative counter-ion
  • the compound reduced is that containing ring C"
  • the invention also provides a compound according to the following formula
  • the invention also provides a method of synthesizing this compound comprising reacting a compound of the formula
  • L is a nucleophilic substitution leaving group and wherein ring C can be fused with phenyl or substituted, the same as defined for ring C"
  • the invention also provides a compound of the invention according to the following formula
  • ring C ⁇ x can be fused with phenyl or substituted, the same as defined for ring C", and is mono or di-unsaturated at one or more of the bonds indicated with the dased lines with the double bonds formed between ring carbons and no two double bonds are adjacent
  • the invention also provides a compound of the following formula
  • the invention also provides a method of synthesizing this compound comprising reacting a compound of the formula
  • the invention also provides a compound of the following formula
  • the invention also provides a method of synthesizing this compound, the method comprising reducing a compound of the following formula
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula
  • the invention also provides a method of synthesizing of a compound of the invention, the method comprising reacting a compound of formula
  • Ar is aryl which is substituted with an electron-withdrawing group or heteroaryl and is substituted with an electron-withdrawing group, and wherein Q is halide (preferably fluoro or chloro), to form
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula X
  • the method further comprises converting the compound of formula X to
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising reacting a compound of formula
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula:
  • said synthesis comprising reducing the ketone of a compound of formula
  • the invention also provides a compound of the following formula
  • the invention also provides a method of synthesizing this compound, comprising reacting a compound of the formula
  • the invention also provides a compound of the following formula
  • ring C x can be fused with phenyl or substituted, the same as defined for ring C"
  • Excipients are pharmaceutically acceptable organic or inorganic carrier substances suitable for parenterai, enteral (e g , oral or inhalation) or topical application that do not deletereiously react with the active compositions
  • Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions, alcohols, gum arable, benzyl alcohols, gelatine, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, hydroxymethylcellulose, polyvmylpyrrolidone, and the like
  • Neuronal cell death is "prevented” if there is a reduction in the amount of cell death that would have been expected to have occurred but for the administration of a compound of the invention
  • L 1 and L 2 are good nucleophilic substitution leaving groups such as a halide, especially a bromide, a tosylate, a brosylate (p-bromobenzenesulfonate), and the like.
  • the reaction is preferably conducted in the presence of a base such as potassium carbonate or a tertiary amine such as diisopropylethylamine.
  • the leaving group is a halide
  • the reaction can be conducted in the presence of an iodide salt such as potassium iodide.
  • Suitable organic solvents include, for example, methanol, dioxane, acetonitrile or dimethyformamide.
  • the reaction is favorably conducted at a temperature range of about 15 * C to about 40°C. Avoiding more elevated temperatures helps avoid producing the quaternary ammonium salt resulting from bis-alkylation.
  • Cmpound I 1 can be reduced further, for instance in a Reaction 5 that produces
  • a further Reaction 6 can be used to fully reduce ring C v
  • the bond between R 1 and the ring is either at the 2, 3 or 4 position of the ring
  • L 4 is a good nucleophihc substitution leaving group such as a halide, especially a bromide
  • the ring C can be substituted Suitable organic solvents include, for example, those that effectively solubilize the starting materials and are unreactive to the alkylation reagent Depending on the reactants, such solvents can include benzene, acetonit ⁇ le, tetrahydrofuran or ethanol The reaction is favorably conducted at a temperature range of about 20 ⁇ C to about 100 ⁇ C
  • the ring C is reduced by one of a number of reduction procedures known in the art, such as, for instance, reaction with a metal hydride such as sodium borohyd ⁇ de See R M Acheson, G Paghetti, J Chem Soc . Perkm I.
  • a metal hydride such as sodium borohyd ⁇ de See R M Acheson, G Paghetti, J Chem Soc . Perkm I.
  • R c and R d are independently the same as defined for R x
  • the starting material III can be synthesized, for instance, using the chemistry of Reaction 15 (similar to Reaction 1), as follows
  • R has the same definition as R except that it does not include a nitrogen, does not include an oxygen linked to the above-illustrated carbonyl and does not include any double bonds conjugated with the above-illustrated carbonyl, and wherein L 3 is a good nucleophilic substitution leaving group such as a halide, especially a bromide, a tosylate, a brosylate (p- bromobenzenesulfo ⁇ ate), and the like
  • Reaction 7 shown in the Figure, R d -NH 2 is reacted with III to form IV under conditions that effect a reductive alkylation
  • the reductive alkylation can be effected by several known methods (see, for example, "Reductive Alkylation,” W S Emerson in Organic Reactions.
  • Suitable solvents using catalytic hydrogenation to reduce the Schiffs base include ethanol.
  • Suitable solvents using a borohydride to reduce the Schiffs base include alcoholic solvents such as methanol or ethanol.
  • a drying process can be employed during the reaction to promote the dehydration reaction that forms the Schiffs base that is reduced. Such drying processes include refluxing under conditions selected to remove water as an azeotrope or the use of molecular sieves or other drying reagents. Suitable reaction temperatures include the range from about 20°C to the reflux temperature of the solvent employed.
  • IV can be synthesized via Reaction 16, shown in the Figure, by reacting R d -NH 2 with X under the conditions described for Reaction 1 or Reaction 2
  • starting material III 1 is prepared as follows: Reaction 17
  • Reactions 17 and 18 use chemistry described above for Reactions 3 and 6, respectively
  • This compound III' can be substituted for III in Reactions 7, 8 and 12, shown in the Figure.
  • R e is independently the same as defined for R 1 .
  • III or III' is reacted with a organometallic reagent such as an aryllithium or an aryl or arylalkyl Grignard reagent to form V, as described, for instance, in Section 5.1.2 of Cary and Sundberg, Advanced Organic Chemistry, Part 2, Plenum, New York, 1977, pp. 170-180, and references cited therein.
  • the organometallic reagent may react with the ester group; in those such cases where the yield of the desired product is too low, the solvent, the organometallic reagent or the ester substitution can be varied.
  • V is subjected to conditions suitable for dehydration to form a double bond.
  • conditions suitable for dehydration to form a double bond are, for instance, those described in H. Weiland, B_SL
  • reaction 11 V is acylated, for instance, with acetic anhydride in the presence of an acylation catalyst such as 4-dimethylaminopyridine.
  • reaction 12 shown in the Figure, the ketone moiety of III or III' is reduced, for instance by any of a number of known methods for selectively reducing ketones, such as reaction with lithium tri-tert-butoxyaluminohydride.
  • reaction 13 shown in the Figure, the hydroxyl of IX is replaced by a leaving group L 6 , wherein the leaving group is, for instance, chloro or bromo, by reacting IX with, for instance, thionyl chloride or thionyl bromide.
  • R f independently satisfies the definition of R x .
  • X is reacted with R f OH in the presence of a base such as K 2 C0 3 or sodium hydride.
  • a base such as K 2 C0 3 or sodium hydride.
  • the thio-containing analog of XI can be synthesized by reacting X with R f SH.
  • reaction 19 IX is reacted with R ⁇ HSO ⁇ r to yield XII, for instance for instance under the conditons of Mitzunobu reaction, and further converted into IV by reacton 20, analogously to the procedure described in J.R. Henry et al., Tetrahedron Letters 30: 5709-5712, 1989.
  • acids can be formed by the hydrolysis of the corresponding esters.
  • Amine derivatives can be formed by the alkylation of primary, secondary or tertiary amines.
  • a number of double bond containing compounds can be hydrogenated to form the corresponding single bond.
  • R 13 , R' 5 , R' 6 , R 17 and R 20 can be residues other than hydrogen representing functionalized resin or suitably selected linker attached to functionalized resin
  • the linker and the functional group represented by R 5 should be stable under the conditions employed for the above-described reactions
  • the compounds of the invention where R 13 , R 15 , R 16 , R 17 is R 20 is hydrogen, are then cleaved from the resin or the linker leaving the remainder of the molecule intact
  • solid-phase synthesis of peptoids [ol ⁇ go(N-subst ⁇ tuted glycines)] using robotic synthesizer was described by Zuckermann et al , J.
  • the chemistries outlined above may have to be modified, for instance by use of protective groups, to prevent side reactions due to reactive groups, such as reactive groups incorporated into heterocyclic rings or attached as substituents Using the reactions described herein, hydrolysis of esters, alkylation of amines, or hydrogenation reactions, the following compounds of the invention have been synthesized
  • Enantiome ⁇ c excess (“ee") can be enhanced by purification techniques such as crystallization or chromatography on chiral supports Enantiome ⁇ c excess can be quantitated by a number of analytic techniques including NMR, optical rotation measurements and appropriate chromatography.
  • the D ring or the E ring is substituted with at most one of aryl or heteroaryl
  • glycine transporter genes and their respective gene products are responsible for the reuptake of glycine from the synaptic cleft into presynaptic nerve endings or ghal cells, thus terminating the action of glycine Neurological disorders or conditions associated with improperly controlled glycine receptor activity, or which could be treated with therapeutic agents that modulate glycine receptor activity, include spasticity (Becker, FASEB Journal, 4, 2767-2774 (1990)) and pain realization (Yaksh, Pajn, 37, 111-123 (1989)) Additionally, glycine interacts at N-methyl-D-aspartate (NMDA) receptors, which have been implicated in learning and memory disorders and certain clinical conditions such as epilepsy, Alzheimer's and other cognition-related diseases, and schizophrenia See Rison and Stanton, Neurosci Biobehav Rev . 19, 533-552 (1995), Danysz et al , Behavioral Pharmacol . 6, 455-474 (1995)
  • NMDA N
  • NMDA receptors which receptors are located in the forebrain, among other locations
  • This concentration increase elevates the activity of NMDA receptors, thereby alleviating schizophrenia and enhancing cognitive function
  • compounds that interact directly with the glycine receptor component of the NMDA receptor can have the same or similar effects as increasing or decreasing the availability of extracellular glycine caused by inhibiting or enhancing GlyT-1 activity, respectively See, for example, Pitkanen et al , Eur J Pharmacol . 253. 125-129 (1994), Thiels et al , Neuroscience. 46, 501-509 (1992), and Kretschmer and Schmidt, J Neurosci..
  • the compounds of the invention are, for instance, administered orally, sublmgually, rectally, nasally, vaginally, topically (including the use of a patch or other transdermal delivery device), by pulmonary route by use of an aerosol, or parenterally, including, for example, intramuscularly, subcutaneously, intrape ⁇ toneally, intraarte ⁇ ally, intravenously or intrathecally Administration can be by means of a pump for periodic or continuous delivery
  • the compounds of the invention are administered alone, or are combined with a pharmaceutically-acceptable carrier or excipient according to standard pharmaceutical practice
  • the compounds of the invention are used in the form of tablets, capsules, lozenges, chewing gum, troches, powders, syrups, elixirs, aqueous solutions and suspensions, and the like
  • carriers that are used include lactose, sodium citrate and salts of phosphoric acid
  • Various dismtegrants such as starch, and lubricating agents such as magnesium stea
  • Suppository forms of the compounds of the invention are useful for vaginal, urethral and rectal administrations
  • Such suppositories will generally be constructed of a mixture of substances that is solid at room temperature but melts at body temperature
  • the substances commonly used to create such vehicles include theobroma oil, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weight and fatty acid esters of polyethylene glycol See, Remington's Pharmaceutical Sciences, 16th Ed , Mack Publishing, Easton, PA, 1980, pp 1530-1533 for further discussion of suppository dosage forms
  • Analogous gels or cremes can be used for vaginal, urethral and rectal administrations
  • Numerous administration vehicles will be apparent to those of ordinary skill in the art, including without limitation slow release formulations, liposomal formulations and polymeric matrices
  • Examples of pharmaceutically acceptable acid addition salts for use in the present invention include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphospho ⁇ c, nitric and sulfunc acids, and organic acids, such as tarta ⁇ c, acetic, citric, malic, lactic, fuma ⁇ c, benzoic, glycolic, gluconic, succmic, p-toluenesulphonic and arylsulphonic acids, for example
  • Examples of pharmaceutically acceptable base addition salts for use in the present invention include those derived from non-toxic metals such as sodium or potassium, ammonium salts and organoamino salts such as tnethylamine salts Numerous appropriate such salts will be known to those of ordinary skill
  • Dosages will generally be selected to maintain a serum level of compounds of the invention between about 0 01 ⁇ g/cc and about 1000 ⁇ g/cc, preferably between about 0 1 ⁇ g/cc and about 100 ⁇ g/cc
  • an alternative measure of preferred amount is from about 0 01 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg, will be administered
  • an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
  • an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
  • an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
  • eukaryokic cells For use in assaying for activity in inhibiting glycine transport, eukaryokic cells, preferably QT-6 cells derived from quail fibroblasts, have been transfected to express one of the three known variants of human GlyT-1, namely GlyT-1a, GlyT-1b or GlyT-1c or human GlyT-2
  • the sequences of these GlyT-1 transporters are described in Kim et al , Molec Pharm 45 608-617, 1994, excepting that the sequence encoding the extreme N-terminal of GlyT-1a was merely inferred from the corresponding rat-derived sequence
  • This N-terminal protein-encoding sequence has now been confirmed to correspond to that inferred by Kim et al
  • the sequence of the human GlyT-2 is described by Albert et al., U S.
  • Suitable expression vectors include pRc/CMV (Invitrogen), Zap Express Vector (Stratagene Cloning Systems, LaJolla, CA, hereinafter "Stratagene"), pBk/CMV or pBk-RSV vectors (Stratagene), Bluesc ⁇ pt II SK -n'- Phagemid Vectors (Stratagene), LacSwitch (Stratagene), pMAM and pMAM neo (Clontech), among others
  • a suitable expression vector is capable of fostering expression of the included GlyT DNA in a suitable host cell, preferably a non-mammalian host cell, which can be eukaryotic, fungal, or prokaryotic
  • suitable host cells include amphibian, avian, fungal, insect, and reptilian cells
  • the compounds of the invention have a number of pharmacological actions
  • the relative effectiveness of the compounds can be assessed in a number of ways, including the following
  • test compound that increases calcium flux either (a) has little or no antagonist activity at the NMDA receptor and should not affect the potentiation of glycine activity through GlyT-1 transporter inhibition or (b), if marked increases are observed over GlyT-1 inhibitors used for comparison and that have little direct interaction with NMDA receptors, then the compound is a receptor agonist
  • the test confirms activity in treating or preventing schizophrenia, increasing cognition, or enhancing memory
  • a test compound that decreases calcium flux has a net effect wherein receptor antagonist activity predominates over any activity the compound has in increasing glycine activity through inhibiting glycine transport
  • the test confirms activity in limiting or preventing the cell damage and cell death arising after stroke or other ischemia- mducing conditions, or in limiting or preventing the cell damage associated with neurodegenerative diseases All animal methods of treatment or prevention described herein are
  • Reagent A) ethyl bromoacetate (Aldrich); B) benzyl 2-bromoacetate (Aldrich) Solvent X) acetonit ⁇ le
  • Step 1 A mixture of 0490 g (2 mmol) 3-d ⁇ phenylmethylpyr ⁇ d ⁇ ne (Sigma-Aldrich Library of Rare Chemicals) and 0334 g (4 mmol) ethyl bromoacetate (Aldrich) in 2 ml acetonit ⁇ le was heated under reflux for 1 hour The solvent was evaporated, the residue suspended in diethyl ether and filtered to give 08 g 1-ethoxycarbonylmethyl-3-diphenylmethylpyndinium bromide as a yellow powder ⁇ NMR (CD 3 OD, 300 MHz) ⁇ 887 (d, 1 H), 877 (s, 1 H), 842 (d, 1 H), 8 10
  • Example 3 Example 5 - Hydrogenation of compound C1 to form 3-diphenylmethylp ⁇ pe ⁇ d ⁇ n-1-yl acehc acid ethyl ester (compound C2)
  • Example 6A - Additional syntheses Compound C7 is prepared by hydrogenation of compound C8 using the methodology of
  • Example 6B Additional Syntheses Using the Procedure of Example 6A
  • Compound C11 was prepared by hydrolysis of Compound C2, followed by acidification
  • Compound C12 was prepared by hydrolysis of Compound C1, followed by acidification
  • This example sets forth methods and materials used for growing and transfecting QT-6 cells.
  • QT-6 cells were obtained from American Type Culture Collection (Accession No. ATCC CRL-1708) Complete QT-6 medium for growing QT-6 is Medium 199 (Sigma Chemical Company, St. Louis, MO, hereinafter "Sigma") supplemented to be 10% tryptose phosphate, 5% fetal bovine serum (Sigma); 1% penicillin-streptomycin (Sigma); and 1% sterile dimethylsulfoxide (DMSO; Sigma) Other solutions required for growing or transfecting QT-6 cells included.
  • DNA/DEAE Mix 450 ⁇ l TBS, 450 ⁇ l DEAE Dextran (Sigma), and 100 ⁇ l of DNA (4 ⁇ g) in TE, where the DNA includes GlyT-1a, GlyT-1b , GlyT-1c, or GlyT-2, in a suitable expression vector
  • PBS Standard phosphate buffered saline, pH 7.4 including 1 mM CaCI 2 and 1 mM MgCI 2 sterilized through 0.2 ⁇ filter.
  • TBS One ml of Solution B, 10 ml of Solution A; brought to 100 ml with distilled H 2 0; filter-sterilized and stored at 4°C.
  • IE 0.01 M Tris, 0.001 M EDTA, pH 8.0.
  • DEAE dextran Sigma, #D-9885.
  • a stock solution was prepared consisting of 0.1% (1 mg/ml) of the DEAE dextran in TBS. The stock solution was filter sterilized and frozen in 1 ml aliquots.
  • Chloroquine Sigma, #C-6628. A stock solution was prepared consisting of 100 mM chloroquine in H 2 0. The stock solution was filter-sterilized and stored in 0.5 ml aliquots, frozen.
  • Solution B M00)Q The solution was adjusted to pH 7.5 with HCI, brought to 100.0 ml with distilled H 2 0, and filter-sterilized and stored at room temperature.
  • the solution was brought to 100 ml with distilled H 2 0, and filter-sterilized; the solution was then stored at room temperature.
  • HBSS 150 mM NaCI, 20 mM HEPES, 1 mM CaCI 2 , 10 mM glucose, 5 mM KCI, 1 mM MgCI 2 « H 2 0; adjusted with NaOH to pH 7.4. Standard growth and passaging procedures used were as follows: Cells were grown in
  • rat GlyT-2 (rGlyT-2) clone used contains the entire sequence of rGlyT-2 cloned into pBluescnpt SK+(Stratagene) as an Eco Rl - Hind III fragment, as described in Liu et al , J Biol Chem 268.
  • GlyT-2 was then subcloned into the pRc/RSV vector as follows A PCR fragment corresponding to nucleotides 208 to 702 of the rGlyT-2 sequence was amplified by PCR using the oiigonucleotide 5'GGGGGAAGCTTATGGATTGCAGTGCTCC 3' as the 5' primer and the oiigonucleotide
  • This cDNA encoding GlyT-1a actually contained the first 17 nucleotides (corresponding to the first 6 ammo acids) of the GlyT-1a sequence from rat
  • the 5' region of hGlyT-1a from nucleotide 1 to 212 was obtained by rapid amplification of cDNA end using the 5' RACE system supplied by Gibco BRL (Gaithersburg, MD)
  • the gene specific primer 5' CCACATTGTAGTAGATGCCG 3' corresponding to nucleotides 558 to 539 of the hGlyT-1a sequence was used to prime cDNA synthesis from human brain mRNA, and the gene specific primer 5' GCAAACTGGCCGAAGGAGAGCTCC 3', corresponding to nucleotides 454 to 431 of the hGlyT-1a sequence, was used for PCR amplification Sequencing of this 5' region of GlyT-1a confirmed that the
  • the human GlyT-1b (hGlyT-1b) clone used contains the sequence of hGlyT-1b from nucleotide position 213 to 2274 cloned into the pRc/CMV vector as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol . 4JS, 608-617, 1994
  • the human GtyT-1c (hGlyT-1c) clone used contains the sequence of hGlyT-1c from nucleotide position 213 to 2336 cloned into the pRc/CMV vector (Invitrogen) as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol.. 45, 608-617, 1994
  • the Hind lll - Xba fragment of hGlyT-1c from this clone was then subcloned into the pRc/RSV vector
  • Transfection experiments were performed with GlyT-1c in both the pRc/RSV and pRc/CMV expression vectors The following four day procedure for the tranfections was used. On day 1, QT-6 cells were plated at a density of 1 x 10 6 cells in 10 ml of complete QT- 6 medium in 100 mm dishes
  • the media was aspirated and the cells were washed with 10 ml of PBS followed by 10 ml of TBS
  • the TBS was aspirated, and then 1 ml of the DEAE/DNA mix was added to the plate
  • the plate was swirled in the hood every 5 minutes.
  • 8 ml of 80 ⁇ M chloroquine, in QT-6 medium was added and the culture was incubated for 2.5 hours at 37"C and 5% C0 2
  • the medium was then aspirated and the cells were washed two times with complete QT-6 media, then 100 ml complete QT-6 media was added and the cells were returned to the incubator
  • This example illustrates a method for the measurement of glycine uptake by transfected cultured cells
  • Transient GlyT-transfected cells grown in accordance with Example 7 were washed three times with HEPES buffered saline (HBS)
  • HBS HEPES buffered saline
  • the cells were then incubated 10 minutes at 37°C, after which a solution was added containing 50 nM [ 3 H]glyctne (17 5 Ci/mmol) and either (a) no potential competitor, (b) 10 mM nonradioactive glycine or (c) a concentration of a candidate drug
  • a range of concentrations of the candidate drug was used to generate data for calculating the concentration resulting in 50% of the effect (e.g., the IC 50 s, which are the concentrations of drug inhibiting glycine uptake by 50%)
  • the cells were then incubated another 10 minutes at 37°C, after which the cells were aspirated and washed three times with ice-cold HBS
  • the cells were harvested, s ⁇ ntillant was added to the cells, the cells
  • This example illustrates binding assays to measure interaction of compounds with the glycine site on the NMDA receptor
  • Direct binding of [ 3 H]glycine to the NMDA-giycine site was performed according to the method of Grimwood et al., Molecular Pharmacology. 41, 923-930 (1992); Yoneda et al., i Neurochem. 62, 102-112 (1994).
  • the third binding test was operated to identify antagonists as follows 100 ⁇ g of membranes were added to wells of a 96-well plate, along with glutamate (10 ⁇ M) and glycine (200 nM) and various concentrations of the ligand to be tested
  • the assay was started by the addition of 5 nM [ 3 H]MK-801 (239 Ci/mmol), which binds to the ion channel associated with NMDA receptors
  • the final volume of the assay was 200 ⁇ l
  • Bound radioactivity was separated from free by filtration, using a TOMTEC harvester Antagonist activity was indicated by decreasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand
  • the third binding test was operated to identify agonists by performing the test as above, except that the concentration of glycine was 200 nM Agonist activity was indicated by increasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand Example 10 - Assay of Calcium Flux
  • This example illustrates a protocol for measuring calcium flux in primary neuronal calls
  • the calcium flux measurement is performed in primary neuronal cell cultures, which are prepared from rat fetal cortices dissected from pregnant rats using standard procedures and techniques that require sterile dissecting equipment, a microscope and defined medium
  • the protocol used was adapted from Lu et al , Proc Nat'l Acad. Sci USA. 88, 6289-6292 (1991) Defined medium is prepared in advance in accordance with the following recipe
  • tissue culture plates were treated with polylysine (100 ⁇ g/ml for at least 30 minutes at 37°C) and washed with distilled water Also, a metal tray containing two sets of sterile crude dissecting equipment (scissors and tweezers) and several sets of finer dissecting tools was autoclaved A pair of scissors and tweezers were placed into a sterile beaker with 70% alcohol and brought to the dissecting table A pet ⁇ dish with cold phosphate buffered saline (PBS) was placed on ice next to the place of dissection A pregnant rat (E15 or 16 on arrival from Hilltop Lab Animals (Scottdale, PA), E17 or 18 at dissection) was placed in a CO ⁇ dry ice chamber until it was unconscious The rat was removed, pinned to a backing, the area of dissection was swabbed with 70% alcohol, and skin was cut and removed from the area of interest A second pair of scissors was used to cut through and remove the pre
  • the cortical cultures for the standard calcium flux assay were grown in 24-well plates in the defined medium described above for 7 days and fed once with serum containing media (10% heat inactivated fetal calf serum, 06% glucose in MEM) by exchanging half of the medium Cultures were used after 12 days of incubation in vitro The cultures were rinsed three times with HCSS ( ⁇ e HEPES-buffered control salt solution, containing 120 mM NaCI, 54 mM KCI, 1 8 mM CaCI 2 25 mM HEPES, and 15 mM glucose, in HPLC water and adjusted to pH 7 4 by NaOH, which was also made in HPLC water) In the third wash, the culture was incubated at 37"C for

Landscapes

  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Pain & Pain Management (AREA)
  • Psychiatry (AREA)
  • Virology (AREA)
  • Psychology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • AIDS & HIV (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Hospice & Palliative Care (AREA)
  • Molecular Biology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Hydrogenated Pyridines (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Pyrrole Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

Cette invention concerne un produit pharmaceutique destiné au traitement de troubles neurologiques ou neuropsychiatriques. Ledit produit pharmaceutique comprend un composé ayant les formules (I) et (II) ou un sel pharmaceutiquement acceptable dudit composé.
EP97926837A 1996-05-31 1997-05-29 Produit pharmaceutique pour le traitement de troubles neurologiques et neuropsychiatriques Withdrawn EP0918767A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US655847 1991-02-15
US65584796A 1996-05-31 1996-05-31
US80768197A 1997-02-27 1997-02-27
US807681 1997-02-27
PCT/US1997/009346 WO1997045423A1 (fr) 1996-05-31 1997-05-29 Produit pharmaceutique pour le traitement de troubles neurologiques et neuropsychiatriques

Publications (2)

Publication Number Publication Date
EP0918767A1 true EP0918767A1 (fr) 1999-06-02
EP0918767A4 EP0918767A4 (fr) 2000-04-26

Family

ID=27097055

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97926837A Withdrawn EP0918767A4 (fr) 1996-05-31 1997-05-29 Produit pharmaceutique pour le traitement de troubles neurologiques et neuropsychiatriques

Country Status (5)

Country Link
EP (1) EP0918767A4 (fr)
JP (2) JP4403212B2 (fr)
AU (1) AU737095B2 (fr)
CA (1) CA2255727A1 (fr)
WO (1) WO1997045423A1 (fr)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU737095B2 (en) * 1996-05-31 2001-08-09 Nps Pharmaceuticals, Inc. Pharmaceutical for treating of neurological and neuropsychiatric disorders
AU3254499A (en) * 1998-03-06 1999-09-20 Janssen Pharmaceutica N.V. Glycine transport inhibitors
TW555757B (en) 1998-07-31 2003-10-01 Akzo Nobel Nv Aminomethylcarboxylic acid derivatives
HN1999000149A (es) 1998-09-09 2000-01-12 Pfizer Prod Inc Derivados de 4,4-biarilpiperidina
UA75051C2 (en) * 1999-09-03 2006-03-15 Syngenta Participations Ag Tetrahydropiridines as pesticides, a composition, a method for the preparation thereof and a method of controlling pests
TWI243173B (en) 1999-11-17 2005-11-11 Akzo Nobel Nv Spiro[2H-1-benzopyran-2,4'-piperidine] derivatives
US7049343B2 (en) 2000-09-08 2006-05-23 Merck & Co., Inc. Substituted hydrazine derivatives
CA2422044A1 (fr) * 2000-09-14 2002-03-21 Gliatech, Inc. Composes azotes et leur utilisation comme inhibiteurs de transport de la glycine
AR032653A1 (es) * 2001-02-09 2003-11-19 Telik Inc Inhibidores heterociclicos del trasportador de glicina 2 composiciones farmaceuticas, uso y metodos.
EP1434865A2 (fr) 2001-07-24 2004-07-07 Genset S.A. Nouveaux variants et exons du transporteur glyt1
WO2003016274A2 (fr) * 2001-08-21 2003-02-27 Sepracor, Inc. Piperidines 2-substitue, ligands pour des recepteurs et des transporteurs de monoamines
WO2005100301A1 (fr) * 2004-03-31 2005-10-27 Eli Lilly And Company Derives de la 2-aryloxyethyl glycine et leur utilisation comme inhibiteurs du transport de la glycine
EP1843767B1 (fr) * 2005-01-18 2009-07-08 F. Hoffmann-Roche AG Derives de phenylmethanone disubstitues en 2, 5 en tant qu'inhibiteurs du transporteur 1 de la glycine (glyt-i) pour le traitement de troubles neurologiques et neuropsychiatriques
EA014959B3 (ru) * 2006-06-28 2014-10-30 Амген Инк. Ингибиторы глицинового переносчика-1
CA2707305A1 (fr) 2007-12-12 2009-06-18 Amgen Inc. Inhibiteurs du transporteur de glycine 1
JP2011513354A (ja) * 2008-03-05 2011-04-28 ノイロサーチ アクティーゼルスカブ 新規な４−ベンズヒドリル−テトラヒドロ−ピリジン誘導体及びモノアミン神経伝達物質再取り込み阻害薬としてのその使用
CN110372571B (zh) * 2018-04-12 2022-11-15 中国科学院大连化学物理研究所 一种2-(2,2-二芳基乙基)-环胺衍生物或盐及合成和应用与组合物

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5063235A (en) * 1990-04-30 1991-11-05 A. H. Robins Company, Inc. 4-[(diaryl)hydromethyl]-1-piperidinealkanols and esters and carbamates thereof useful in the treatment of allergic disorders

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0686463B2 (ja) * 1988-07-01 1994-11-02 明治製菓株式会社 新規セフェム化合物、その製造法及び抗菌剤
JPH03264562A (ja) * 1989-05-22 1991-11-25 Hokuriku Seiyaku Co Ltd ピペリジン誘導体
CA2015949A1 (fr) * 1989-05-22 1990-11-22 Yasuo Ito Derive de piperidine, methode de preparation et compose pharmaceutique le contenant
JPH03204885A (ja) * 1989-12-28 1991-09-06 Meiji Seika Kaisha Ltd 新規セファロスポリン系化合物
US5057524A (en) * 1990-02-08 1991-10-15 A. H. Robins Company Incorporated 4-[diaryl)hydroxymethyl]-1-piperidinealkylcarboxylic acids, salts and esters useful in the treatment of allergic disorders
JPH0517443A (ja) * 1991-07-11 1993-01-26 Hokuriku Seiyaku Co Ltd ピペリジン誘導体
AU737095B2 (en) * 1996-05-31 2001-08-09 Nps Pharmaceuticals, Inc. Pharmaceutical for treating of neurological and neuropsychiatric disorders

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5063235A (en) * 1990-04-30 1991-11-05 A. H. Robins Company, Inc. 4-[(diaryl)hydromethyl]-1-piperidinealkanols and esters and carbamates thereof useful in the treatment of allergic disorders

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
IWASAKI, NOBUHIKO ET AL: "Amphoteric drugs. I. Synthesis and antiallergic activity of [4-(diphenylmethoxy)piperidinoÜ-, [4-(diphenylmethyl)piperazinylÜ- and [4-(diphenylmethylene)piperidinoÜalkanoic acid derivatives" CHEM. PHARM. BULL. (1994), 42(11), 2276-84, XP002128280 *
MURAMATSU, SAWANISHI, IWASAKI, KAKIUCHI, OHASHI, KATO, ITO: 'Study on Zwitter-Ionization of Drugs. II.' CHEM. PHARM. BULL. vol. 41, no. 11, 1993, pages 1987 - 1993 *
See also references of WO9745423A1 *

Also Published As

Publication number Publication date
WO1997045423A1 (fr) 1997-12-04
CA2255727A1 (fr) 1997-12-04
JP2001500107A (ja) 2001-01-09
JP4403212B2 (ja) 2010-01-27
EP0918767A4 (fr) 2000-04-26
AU737095B2 (en) 2001-08-09
JP2009149663A (ja) 2009-07-09
AU3151097A (en) 1998-01-05

Similar Documents

Publication Publication Date Title
CA2254833C (fr) Produit pharmaceutique pour le traitement de troubles neurologiques et neuropsychiatriques
US6191165B1 (en) Pharmaceutical for treatment of neurological and neuropsychiatric disorders
AU737095B2 (en) Pharmaceutical for treating of neurological and neuropsychiatric disorders
JP2005519048A (ja) ＧｌｙＴ１トランスポーター阻害剤ならびに神経病学および神経精神病学的障害の治療におけるその使用
WO2004113280A1 (fr) Inhibiteurs de transporteurs de glyt1 et leurs utilisations dans le traitement de troubles neurologiques et neuropsychiatriques
US6001854A (en) Pharmaceutical for treating of neurological and neuropsychiatric disorders
JP2022065012A (ja) Ｄ－アミノ酸オキシダーゼ（ｄａａｏ）阻害剤としての新規な置換ベンゾイミダゾール誘導体
WO2004002483A1 (fr) 3- et 4- aminomethylpiperidines substituees utilisees comme beta-secretase dans le traitement de la maladie d'alzheimer
EA000380B1 (ru) 4-аминотетрагидробензизоксазоловые или -изотиазоловые соединения, их применение и фармацевтическая композиция на их основе
JP2011510022A (ja) Ｎ−及びｏ−置換型の４−［２−（ジフェニルメトキシ）−エチル］−１−［（フェニル）メチル］ピペリジンアナログ、及びそれを用いたｃｎｓ障害を治療する方法
EP1440075A1 (fr) Nouveaux derives amides heteroaromatiques de 3beta-amino azabicyclooctane, leur procede de preparation et leurs applications en therapeutique
NZ233002A (en) 3-(aminoalkyl)benzothiopyran derivatives and pharmaceutical compositions
EP0557305B1 (fr) Derives de (2-thienyl) alkylamine possedant des proprietes neuroprotectrices
MXPA03001311A (es) Profarmacos para ligandos receptores de n-metil-d-aspartato.
RU2465273C2 (ru) ГЕТЕРОЦИКЛИЧЕСКИЕ НИЗКОМОЛЕКУЛЯРНЫЕ sAPP-МИМЕТИКИ, ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ, СПОСОБЫ ПОЛУЧЕНИЯ И ПРИМЕНЕНИЯ
AU2001285894A1 (en) Prodrugs to NMDA receptor ligands
KR20010033998A (ko) 신경학적 질병 치료용 1,4-디아자시클로헵탄 유도체
MXPA00006078A (en) 1,4-diazacycloheptane derivatives
JPH1149718A (ja) 新規なシクロペンテノン誘導体及びその用途

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19981221

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ALLELIX NEUROSCIENCE INC.

RIC1 Information provided on ipc code assigned before grant

Free format text: 7C 07D 401/02 A, 7C 07D 401/14 B, 7C 07D 405/02 B, 7C 07D 405/14 B, 7C 07D 211/40 B, 7C 07D 211/34 B, 7C 07D 211/54 B, 7A 61K 31/445 B, 7C 07D 211/14 B

A4 Supplementary search report drawn up and despatched

Effective date: 20000314

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20001215

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20030925