EP0840792B1 - (s)-hydroxynitrillyase aus hevea brasiliensis - Google Patents
(s)-hydroxynitrillyase aus hevea brasiliensis Download PDFInfo
- Publication number
- EP0840792B1 EP0840792B1 EP96925698A EP96925698A EP0840792B1 EP 0840792 B1 EP0840792 B1 EP 0840792B1 EP 96925698 A EP96925698 A EP 96925698A EP 96925698 A EP96925698 A EP 96925698A EP 0840792 B1 EP0840792 B1 EP 0840792B1
- Authority
- EP
- European Patent Office
- Prior art keywords
- protein
- hnl
- dna sequence
- nitrile
- hydroxy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/002—Nitriles (-CN)
- C12P13/004—Cyanohydrins
Definitions
- One of the enzymes used is the (S) -hydroxynitrile lyase (Hnl) from Hevea brasiliensis , which catalyzes not only the formation of aromatic but also the formation of aliphatic (S) -cyanohydrins from the corresponding aldehydes or ketones with HCN or HCN donors (EP-A- 0 632 130).
- Hnl aliphatic lyases
- Hnl is made from the leaves of the Hevea brasiliensis according to Selmar (Physiologia plantarum 75 : 97-101, 1989) and has a molecular mass of 46 kDa (JE Poulton in: Cyanide Compounds in Biology [Ciba Foundation Symposium 140), pp 67-91, 1988).
- the enzyme isolated in this way is not pure enough to obtain specific anti-Hnl antibodies or to determine amino acid sequences of the Hnl protein. All attempts to isolate pure HNL enzyme using other common chromatographic purification steps failed. No Hnl activity was found in the column eluate in all attempts to obtain the enzyme in pure form by means of ion exchange chromatography using sodium chloride gradient elution.
- the invention accordingly relates to a (S) -hydroxynitrile lyase in purified and isolated form.
- the Hnl isolated and purified in this way has a molecular mass of 30 ⁇ 1 kDa, a specific activity of 19 IU / mg protein and contains the following amino acid partial sequences:
- the cDNA contains the entire coding region of the hnl gene with an open reading frame for a polypeptide of 257 amino acids.
- the molecular mass was calculated from the amino acid sequence of the coding protein derived from the DNA sequence determined to be 29,227 Da.
- the invention accordingly furthermore relates to a DNA sequence which codes for (S) -hydroxynitrile lyase or is more than 85% identical to this sequence in the region coding for hydroxynitrile lyase. It was obtained from mRNA by reverse transcription.
- the cDNA forms the basis for the extraction of enzyme preparations by heterologous expression in different host organisms.
- the present invention accordingly further relates to recombinant proteins which can be produced by heterologous expression of the hnl gene (cDNA) from Hevea brasiliensis in suitable microorganisms, preferably in eukaryotic microorganisms.
- cDNA hnl gene
- Hnl protein which was produced by heterologous expression of the Hevea brasiliensis hnl gene (cDNA) in eukaryotic microorganisms, such as, for example, in Saccharomyces cerevisiae or Pichia pastoris , was clearly isolated from the natural Hevea brasiliensis plant Hnl protein differs.
- the main characteristic is that the specific activity of such recombinant Hnl protein is significantly higher than the specific activity of the purified natural protein from Hevea brasiliensis .
- the differences are also manifested in the electrophoretic behavior of the proteins.
- a QAE-Sepharose FF column (XK 16, 21 cm, Pharmacia, Uppsala, Sweden) was equilibrated with start buffer I (10 mM histidine-sulfuric acid pH 6.5, 10% sorbitol). After sample application, the column was washed with at least 50 ml of start buffer. A linear gradient from 0 to 0.6 M (NH 4 ) 2 SO 4 in start buffer I was used for elution. Fractions (10 ml) were collected and tested for Hnl activity, and fractions with Hnl activity were pooled.
- start buffer I 10 mM histidine-sulfuric acid pH 6.5, 10% sorbitol
- a Biogel P150 column (26 x 34 cm, Biorad, Hercules, California) was used 100 mM potassium phosphate buffer pH 6.5 equilibrated. The volume of the Enzyme solution was removed by ultrafiltration (exclusion limit 10,000 Da, Amicon Inc., Beverly, MA). The elution took place at 100 mM potassium phosphate buffer pH 6.5 at room temperature, fractions (6 ml) were collected. The Hnl protein purified in this way showed in the SDS polyacrylamide Gel electrophoresis only a single band in one Molecular weight of 30 ⁇ 1 kDa and had a specific activity of 19 IU / mg.
- the Hnl enzyme activity was characterized by the formation of benzaldehyde racemic mandelonitrile at 25 ° C and pH 5.0 tracked.
- 50 ⁇ l Enzyme solution was mixed with 900 ul 50 mM sodium citrate buffer pH 5.0 and the activity test by adding 100 ⁇ l substrate solution (37.5 mM Mandelonitrile in 10 mM sodium citrate buffer pH3.5, freshly prepared daily) started.
- substrate solution 37.5 mM Mandelonitrile in 10 mM sodium citrate buffer pH3.5, freshly prepared daily
- mRNA was prepared from young leaves of a 10-year-old tree of the genus Hevea brasiliensis from the botanical garden of the University of Graz according to standard methods (Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, New York, 1990).
- the cDNA gene bank was produced using and following the instructions in the documents of the "Zap-cDNA Synthesis Kit” and the "Gigapack II Gold Packaging Extract” (Stratagene Cloning Systems, La Jolla, CA, USA).
- phages from the cDNA library were examined in an immuno-screening according to standard methods using a polyclonal anti-Hnl antiserum (rabbit).
- the specifically bound antibody was visualized using a detection system (Boehringer Mannheim Biochemica) based on alkaline phosphatase and the chromogenic substrate NBT (nitroblue tetrazolium) / X-phosphate (5-bromo-4-chloro-3-indolyl phosphate; 4-toluidine salt) , Mannheim, Germany).
- the insert from the phage DNA was converted into the corresponding recombinant plasmid (pHNL-100) according to the protocol "In vivo Excision of pBluescript from Uni-Zap XR" (Stratagene Cloning Systems, La Jolla, CA, USA) ).
- the size of the cDNA insert was 1100 bp.
- pHNL-100 was transformed into E.coli SOLR (Stratagene Cloning Systems, La Jolla, CA, USA).
- DNA sequencing was carried out according to the chain termination method of Sanger et al. (Sanger et al., PNAS, 74: 5463-5467, 1977) using the "DyeDeoxy Terminator Cycle Sequencing Kit” (Applied Biosystems Inc., Foster City, CA, USA) and an automatic "DNA Sequencer 373A” (Applied Biosystems ) carried out. From the first sequence data it could be seen that the plasmid pHNL-100 contains an incomplete cDNA insert. The missing part in the 5 'region was supplemented as described below: Phage DNA was isolated from the H.
- brasiliensis cDNA gene bank and used as a template for a two-stage PCR with two gene-specific primers (primer 1: CCTCCAAGAACGTCAACAAG; primer 2: CATCAAATGAGCCAATCTCC) and one Vector-specific primers (T3: AATTAACCCTCACTAAAGGG) were used.
- PCR cycle 1 only primer 1 and 40 mg cDNA library ( H. brasiliensis ) DNA
- PCR cycle 2 Primer 2 and T3 and 1/10 volume from PCR cycle 1 as DNA template.
- the DNA obtained from PCR cycle 2 was cut with Eco RI and Styl and the resulting fragment was cloned into the corresponding region of the plasmid pHNL-100 ( Eco RI and Styl cut).
- pHNL-101 The insert in the resulting construct called pHNL-101 was completely sequenced. Analysis of the DNA sequence revealed an open reading frame starting with ATG at position 1 and ending with a TGA stop codon at position 772, which codes for a protein of 29,227 Da. The size of this protein correlates with the determined molecular weight of the hydroxynitrile lyase (Hnl) isolated from leaves of H. brasiliensis . The DNA sequence coding for this protein was determined as the hnl gene (cDNA) from H. brasiliensis .
- Hnl hydroxynitrile lyase isolated from leaves of H. brasiliensis
- coli strain Top10 (Invitrogen Corp., San Diego, CA, USA).
- Protein production was induced by adding 1mM IPTG (isopropyl- ⁇ -D-thiogalactopyranoside) and the culture was continued for 3 hours after the addition of 1% glucose under the same conditions.
- IPTG isopropyl- ⁇ -D-thiogalactopyranoside
- the cells were then harvested by centrifugation and taken up in 4 ml digestion buffer (50 mM potassium phosphate pH 7.4, 1 mM EDTA [ethylenediaminetetraacetate], 1 mM PMSF [phenylmethylsulfonyl fluoride], 5% glycerol).
- the cells were disrupted under ice cooling using an ultrasonic disintegrator (Labsonic 2000, Braun) with 45 watts for 3 minutes.
- the digestion solution was separated into soluble and insoluble components by centrifugation for 15 min at 27000 g and 4 ° C. in a Sorvall SS-34 rotor and a Sorvall RC-5 centrifuge (DuPont Company, Wilmington, Delaware, USA).
- the soluble fraction contained protein with hydroxynitrile lyase activity (0.15 U / mg protein). Analysis of the proteins in the soluble and insoluble fractions by SDS polyacrylamide gel electrophoresis and Western blotting revealed that only about 1% of the total heterologous immunoreactive Hnl protein produced was present in the active soluble fraction, while 99% of the immunoreactive Hnl protein was in the insoluble fraction in Form of inactive "inclusion bodies" were to be found. Proteins of the insoluble fraction were solubilized by adding 20 ml denaturing buffer (3.5 M urea, 0.1 M Tris; pH 8.0) and the insoluble constituents were removed by centrifugation (15 min at 27000 g at 4 ° C.).
- 20 ml denaturing buffer 3.5 M urea, 0.1 M Tris; pH 8.0
- the protein solution obtained was first dialyzed in several stages against buffer 1 (50 mM potassium phosphate pH 7.4, 1 mM EDTA, 1M urea) and 5 times against buffer 2 (50 mM potassium phosphate pH 7.4, 1 mM EDTA) at 4 ° C.
- the solubilized and renatured protein preparation thus obtained showed a specific Hnl activity of 0.8 to 1.4 IU / mg protein.
- the resulting plasmid designated pHNL-300, was checked by sequencing and further transformed into S. cerevisiae laboratory strain W303 D (Hill et al., Yeast, 2: 163-167, 1986). Transformants were on minimal medium without leucine (6.7 g / l yeast nitrogen base w / o amino acids [Difco, USA], 20 g / l glucose, 20 ml / l amino acid concentrate without leucine [adenine 1.0 g / l, methionine 1.0 g / l, arginine 1.0 g / l, threonine 15.0 g / l, histidine 1.0 g / l, tryptophan 1.0 g / l, uracil 2.0 g / l, lysine 11.5 g / l]).
- the cells were slurried in 5 ml digestion buffer (as in Example 5) and, according to the “glass ball method” (Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersience, New York, 1990), in a Merckenschlag (Fa Braun, Mels Institute, FRG) open-minded.
- a hydroxynitrile lyase activity of 4.62 IU / mg protein was detected in the soluble cytosolic fraction.
- Controls were yeast transformants with the empty plasmid pMA91, where no cytosolic hydroxynitrile lyase activity could be detected.
- the aqueous protein preparations thus prepared were stored at -20 ° C. Another possibility for permanent storage of the protein preparation was to freeze-dry the preparation after removal of all low-molecular substances (dialysis at 4 ° C. against distilled water) or digestion of the yeast cells after suspension in water (Benchtop 3L, VIRTIS Co., Inc., Gardiner, NY, USA). The activity of an enzyme sample resolubilized in digestion buffer (as in Example 5) remained almost 100%.
- the hnl gene (cDNA) was cloned as an Eco RI fragment from the plasmid pHNL-104 into the P. pastoris expression vector pHIL-D2 linearized with Eco RI (Invitrogen Corp., San Diego, CA, USA).
- the construct named pHNL-400 was checked by sequencing.
- the transformation of the host strain GS115 (His4-), selection of the histidine prototrophs and at the same time methanol utilization auxotrophs was carried out according to the documents of the " Pichia Expression Kit” system (Invitrogen Corp., San Diego, CA, USA). Among 20 positive transformants, two could be identified which produced the hydroxynitrile lyase in high concentration intracellularly.
- the cells for the protein production were also grown according to the protocols of the "Pichia Expression Kit".
- the protein preparations produced in this way could be stored in the same way as described in Example 6 without any significant loss of activity.
- a highly purified enzyme preparation can be obtained in a simple manner, which practically only showed a band at 30 ⁇ 1 kDa in SDS-polyacrylamide gel electrophoresis.
- Such preparations of recombinant Hnl obtained by overexpression in P. pastoris showed specific activity in the range from 41 to 46 IU / mg protein.
- Hnl protein preparations were analyzed by isoelectric focusing with gels 3-9 (Phast System, Pharmacia, Uppsala, Sweden) or by native polyacrylamide gel electrophoresis (7.5% polyacrylamide, Tris-Glycine buffer pH 8.8). It was found that different bands were found in the different preparations. With isoelectric focusing, Hnl from H.brasiliensis showed a band at an isoelectric point of 4.1. In the recombinant proteins from S.cerevisiae and P.pastoris , two to three closely adjacent bands were found, which were located somewhat further towards positions corresponding to basic regions. With recombinant Hnl from P.pastoris a predominant part was to be found in these shifted positions.
- these proteins have a so-called catalytic triad with Asp or Ser or Cys as the nucleophilic part of the triad, and Asp / Glu and His.
- Asp or Ser or Cys as the nucleophilic part of the triad
- Asp / Glu and His Asp / Glu and His.
- a mutant, antisense end primer, which also overlaps the gene-specific restriction interface Mun I required for subcloning, and a vector-specific primer (T3) (Ausubel et al., Current.) Were used to change the amino acid positions 79, 80 and 81 Protocols in Molecular Biology, Vol. 1 & 2, Greene Publishing Associates and Wiley-Intersience, New York, 1990).
- a special PCR method was used to change amino acid positions 207 and 235.
- a phosphorylated mutant primer in the sense direction, a gene-specific primer which also overlaps the restriction interface Ce / II necessary for subcloning and a further vector-specific primer (T7) were used (Michael SF, BioTechniques 16, 410-412, 1994).
- the PCR products were purified and subcloned using standard methods.
- the resulting mutant hnl genes (cDNA) in the plasmids pHNL-105 - pHNL-109 were cloned into the expression plasmid pMA91 (pHNL-302 - pHNL-306) and the mutant proteins were produced in Saccharomyces cerevisiae as described in Example 6.
- the hydroxynitrile lyase activity was determined in the soluble cytosolic fraction, with the result that each of the 5 mutations carried out led to the complete inactivation of the enzyme activity. Participation of these amino acids in direct enzymatic catalysis can be derived from this.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
- Peptides Or Proteins (AREA)
- Chemical Or Physical Treatment Of Fibers (AREA)
- Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
- Detergent Compositions (AREA)
Description
Die so isolierte und gereinigte Hnl besitzt eine molekulare Masse von 30 ± 1 kDa, eine spezifische Aktivität von 19 IU/mg Protein und beinhaltet folgende Aminosäure-Teilsequenzen:
Ein weiterer Gegenstand der Erfindung ist demnach eine DNA-Sequenz, die für (S)-Hydroxynitrillyase kodiert oder mit dieser Sequenz im für Hydroxynitrillyase kodierenden Bereich zu über 85 % identisch ist. Sie wurde durch reverse Transkription aus mRNA gewonnen. Die cDNA stellt die Basis für die Gewinnung
von Enzympräparationen durch heterologe Expression in verschiedenen Wirtsorganismen dar.
Die vorliegende Erfindung betrifft demnach weiters rekombinante Proteine, herstellbar durch heterologe Expression des hnl-Gens (cDNA) aus Hevea brasiliensis in geeigneten Mikroorganismen, vorzugsweise in eukaryotischen Mikroorganismen.
Eine Analyse der DNA-Sequenz ergab einen offenen Leserahmen beginnend mit ATG bei Position 1 und endend mit einem TGA Stoppkodon bei Position 772, der für ein Protein von 29.227 Da kodiert. Die Größe dieses Proteins korreliert mit dem ermittelten Molekulargewicht der aus Blättern von H. brasiliensis isolierten Hydroxynitril Lyase (Hnl). Die für dieses Protein kodierende DNA-Sequenz wurde als hnl Gen (cDNA) von H. brasiliensis festgelegt.
3' Bereich: PCR mit Primer P51-HX (CCGCTCGAGAAGCTTCAAAGAAGTCAATTATAG) und Primer P51-3.2 (CACGCTTCTGAGGGAAAAT), Schneiden der DNA aus der PCR mit XhoI und CelII und einklonieren des Fragments in das Plasmid pHNL-101 (Xhol und CelII geschnitten). Das entstandene Plasmid wurde pHNL-102 benannt.
5' Bereich: PCR mit Primer P51-EN (GGAATTCCATGGCATTCGCTCATTTT) und Primer P51-3.1A (CCTCCAAGAACGTCAACAAG), Schneiden der DNA aus der PCR mit EcoRI und Styl und einklonieren des Fragments in das Plasmid pHNL-102 (EcoRI und Styl geschnitten). Das entstandene Plasmid mit der Bezeichnung pHNL-103 wurde durch Sequenzierung überprüft.
Das Ncol - HindIII Fragment aus pHNL-103 wurde im letzten Schritt in den E.coli Expressionsvektor pSE420 (Invitrogen Corp., San Diego, CA, U.S.A.) kloniert. Das erhaltene Plasmid pHNL-200 wurde durch Sequenzierung überprüft und in den E.coli Stamm Top10' (Invitrogen Corp., San Diego, CA, U.S.A.) transformiert.
Eine entsprechende Transformante wurde in 100 ml 2xYT Medium (10g/l NaCI, 10 g/l Hefe Extrakt, 16 g/l Bactotryptone), supplementiert mit 100mg/l Ampicillin-Na Salz, in einem Schikanen-Schüttelkolben bei 37 °C und 160 Upm bis zu einer optischen Dichte von OD600 = 0.5 gezüchtet. Die Proteinproduktion wurde durch Zugabe von 1mM IPTG (Isopropyl-β-D-thiogalaktopyranosid) induziert und die Kultur nach Zusatz von 1% Glukose für 3 h unter den gleichen Bedingungen weitergeführt. Die Zellen wurden anschließend durch Zentrifugation geerntet und in 4ml Aufschlußpuffer (50 mM Kaliumphosphat pH 7.4, 1mM EDTA [Ethylendiamintetraacetat], 1mM PMSF [Phenylmethylsulfonylfluorid], 5% Glycerin) aufgenommen. Der Aufschluß der Zellen erfolgte unter Eiskühlung mit einem Ultraschalldesintegrator (Labsonic 2000, Fa. Braun) mit 45 Watt über 3 min. Die Aufschlußlösung wurde durch Zentrifugation für 15 min bei 27000 g und 4 °C in einem Sorvall SS-34 Rotor und einer Sorvall RC-5 Zentrifuge (DuPont Company, Wilmington, Delaware, U.S.A.) in lösliche und unlösliche Bestandteile aufgetrennt. Die lösliche Fraktion enthielt Protein mit Hydroxynitrillyase Aktivität (0.15 U/mg Protein). Eine Analyse der Proteine in den löslichen und unlöslichen Fraktionen durch SDS Polyacrylamid Gelelektrophorese und Western Blotting ergab, daß nur etwa 1% des gesamten produzierten heterologen immunreaktiven Hnl Proteins in der aktiven löslichen Fraktion vorlag, während 99% des immunreaktiven Hnl Proteins in der unlöslichen Fraktion in Form von nicht aktiven "Einschlußkörpern" zu finden waren.
Proteine der unlöslichen Fraktion wurden durch Zugabe von 20 ml Denaturierungspuffer (3.5 M Harnstoff, 0.1M Tris; pH 8.0) solubilisiert und die unlöslichen Bestandteile durch Zentrifugation (15 min bei 27000 g bei 4 °C) entfernt. Die erhaltene Proteinlösung wurde in mehreren Stufen zuerst gegen Puffer1 (50 mM Kaliumphosphat pH 7.4, 1mM EDTA, 1M Harnstoff) und 5 mal gegen Puffer 2 (50 mM Kaliumphosphat pH 7.4, 1mM EDTA) bei 4 °C dialysiert. Die so erhaltene solubilisierte und renaturierte Proteinpräparation zeigte eine spezifische Hnl Aktivität von 0.8 bis 1.4 IU/mg Protein.
Das hnl Gen (cDNA) wurde als BamHI Fragment aus dem Plasmid pHNL-104 entnommen und in den mit BglII linearisierten Hefe-Expressionsvektor pMA91 (Kingsman et al., Methods in Enzymology, 185:329-341, 1990) kloniert. Das resultierende Plasmid mit der Bezeichnung pHNL-300 wurde durch Sequenzierung überprüft und weiter in den S. cerevisiae Laborstamm W303 D (Hill et al., Yeast, 2:163-167, 1986) transformiert. Transformanten wurden auf Minimalmedium ohne Leucin (6.7 g/l Yeast Nitrogen Base w/o Amino Acids [Fa. Difco, U.S.A], 20 g/l Glukose, 20 ml/l Aminosäurekonzentrat ohne Leucin [Adenin 1.0 g/l, Methionin 1.0 g/l, Arginin 1.0 g/l, Threonin 15.0 g/l, Histidin 1.0 g/l, Tryptophan 1.0 g/l, Uracil 2.0 g/l, Lysin 11.5 g/l]) gezüchtet. Für die Proteinproduktion wurden die Zellen in einem Schikanenerlenmeyerkolben in 100 ml leucinfreiem Minimalmedium bei 30°C und 150 Upm bis zu einer optischen Dichte von OD600 = 5.0 gezüchtet und durch Zentrifugation geerntet. Die Zellen wurden in 5 ml Aufschlußpuffer (wie bei Beispiel 5) aufgeschlämmt und nach der "Glaskugelmethode" (Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersience, New York, 1990) in einem Merckenschlager (Fa. Braun, Melsungen, BRD) aufgeschlossen. In der löslichen cytosolischen Fraktion konnte eine Hydroxynitrillyaseaktivität von 4.62 IU/mg Protein nachgewiesen werden. Als Kontrolle dienten Hefe-Transformanten mit dem leeren Plasmid pMA91, wo keine cytosolische Hydroxynitrillyaseaktivität nachgewiesen werden konnte. Die so hergestellten wäßrigen Proteinpräparationen wurden bei -20°C gelagert. Eine weitere Möglichkeit für eine dauerhafte Lagerung der Proteinpräparation bestand darin, das Präparat nach Entfernung sämtlicher niedermolekularer Substanzen (Dialyse bei 4°C gegen destilliertes Wasser) bzw. Aufschluß der Hefezellen nach Suspension in Wasser gefrierzutrocknen (Benchtop 3L, VIRTIS Co., Inc., Gardiner, NY, U.S.A.). Die Aktivität einer in Aufschlußpuffer (wie in Beispiel 5) resolubilisierten Enzymprobe blieb dabei nahezu zu 100% erhalten.
Es war auch weiters leicht möglich, ausgehend von den wäßrigen Proteinpräparationen hochgereinigtes rekombinantes Hnl Protein herzustellen. Nach den gleichen Verfahren wie in Beispiel 1 beschrieben, konnte auf einfache Weise eine Enzympräparation, die bei SDS-Polyacrylamid Gelelektrophorese praktisch nur mehr eine Bande bei 30 ± 1 kDa zeigt, gewonnen werden. Solche Präparationen von rekombianter, durch Überexpression in S.cerevisiae gewonnener Hnl zeigten spezifische Aktivität von 22 bis 28 IU/mg Protein.
Die Transformation des Wirtstammes GS115 (His4-), Selektion der Histidin Prototrophen und gleichzeitig Methanol-Verwertungs Auxotrophen erfolgte nach den Unterlagen des "Pichia Expression Kit" Systems (Invitrogen Corp., San Diego, CA, U.S.A.). Unter 20 positiven Transformanten konnten zwei identifiziert werden, welche die Hydroxynitrillyase in hoher Konzentration intrazellulär produzierten. Die Anzucht der Zellen für die Proteinproduktion erfolgte ebenfalls nach den Protokollen des "Pichia Expression Kit". Die durch Zentrifugation geernteten Zellen wurden in Aufschlußpuffer (wie Beispiel 5) zu einer optischen Dichte von OD600 = 50.0 suspendiert und nach der "Glaskugelmethode" (wie bei Beispiel 6) aufgeschlossen. In der löslichen cytosolischen Fraktion konnte Hydroxynitrillyase Aktivität von 16 U/mg Protein detektiert werden. Die so hergestellten Proteinpräparationen konnten in gleicher Weise wie bei Beispiel 6 beschrieben ohne nennenswerte Aktivitätsverluste gelagert werden.
Nach den gleichen Verfahren wie in Beispiel 1 beschrieben, kann auf einfache Weise eine hochgereinigte Enzympräparation gewonnen werden, die bei SDS-Polyacrylamid Gelelektrophorese praktisch nur mehr eine Bande bei 30 ± 1 kDa zeigte. Solche Präparationen von rekombianter, durch Überexpression in P.pastoris gewonnener Hnl zeigten spezifische Aktivität im Bereich von 41 bis 46 IU/mg Protein.
Bei isoelektrischer Fokussierung zeigte Hnl aus H.brasiliensis eine Bande bei einem isoelektrischen Punkt von 4.1. Bei den rekombinanten Proteinen aus S.cerevisiae und P.pastoris konnten zwei bis drei knapp beisammenliegende Banden gefunden werden, die etwas weiter in Richtung zu basischen Bereichen entsprechenden Positionen lokalisiert waren. Bei rekombinanter Hnl aus P.pastoris war ein überwiegender Anteil bei diesen verschobenen Positionen zu finden.
Bei nativer Polyacrylamid Gelelektrophorese zeigten die rekombinanten Proteine aus S.cerevisiae und P.pastoris eher ähnliches Verhalten. Es konnten jeweils zwei starke eng beisammenliegende Banden, flankiert von zwei schwachen Banden als spezifisch für Hnl Protein durch Western-Blotting (mit polyklonalem anti-Hnl Antiserum) identifiziert werden. Bei Analyse des Proteins aus H.brasiliensis konnte im Gegensatz dazu eine etwas diffuse Bande identifiziert werden, die etwas weiter gelaufen war.
Claims (10)
- (S)-Hydroxynitrillyase, welche die von der folgenden DNA-Sequenz SEQ ID NO 1 abgeleitete Aminosäuresequenz SEQ ID NO 2 aufweist oder mit dieser zumindestens 80 % identisch ist.
- DNA-Sequenz, die für (S)-Hydroxynitrillyase gemäß Anspruch 1 kodiert oder mit dieser Sequenz im für Hydroxynitrillyase kodierenden Bereich zu über 85 % identisch ist.
- DNA-Sequenz gemäß Anspruch 2, welche die für (S)-Hydroxynitrillyase-Aktivität notwendigen Sequenzen umfaßt.
- Vektor, der eine DNA-Sequenz gemäß einem der Ansprüche 2 oder 3 enthält.
- Wirtszellen enthaltend eine DNA-Sequenz gemäß einem der Ansprüche 2 oder 3, die mittels eines Vektors eingebracht wurde.
- Wirtszellen gemäß Anspruch 5, dadurch gekennzeichnet, daß sie Zellen von Mikroorganismen sind.
- Wirtszellen gemäß Anspruch 5 oder 6, dadurch gekennzeichnet, daß sie Saccharomyces cerevisiae oder Pichia pastoris entstammen.
- Rekombinantes Protein, herstellbar durch heterologe Expression einer DNA Sequenz gemäß einem der Ansprüche 2 oder 3 in einer Wirtszelle gemäß einem der Ansprüche 5 bis 7.
- Verfahren zur Herstellung eines Proteins mit (S)-Hydroxynitrillyase-Aktivität, dadurch gekennzeichnet, daß Wirtszellen nach einem der Ansprüche 5 bis 7 kultiviert werden und das gebildete Protein isoliert wird.
- Verwendung eines rekombinanten Proteins gemäß Anspruch 8 zur Herstellung von (S)-Cyanhydrinen.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AT1182/95 | 1995-07-12 | ||
| AT118295 | 1995-07-12 | ||
| AT0118295A AT404837B (de) | 1995-07-12 | 1995-07-12 | (s)-hydroxynitrillyase aus hevea brasiliensis |
| PCT/EP1996/003010 WO1997003204A2 (de) | 1995-07-12 | 1996-07-10 | (s)-hydroxynitrillyase aus hevea brasiliensis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP0840792A2 EP0840792A2 (de) | 1998-05-13 |
| EP0840792B1 true EP0840792B1 (de) | 2002-02-27 |
Family
ID=3508388
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP96925698A Expired - Lifetime EP0840792B1 (de) | 1995-07-12 | 1996-07-10 | (s)-hydroxynitrillyase aus hevea brasiliensis |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US6046042A (de) |
| EP (1) | EP0840792B1 (de) |
| JP (1) | JP4090076B2 (de) |
| AT (2) | AT404837B (de) |
| CA (1) | CA2226518A1 (de) |
| DE (1) | DE59608804D1 (de) |
| DK (1) | DK0840792T3 (de) |
| ES (1) | ES2170251T3 (de) |
| IL (1) | IL122606A (de) |
| TW (1) | TW469293B (de) |
| WO (1) | WO1997003204A2 (de) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK0799894T3 (da) * | 1996-02-09 | 2004-08-09 | Degussa | Fremgangsmåde til fremstilling af (S)-cyanhydriner |
| AT407397B (de) | 1998-07-02 | 2001-02-26 | Dsm Fine Chem Austria Gmbh | (s)-hydroxynitrillyasen mit verbesserter substratakzeptanz und deren verwendung |
| DE69928206T2 (de) | 1998-12-28 | 2006-08-03 | Nippon Shokubai Co., Ltd. | Verfahren zur Herstellung von S-Hydroxynitrillyasen |
| US6194039B1 (en) * | 1999-10-22 | 2001-02-27 | Elsicon, Inc. | Materials for inducing alignment in liquid crystals and liquid crystal displays |
| DE19963485B4 (de) * | 1999-12-28 | 2006-02-16 | JFC - Jülich Fine Chemicals GmbH | Verfahren zur Herstellung von Hydroxylnitril-Lyasen |
| ATE318914T1 (de) * | 2001-01-16 | 2006-03-15 | Dsm Fine Chem Austria Gmbh | Gene, enthaltend eine für hydroxynitrillyase codierende dna-sequenz, rekombinante proteine mit hydroxynitrillyase-aktivität und deren verwendung |
| AT412157B (de) * | 2002-07-15 | 2004-10-25 | Dsm Fine Chem Austria Gmbh | Screeningmethode zum nachweis von amidase- und nitrilhydrataseaktivitäten und deren verwendung |
| JP4124639B2 (ja) | 2002-12-17 | 2008-07-23 | 株式会社日本触媒 | 大腸菌を用いたs−ヒドロキシニトリルリアーゼの製造方法 |
| AT412092B (de) * | 2003-02-27 | 2004-09-27 | Dsm Fine Chem Austria Gmbh | Verfahren zur herstellung chiraler alpha-hydroxycarbonsäuren durch enzymatische hydrolyse von chiralen cyanhydrinen |
| EP1730274A4 (de) * | 2004-03-31 | 2008-03-26 | Nippon Catalytic Chem Ind | Neue modifizierte s-hydroxynitril-lyase |
| JP4854202B2 (ja) * | 2004-03-31 | 2012-01-18 | 株式会社日本触媒 | 新規改変型s−ヒドロキシニトリルリアーゼ |
| EP2267124A1 (de) | 2004-10-15 | 2010-12-29 | Mitsubishi Rayon Co., Ltd. | Verbesserte Hydroxynitrile-Lyase |
| EP2092060B1 (de) | 2006-12-14 | 2014-01-22 | DSM IP Assets B.V. | Zufällige r-hnl-varianten und ihre verwendung zur herstellung von optisch reinen, sterisch gehinderten cyanohydrinen |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AT396252B (de) * | 1991-10-31 | 1993-07-26 | Chemie Linz Gmbh | Enzymatisches verfahren zur enantioselektiven herstellung optisch aktiver cyanhydrine |
-
1995
- 1995-07-12 AT AT0118295A patent/AT404837B/de not_active IP Right Cessation
-
1996
- 1996-07-10 EP EP96925698A patent/EP0840792B1/de not_active Expired - Lifetime
- 1996-07-10 WO PCT/EP1996/003010 patent/WO1997003204A2/de not_active Ceased
- 1996-07-10 US US08/981,256 patent/US6046042A/en not_active Expired - Lifetime
- 1996-07-10 ES ES96925698T patent/ES2170251T3/es not_active Expired - Lifetime
- 1996-07-10 DE DE59608804T patent/DE59608804D1/de not_active Expired - Lifetime
- 1996-07-10 JP JP50550297A patent/JP4090076B2/ja not_active Expired - Lifetime
- 1996-07-10 CA CA002226518A patent/CA2226518A1/en not_active Abandoned
- 1996-07-10 DK DK96925698T patent/DK0840792T3/da active
- 1996-07-10 IL IL12260696A patent/IL122606A/xx not_active IP Right Cessation
- 1996-07-10 AT AT96925698T patent/ATE213776T1/de not_active IP Right Cessation
- 1996-07-11 TW TW085108400A patent/TW469293B/zh not_active IP Right Cessation
Also Published As
| Publication number | Publication date |
|---|---|
| ES2170251T3 (es) | 2002-08-01 |
| IL122606A0 (en) | 1998-08-16 |
| US6046042A (en) | 2000-04-04 |
| IL122606A (en) | 2005-11-20 |
| ATE213776T1 (de) | 2002-03-15 |
| JP4090076B2 (ja) | 2008-05-28 |
| AT404837B (de) | 1999-03-25 |
| TW469293B (en) | 2001-12-21 |
| ATA118295A (de) | 1998-07-15 |
| WO1997003204A3 (de) | 1997-03-20 |
| DE59608804D1 (en) | 2002-04-04 |
| WO1997003204A2 (de) | 1997-01-30 |
| JPH11508775A (ja) | 1999-08-03 |
| DK0840792T3 (da) | 2002-04-22 |
| CA2226518A1 (en) | 1997-01-30 |
| EP0840792A2 (de) | 1998-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AT404837B (de) | (s)-hydroxynitrillyase aus hevea brasiliensis | |
| DE69730514T2 (de) | Amidase | |
| DE60036395T2 (de) | Enzyme des auf die lysosomen gerichteten weges | |
| DE60202478T2 (de) | Verfahren zur herstellung von polynukleotidvarianten | |
| Wood | Electron microscopic localization of amines in central nervous tissue | |
| DE69731317T2 (de) | Neue carbonyl-reduktase, gene welche diese kodieren und methoden zu deren verwendung | |
| Döbeli et al. | A biotechnological method provides access to aggregation competent monomeric Alzheimer's 1–42 residue amyloid peptide | |
| DE69030615T2 (de) | Neue Polypeptide, DNA-Sequenzen, die deren Expression erlauben, Verfahren zur Vorbereitung und Verwendung | |
| EP0955369B1 (de) | Hochaktive alkalische Phosphatase | |
| JP4160652B2 (ja) | エンド−β−N−アセチルグルコサミニダーゼ遺伝子 | |
| DE69636649T2 (de) | Für einen Endoglycoceramidase-Aktivator kodierendes Gen | |
| Taketani et al. | Induction of terminal enzymes for heme biosynthesis during differentiation of mouse erythroleukemia cells | |
| EP0297291A2 (de) | Äusseres Membranprotein F von Pseudomonas aeruginosa | |
| EP1566441B1 (de) | Gene, enthaltend eine für Hydroxynitrillyase codierende DNA-Sequenz, rekombinante Proteine mit Hydroxynitrillyase-Aktivität und deren Verwendung | |
| DE69634815T2 (de) | D-pantolactonhydrolase und dafür kodierendes gen | |
| AT407397B (de) | (s)-hydroxynitrillyasen mit verbesserter substratakzeptanz und deren verwendung | |
| DE19529116A1 (de) | (S)-Hydroxynitrillyase aus Hevea brasiliensis | |
| DE69027466T2 (de) | Achromobacter-Protease-I-Gen sowie Genprodukt | |
| DE69935828T2 (de) | Alkalische Ceramidase (E.C. 3.5.1.23) kodierendes Gen aus Pseudomonas aeruginosa | |
| DE60032328T2 (de) | Verfahren zur herstellung von coenzym q 10 | |
| Yamakawa et al. | Fractionation and some properties of acetic-ester synthesizing enzyme from Cladosporium cladosporioides No. 9 | |
| DE102007023986A1 (de) | Verfahren zur Herstellung von UDP-Rhamnose und Enzym, das für dieses Verfahren verwendet wird | |
| EP1504103B1 (de) | Promotoren mit veränderter transkriptionseffizienz aus der methylotrophen hefe hansenula polymorpha | |
| DE10114999A1 (de) | D-Carbamoylase aus Arthrobacter crystallopoietes DSM 20117 | |
| Fujita et al. | Preliminary characterization of glutathione S-transferases that accumulate in callus cells of pumpkin (Cucurbita maxima Duch.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 19971219 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FI FR GB IE IT LI NL SE |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: GRIENGL, HERFRIED Inventor name: KOHLWEIN, SEPP Inventor name: HAYN, ELFRIEDE MARIANNE Inventor name: SCHWAB, HELMUT Inventor name: SCHALL, MICHAEL Inventor name: HASSLACHER, MEINHARD |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: DSM FINE CHEMICALS AUSTRIA GMBH |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: DSM FINE CHEMICALS AUSTRIA NFG GMBH & COKG |
|
| GRAG | Despatch of communication of intention to grant |
Free format text: ORIGINAL CODE: EPIDOS AGRA |
|
| 17Q | First examination report despatched |
Effective date: 20010709 |
|
| GRAG | Despatch of communication of intention to grant |
Free format text: ORIGINAL CODE: EPIDOS AGRA |
|
| GRAH | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOS IGRA |
|
| GRAH | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOS IGRA |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: IF02 |
|
| GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
| AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AT BE CH DE DK ES FI FR GB IE IT LI NL SE |
|
| REF | Corresponds to: |
Ref document number: 213776 Country of ref document: AT Date of ref document: 20020315 Kind code of ref document: T |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: NV Representative=s name: BOVARD AG PATENTANWAELTE |
|
| GBT | Gb: translation of ep patent filed (gb section 77(6)(a)/1977) |
Effective date: 20020228 |
|
| REF | Corresponds to: |
Ref document number: 59608804 Country of ref document: DE Date of ref document: 20020404 |
|
| REG | Reference to a national code |
Ref country code: DK Ref legal event code: T3 |
|
| REG | Reference to a national code |
Ref country code: ES Ref legal event code: FG2A Ref document number: 2170251 Country of ref document: ES Kind code of ref document: T3 |
|
| ET | Fr: translation filed | ||
| PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
| 26N | No opposition filed |
Effective date: 20021128 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: IE Payment date: 20070720 Year of fee payment: 12 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: ES Payment date: 20070727 Year of fee payment: 12 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FI Payment date: 20070713 Year of fee payment: 12 Ref country code: AT Payment date: 20070716 Year of fee payment: 12 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: SE Payment date: 20070712 Year of fee payment: 12 Ref country code: NL Payment date: 20070716 Year of fee payment: 12 Ref country code: IT Payment date: 20070724 Year of fee payment: 12 Ref country code: BE Payment date: 20070802 Year of fee payment: 12 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FR Payment date: 20070710 Year of fee payment: 12 |
|
| EUG | Se: european patent has lapsed | ||
| NLV4 | Nl: lapsed or anulled due to non-payment of the annual fee |
Effective date: 20090201 |
|
| REG | Reference to a national code |
Ref country code: IE Ref legal event code: MM4A |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: AT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080710 |
|
| REG | Reference to a national code |
Ref country code: FR Ref legal event code: ST Effective date: 20090331 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: NL Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20090201 Ref country code: FI Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080710 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080710 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080710 Ref country code: FR Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080731 |
|
| REG | Reference to a national code |
Ref country code: ES Ref legal event code: FD2A Effective date: 20080711 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: ES Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080711 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080711 Ref country code: BE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080731 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: PFA Owner name: DSM FINE CHEMICALS AUSTRIA NFG GMBH & CO KG Free format text: DSM FINE CHEMICALS AUSTRIA NFG GMBH & CO KG#ST.-PETER-STRASSE 25#4021 LINZ (AT) -TRANSFER TO- DSM FINE CHEMICALS AUSTRIA NFG GMBH & CO KG#ST.-PETER-STRASSE 25#4021 LINZ (AT) |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DK Payment date: 20150713 Year of fee payment: 20 Ref country code: CH Payment date: 20150713 Year of fee payment: 20 Ref country code: DE Payment date: 20150707 Year of fee payment: 20 Ref country code: GB Payment date: 20150708 Year of fee payment: 20 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: PUE Owner name: ESIM CHEMICALS GMBH, AT Free format text: FORMER OWNER: DPX FINE CHEMICALS AUSTRIA GMBH AND CO. KG, AT Ref country code: CH Ref legal event code: PFA Owner name: DPX FINE CHEMICALS AUSTRIA GMBH AND CO. KG, AT Free format text: FORMER OWNER: DSM FINE CHEMICALS AUSTRIA NFG GMBH AND CO KG, AT Ref country code: CH Ref legal event code: NV Representative=s name: SCHNEIDER FELDMANN AG PATENT- UND MARKENANWAEL, CH |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: 732E Free format text: REGISTERED BETWEEN 20160218 AND 20160224 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R081 Ref document number: 59608804 Country of ref document: DE Owner name: ESIM CHEMICALS GMBH, AT Free format text: FORMER OWNER: DSM FINE CHEMICALS AUSTRIA NFG GMBH & CO KG, LINZ, AT Ref country code: DE Ref legal event code: R081 Ref document number: 59608804 Country of ref document: DE Owner name: ESIM CHEMICALS GMBH, AT Free format text: FORMER OWNER: DPX FINE CHEMICALS AUSTRIA GMBH & CO KG, LINZ, AT |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R071 Ref document number: 59608804 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: DK Ref legal event code: EUP Effective date: 20160710 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: PL |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: PE20 Expiry date: 20160709 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: GB Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION Effective date: 20160709 |


