EP0563239A1 - Zerstümmeltes interleukin-1-rezeptor-gen zur behandlung von arthritis - Google Patents

Zerstümmeltes interleukin-1-rezeptor-gen zur behandlung von arthritis

Info

Publication number
EP0563239A1
EP0563239A1 EP92902630A EP92902630A EP0563239A1 EP 0563239 A1 EP0563239 A1 EP 0563239A1 EP 92902630 A EP92902630 A EP 92902630A EP 92902630 A EP92902630 A EP 92902630A EP 0563239 A1 EP0563239 A1 EP 0563239A1
Authority
EP
European Patent Office
Prior art keywords
interleukin
gene
receptor
cell line
synovial cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP92902630A
Other languages
English (en)
French (fr)
Other versions
EP0563239A4 (de
Inventor
Joseph C. Glorioso
Christopher H. Evans
Paul D. Robbins
Geethani Bandara
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pittsburgh
Original Assignee
University of Pittsburgh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Pittsburgh filed Critical University of Pittsburgh
Publication of EP0563239A1 publication Critical patent/EP0563239A1/de
Publication of EP0563239A4 publication Critical patent/EP0563239A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13045Special targeting system for viral vectors

Definitions

  • the present invention relates to a method of using a gene encoding a truncated interleukin-1 receptor to resist the deleterious pathological changes associated with arthritis. More specifically, this invention provides a method wherein a gene coding for an extracellular interleukin-1 binding domain of an interleukin-1 receptor is introduced into synovial cells of a mammalian host iri vivo for neutralizing the destructive activity of interleukin-1 upon cartilage and other soft tissues. As an alternative, the patients own cells are transduced iii vitro and introduced back into the affected joint, using surgical transplantation procedures.
  • Arthritis involves inflammation of a joint that is usually accompanied by pain and frequently changes in struc ⁇ ture. Arthritis may result from or be associated with a number of conditions including infection, immunological disturbances, trauma and degenerative joint diseases such as, for example, osteoarthritis. The biochemistry of cartilage degradation in joints and cellular changes have received considerable investigation.
  • cartilage chondrocytes
  • synovium synoviocytes
  • these cells secrete basal levels of prostaglandin E 2 and various neutral proteinases, such as, for example, collagenase, gelatinase and stromelysin, with the ability to degrade cartilage.
  • various neutral proteinases such as, for example, collagenase, gelatinase and stromelysin.
  • these cells become activated.
  • synoviocytes and chondrocytes synthesize and secrete large amounts of prostaglandin E2 and neutral proteinases.
  • interleukin-1 activates chondrocytes and synoviocytes and induces cartilage breakdown in vitro and in vivo.
  • interleukin-1 is a growth factor for synoviocytes and promotes their synthesis of matrix, two properties suggesting the involvement of interleukin-1 in the synovial hypertrophy that accompanies arthritis.
  • interleukin-1 inhibits cartilaginous matrix synthesis by chondrocytes, thereby suppressing repair of cartilage.
  • Interleukin-1 also induces bone resorption and thus may account for the loss of bone density seen in rheumatoid arthritis.
  • Interleukin-1 is inflammatory, serves as a growth factor for lymphocytes, is a chemotactic factor and a possible activator of poly orphonuclear leukocytes (PMNs) . When present in a sufficient concentration, interleukin-1 may cause fever, muscle wasting and sleepiness.
  • PMNs poly orphonuclear leukocytes
  • Interleukin-1 The major source of interleukin-1 in the joint is the synovium. Interleukin-1 is secreted by the resident synoviocytes, which are joined under inflammatory conditions by macrophages and other white blood cells.
  • NSAIDs Non-Steroidal Anti- Inflammatory Drugs
  • the NSAIDs inhibit cartilage synthesis and repair and control inflammation.
  • the mechanism of action of the NSAIDs appears to be associated principally with the inhibition of prosta ⁇ glandin synthesis in body tissues.
  • Most of this development has involved the synthesis of better inhibitors of cyclo- oxygenase, a key enzyme that catalyzes the formation of prostaglandin precursors (endoperoxides) from arachidonic acid.
  • the anti-inflammatory effect of the NSAIDs is thought to be due in part to inhibition of prostaglandin synthesis and release during inflammation.
  • Prostaglandins are also believed to play a role in modulating the rate and extent of leukocyte infiltration during inflammation.
  • the NSAIDs include, such as, for example, acetylsalicylic acid (aspirin), fenoprofen calcium (Nalfon ® Pulvules*, Dista Products Company), ibuprofen (Motrin ® , The Upjohn Company), and indomethacin (Indocin ® , Merck, Sharp & Dohme).
  • genetic material can be introduced into mammalian cells by chemical or biologic means. Moreover, the introduced genetic material can be expressed so that high levels of a specific protein can be synthesized by the host cell. Cells retaining the introduced genetic material may include an antibiotic resistance gene thus providing a selectable marker for preferential growth of the transduced cell in the presence of the corresponding antibiotic. Chemical compounds for inhibiting the production of interleukin-1 are also known.
  • 4,778,806 discloses a method of inhibiting the production of interleukin-1 by monocytes and/or macrophages in a human by administering through the parenteral route a 2-2'-[l,3-propan-2-onediyl-bis (thio)] bis-1 H-imidazole or a pharmaceutically acceptable salt thereof.
  • This patent discloses a chemical compound for inhibiting the production of interleukin-1.
  • gene therapy is employed that is capable of binding to and neutralizing interleukin-1.
  • U.S. Patent No. 4,780,470 discloses a method of inhibiting the production of interleukin-1 by monocytes in a human by administering a 4,5-diaryl-2 (substituted) imidazole. This patent also discloses a chemical compound for inhibiting the production of interleukin-1.
  • U.S. Patent No. 4,794,114 discloses a method of inhibiting the 5-lipoxygenase pathway in a human by administering a diaryl-substituted imidazole fused to a thiazole, pyrrolidine or piperidine ring or a pharmaceutically acceptable salt thereof. This patent also discloses a chemical compound for inhibiting the production of interleukin-1.
  • U.S. Patent No. 4,794,114 discloses a method of inhibiting the 5-lipoxygenase pathway in a human by administering a diaryl-substituted imidazole fused to a thiazole, pyrrolidine or piperidine ring or a pharmaceutically acceptable salt thereof.
  • This patent also discloses a chemical compound for inhibiting the production of interleukin-1.
  • 4,870,101 discloses a method for inhibiting the release of interleukin-1 and for alleviating interleukin-1 mediated conditions by administering an effective amount of a pharmaceutically acceptable anti- oxidant compound such as disulfiram, tetrakis [3-(2,6-di- tert-butyl-4-hydroxyphenyl) propionyloxy methyl] methane or 2,4-di-isobutyl-6-(N,N-dimethylamino methyl)-phenol.
  • a pharmaceutically acceptable anti- oxidant compound such as disulfiram, tetrakis [3-(2,6-di- tert-butyl-4-hydroxyphenyl) propionyloxy methyl] methane or 2,4-di-isobutyl-6-(N,N-dimethylamino methyl)-phenol.
  • This patent discloses a chemical compound for inhibiting the release of interleukin-1.
  • U.S. Patent No. 4,816,436 discloses a process for the use of interleukin-1 as an anti-arthritic agent.
  • This patent states that interleukin-1, in association with a pharmaceutical carrier, may be administered by intra- articular injection for the treatment of arthritis or inflammation.
  • the present invention discloses a method of using and preparing a gene that is capable of binding to and neutralizing interleukin-1 as a method of resisting arthritis.
  • U.S. Patent No. 4,935,343 discloses an immunoassay method for the detection of interleukin-l( ⁇ that employs a monoclonal antibody that binds to interleukin-l ' but does not bind to interleukin-lo*- .
  • the monoclonal antibody disclosed in this patent may be obtained by production of an immunogen through genetic engineering using recombinant DNA technology.
  • the immunogen is injected into a mouse and thereafter spleen cells of the mouse are immortalized by fusing the spleen cells with myeloma cells.
  • the resulting cells include the hybrid continuous cell lines (hybridomas) that may be later screened for monoclonal antibodies.
  • the monoclonal antibodies of the invention may be used therapeutically, such as for example, in the immunization of a patient, or the monoclonal antibodies may be bound to a toxin to form an immunotoxin or to a radioactive material or drug to form a radio pharmaceutical or pharmaceutical.
  • U.S. Patent No. 4,766,069 discloses a recombinant DNA cloning vehicle having a DNA sequence comprising the human interleukin-1 gene DNA sequence.
  • This patent provides a process for preparing human interleukin-1 ⁇ 5 , and recovering the human interleukin-l ⁇ .
  • This patent discloses use of interleukin-1 as an immunological reagent in humans because of its ability to stimulate T-cells and 3- cells and increase immunoglobulin synthesis.
  • U.S. No. 4,396,601 discloses a method for providing mammalian hosts with additional genetic capability.
  • This patent provides that host cells capable of regeneration are removed from the host and treated with genetic material including at least one marker which allows for selective advantage for the host cells in which the genetic material is capable of expression and replication.
  • This patent states that the modified host cells are then returned to the host under regenerative conditions.
  • genetic material may be directly introduced (a) into host cells in vivo or (b) into synoviocytes iri vitro for subsequent transplantation back into the patient's joints.
  • the present invention has met the hereinbefore described need.
  • a method of using the gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor is provided for in the present invention.
  • This gene is capable of binding to and neutralizing interleukin-1 in vivo to substantially resist the degradation of cartilage in a mammalian host.
  • the method of this invention employs gene therapy n vivo to address the chronic debilitating effects of arthritis.
  • a preferred method of using the gene coding for the truncated interleukin-1 receptor of this invention involves employing recombinant techniques to generate a cell line which produces infectious retroviral particles containing the gene coding for the truncated interleukin-1 receptor.
  • the producer cell line is generated by inserting the gene coding into a retroviral vector under the regulation of a suitable eukaryotic promoter, transfecting the retroviral vector containing the gene coding into the retroviral packaging cell line for the production of a viral particle that is capable of expressing the gene coding, and infecting the synovial cells of a mammalian host using the viral particle.
  • the method of using the hereinbefore described gene involves introducing the viral particles obtained from the retroviral packaging cell line directly by intra-articular injection into a joint space of a mammalian host that is lined with synovial cells.
  • the method of using the gene of this invention may be employed both prophylactically and in the treatment of arthritis.
  • a method of using the hereinbefore described gene involves infecting synovial cells in culture with the viral particles and subsequently transplanting the infected synovial cells back into the joint.
  • This method of using the gene of this invention may also be employed prophylactically and in the treatment of arthritis.
  • a method of using the gene coding for an extracellular interleukin-1 binding domain of the interleukin-1 receptor that is capable of binding to and neutralizing interleukin 1 includes employing recombinant techniques to produce a retrovirus vector carrying two genes.
  • the first gene encodes the extracellular interleukin-1 binding domain of the interleukin receptor, and the second gene encodes for selectable antibiotic resistance.
  • This method of use involves transfecting the retrovirus vector into a 5. retrovirus packaging cell line to obtain a cell line producing infectious retroviral particles carrying the gene.
  • Another embodiment of this invention provides a method of preparing a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor including synthesizing the gene by a polymerase chain reaction, introducing the amplified interleukin-1 receptor coding sequence into a retroviral vector, transfecting the retroviral vector into a retrovirus packaging cell line and collecting viral particles from the retrovirus packaging cell line.
  • a compound for parenteral administration to a patient in a therapeutically effective amount contains a gene encoding an extracellular int ⁇ rleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
  • Another embodiment of this invention provides for a compound for parenteral administration to a patient in a prophylactically effective amount that includes a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
  • Figure 2 shows the amino acid and nucleotide sequence of the human and mouse interleukin-1 receptors.
  • Figure 3 shows gene encoding a truncated interleukin-1 receptor inserted into a retroviral vector. DESCRIPTION OF THE PREFERRED EMBODIMENTS As used herein, the term "patient” includes members of the animal kingdom including but not limited to human beings.
  • the gene and method of using the gene of this invention provide for the neutralization of interleukin-1.
  • Interleukin-1 is a key mediator of cartilage destruction in arthritis.
  • Interleukin-1 also causes inflammation and is a very powerful inducer of bone resorption. Many of these effects result from the ability of interleukin-1 to increase enormously the cellular synthesis of prostaglandin E 2 , the neutral proteinases— collagenase, gelatinase, and stromelysin, and plasminogen activator.
  • the catabolic effects of interleukin-1 upon cartilage are exacerbated by its ability to suppress the synthesis of the cartilaginous matrix by chondrocytes.
  • Interleukin-1 is present at high concentrations in synovial fluids aspirated from arthritic joints and it has been demonstrated that intra-articular injection of recombinant interleukin-1 in animals causes cartilage breakdown and inflammation.
  • Interleukin-1 exists as several species, each an unglycosylated polypeptide of 17,000 Daltons. Two species have previously been cloned, interleukin-1 ⁇ c, and interleukin-1- ⁇ .
  • the « • form has a pi of approximately 5, and the ⁇ ⁇ form has a pi around 7.
  • interleukin-1 d and interleukin-1 ⁇ have substantially identical biological properties and share a common cell surface receptor.
  • the interleukin-1 receptor is a 80kDa (kilodalton) glycoprotein and contains an extracellular, interleukin-1 binding portion of 319 amino acids which are arranged in three immunoglobulin-like domains held together by disulfide bridges as shown in Figure 1.
  • a 21 amino acid trans-membrane domain joins the extracellular portion to the 217 amino acid cytoplasmic domain.
  • Figure 2 shows the amino acid and nucleotide sequence of the human and mouse interleukin-1 receptors.
  • the 21 amino acid trans-membrane region of the interleukin-1 receptor is marked by the solid line.
  • the position of the 5' and 3' oligonucleotides for PCR are also marked by a short solid line.
  • the lysine amino acid just 5' to the trans-membrane domain to be mutated to a stop codon is marked by a solid circle in Figure 2.
  • Synovium is by far the major, and perhaps the only, intra-articular source of interleukin-1 in the arthritic joint. Snyovia recovered from arthritic joints secrete high levels of interleukin-1. Both the resident synoviocytes and infiltrating blood mononuclear cells within the synovial lining produce interleukin-1.
  • the present invention provides a method of using in vivo a gene coding for a truncated form of the interleukin-1 receptor which retains its ability to bind interleukin-1 with high affinity but which is released extracellularly and therefore inactive in signal transduction.
  • the binding of this truncated and modified receptor to interleukin-1 inhibits the intra-articular activity of interleukin-1.
  • This method of using a gene encoding the extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 includes employing a retroviral vector carrying a truncated interleukin-1 receptor gene which encodes a truncated and soluble active form of the receptor.
  • the expression of the novel interleukin-1 receptor gene is controlled by regulatory sequences contained within the vector that are active in eukaryotic cells.
  • This recombinant viral vector is transfected into cell lines stably expressing the viral proteins iri trans required for production of infectious virus particles carrying the recombinant vector. These viral particles are used to deliver the recombinant interleukin-1 receptor to the recipient synovial cells by direct virus infection i vivo.
  • the soluble human interleukin-1 receptor to be inserted into the retroviral vector may be generated by a polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • An oligonucleotide complementary to the 5' leader sequence of the human interleukin-1 receptor (GCGGATCCCCTCCTAGAAGCT) and an oligonucleotide complementary to a region just upstream from the trans-membrane domain of the interleukin-1 receptor may be generated by a polymerase chain reaction (PCR).
  • An oligonucleotide complementary to the 5' leader sequence of the human interleukin-1 receptor (GCGGATCCCCTCCTAGAAGCT) and an oligonucleotide complementary to a region just upstream from the trans-membrane domain of the interleukin-1 receptor
  • the primer for the region of the interleukin-1 receptor adjacent to the trans-membrane domain contains a single base change so that the lys codon at amino acid 319 (AAG) is changed to a stop codon (TAG).
  • a BamHI recognition sequence GGATCC is added to the 5' end of the PCR primers, and following amplification, the resulting interleukin-1 receptor fragment is cloned into a BamHI site.
  • a cDNA library from human T- cells is used as a source for the interleukin-1 receptor cDNA.
  • the complementary primers are added to the DNA and 50 cycles of annealing, primer extension and denaturation are performed using a thermocycler and standard PCR reaction conditions well known by those persons skilled in the art.
  • primer extension and denaturation are performed using a thermocycler and standard PCR reaction conditions well known by those persons skilled in the art.
  • the resulting fragment is digested with BamHI and inserted into the pLJ retroviral vector.
  • the pLJ retroviral vector is available from A. J. Kor an and R. C. Mulligan. See also Proc. Natl. Acad. Sci. , Vol.
  • the retrovirus vector carrying the truncated interleukin-1 receptor is transferred into the CRIP (Proc. Natl. Acad. Sci. , Vol. 85, pp. 6460-6464 (1988), O. Danos and R. C. Mulligan) packaging cell line using a standard CaP0 4 transfection procedure and cells wherein the viral vector is stably integrated and is selected on the basis of resistance to the antibiotic G418.
  • the viral vector containing the neomycin resistant (neo-r) gene is capable of imparting resistance of the cell line to G418.
  • the CRIP cell line expresses the three viral proteins required for packaging the vector viral RNAs into infectious particles.
  • the viral particles produced by the CRIP cell line are able to efficiently infect a wide variety of mammalian cell types including human cells. All retroviral particles produced by this cell line are defective for replication but retain the ability to stably integrate into synovial cells thereby becoming an heritable trait of these cells. Virus stocks produced by this method are substantially free of contaminating helper-virus particles and are also non- pathogenic.
  • the truncated interleukin-1 gene can be inserted into a retroviral vector under the regulation of a suitable eukaryotic promoter such as the retroviral promoter already contained within the gene transfer vector, such as for example, the pLJ vector shown in Figure 3.
  • a suitable eukaryotic promoter such as the retroviral promoter already contained within the gene transfer vector, such as for example, the pLJ vector shown in Figure 3.
  • a suitable eukaryotic promoter such as the retroviral promoter already contained within the gene transfer vector, such as for example, the pLJ vector shown in Figure 3.
  • CRIP retroviral packaging cell line
  • the CRIP cell line expresses all the proteins required for packaging of the exogenous retroviral RNA.
  • Viral particles produced by the G418-selected CRIP cell lines will carry a recombinant retrovirus able to infect mammalian cells and stably express the interleukin-1 truncated receptor.
  • the viral particles are used to infect synovial cells directly _in vivo by injecting the virus into the joint space.
  • Another embodiment of this invention provides a method for using the hereinbefore described viral particles to infect in culture synovial cells obtained from the lining of the joint of a mammalian host.
  • infected cells harboring the interleukin-1 receptor retroviral construct can be selected using G418 for expression of the neomycin resistance gene.
  • the infected synovial cells expressing the interleukin-1 receptor can then be transplanted back into the joint by intra-articular injection.
  • the transplanted cells will express high levels of soluble interleukin-1 receptor in the joint space thereby binding to and neutralizing substantially all isoforms of interleukin-1, including interleukin-l « ⁇ and interleukin- l ⁇ •
  • the method used for transplantation of the synovial cells within the joint is a routine and relatively minor procedure used in the treatment of chronic inflammatory joint disease.
  • synovium can be recovered from the joint during open surgery, it is now common to perform synovectomies, especially of the knee, through the arthroscope.
  • the arthroscope is a small, hollow rod inserted into the knee via a small puncture wound.
  • the arthroscope allows access to surgical instruments, such that snyovial tissue can be removed arthroscopically. Such procedures can be carried out under "spinal" anesthetic and the patient allowed home the same day. In this manner sufficient synovium can be obtained from patients who will receive this gene therapy.
  • the synovial cells (synoviocytes) contained within the excised tissue may be aseptically recovered by enzymic digestion of the connective tissue matrix.
  • the synovium is cut into pieces of approximately 1 millimeter diameter and digested sequentially with trypsin (0.2% w/v in Grey's Balanced Salt Solution) for 30 minutes at 37° centigrade, and collagenase (0.2% w/v in Grey's Balanced Salt Solution) for 2 hours at 37° centigrade.
  • Cells recovered from this digestion are seeded into plastic culture dishes at a concentration of 10 4 - 10 5 cells per square centimeter with Hank's F 12 medium supplemented with 10% foetal bovine serum and antibiotics. After 3-7 days, the culture medium is withdrawn.
  • Non-adherent cells such as lymphocytes are removed by washing with Grey's Balanced Salt Solution and fresh medium added.
  • the adherent cells can now be used as they are, allowed to grow to confluency or taken through one or more subcultures. Subcultivating expands the cell number and removes non-dividing cells such as macrophages.
  • the cells Following genetic manipulation of the cells thus recovered, they can be removed from the culture dish by trypsinising, scraping or other means, and made into a standard suspension. Grey's Balanced Salt Solution or other isogenic salt solutions of suitable composition, or saline solution are suitable carriers. A suspension of cells can then be injected into the recipient mammalian joint. Intra- articular injections of this type are routine and easily carried out in the doctor's office. No surgery is necessary. Very large numbers of cells can be introduced in this way and repeat injections carried out as needed.
  • Another embodiment of this invention is the gene produced by the hereinbefore described method of preparation.
  • This gene carried by the retrovirus may be incorporated in a suitable pharmaceutical carrier, such as for example, buffered physiologic saline, for parenteral administration.
  • This gene may be administered to a patient in a therapeutically effective dose. More specifically, this gene may be incorporated in a suitable pharmaceutical carrier at a therapeutically effective dose and administered by intra-articular injection.
  • this gene may be administered to patients as a prophylactic measure to prevent the development of arthritis in those patients determined to be highly susceptible of developing this disease. More specifically, this gene carried by the retrovirus may be incorporated in a suitable pharmaceutical carrier at a prophylactically effective dose and administered by parenteral injection, including intra- articular injection. It will be appreciated by those persons skilled in the art that this invention provides a method of using and a method of preparing a gene encoding an extra cellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1, and thus substantially protect cartilage of a mammalian host from pathological degradation. In addition, it will be understood by those persons skilled in the art that the method of using the gene of this invention will reduce inflammation, protect soft tissues of the joint and suppress the loss of bone that occurs in patients suffering with arthritis.
  • the viral vectors employed in the hereinbefore described invention may be employed to transfect synovial cells in vivo or in culture, such as by direct intra- articular injection or transplantation of autologous synovial cells from the patient transduced with the retroviral vector carrying the truncated interleukin-1 receptor gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Rheumatology (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Pain & Pain Management (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP19920902630 1990-12-20 1991-12-09 Zerstümmeltes interleukin-1-rezeptor-gen zur behandlung von arthritis. Withdrawn EP0563239A4 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US63098190A 1990-12-20 1990-12-20
US630981 1990-12-20
PCT/US1991/009231 WO1992011359A1 (en) 1990-12-20 1991-12-09 A truncated interleukin-1 receptor gene for the treatment of arthritis

Publications (2)

Publication Number Publication Date
EP0563239A1 true EP0563239A1 (de) 1993-10-06
EP0563239A4 EP0563239A4 (de) 1994-10-12

Family

ID=24529337

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19920902630 Withdrawn EP0563239A4 (de) 1990-12-20 1991-12-09 Zerstümmeltes interleukin-1-rezeptor-gen zur behandlung von arthritis.

Country Status (4)

Country Link
EP (1) EP0563239A4 (de)
JP (1) JPH06504440A (de)
CA (1) CA2098848A1 (de)
WO (1) WO1992011359A1 (de)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6159464A (en) * 1990-12-20 2000-12-12 University Of Pittsburgh Of The Commonwealth System Of Higher Education Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
US5858355A (en) * 1990-12-20 1999-01-12 University Of Pittsburgh Of The Commonwealth System Of Higher Education IRAP gene as treatment for arthritis
US6228356B1 (en) 1990-12-20 2001-05-08 University Of Pittsburgh Of The Commonwealth System Of Higher Education Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
US6156304A (en) * 1990-12-20 2000-12-05 University Of Pittsburgh Of The Commonwealth System Of Higher Education Gene transfer for studying and treating a connective tissue of a mammalian host
US6413511B1 (en) * 1990-12-20 2002-07-02 University Of Pittsburgh Of The Commonwealth System Of Higher Education Cartilage alterations by administering to joints chondrocytes comprising a heterologous polynucleotide
US5792751A (en) * 1992-04-13 1998-08-11 Baylor College Of Medicine Tranformation of cells associated with fluid spaces
AU684050B2 (en) * 1992-07-13 1997-12-04 Baylor College Of Medicine Targeting somatic gene therapy to joints
JPH08511507A (ja) * 1993-03-08 1996-12-03 ユニバーシティー オブ ピッツバーグ オブ ザ コモンウェルス システム オブ ハイヤー エデュケーション 哺乳動物宿主の結合組織を処置するための遺伝子導入
US5645829A (en) * 1993-06-18 1997-07-08 Beth Israel Hospital Association Mesothelial cell gene therapy
AU7516594A (en) * 1993-07-28 1995-02-28 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Pre-binding of retroviral vector particles with complement components to enable the performance of human gene therapy (in vivo)
EP0690673A4 (de) * 1993-12-14 1996-05-29 Univ Pittsburgh Systemische genetische behandlung von bindegewebeerkrankungen
JPH083058A (ja) * 1994-06-17 1996-01-09 Hoechst Japan Ltd 新規な骨代謝疾患治療剤
EP0807183B1 (de) * 1994-08-26 2001-01-03 Aventis Pharma Deutschland GmbH Gentherapie von erkrankungen, die durch das immunsystem bedingt sind, mit hilfe eines zellspezifischen zellzyklusregulierten wirkstoffes
US6096728A (en) * 1996-02-09 2000-08-01 Amgen Inc. Composition and method for treating inflammatory diseases
US6294170B1 (en) 1997-08-08 2001-09-25 Amgen Inc. Composition and method for treating inflammatory diseases
EP1009444A2 (de) * 1997-09-02 2000-06-21 Chiron Corporation Zusammensetzungen und verfahren zur behandlung von arthritis durch gentherapie
EP1939300A1 (de) 1999-05-28 2008-07-02 Targeted Genetics Corporation Verfahren und Zusammensetzung zur Senkung des Spiegels des Tumornekrosefaktors (TNF) bei TNF-assoziierten Leiden
WO2000073481A1 (en) 1999-05-28 2000-12-07 Targeted Genetics Corporation Methods and compositions for lowering the level of tumor necrosis factor (tnf) in the tnf-associated disorders
WO2001013960A1 (en) * 1999-08-20 2001-03-01 University Of Pittsburgh Of The Commonwealth System Of Higher Education Methods for in vivo gene delivery to sites of cartilage damage
WO2002083080A2 (en) * 2001-04-17 2002-10-24 Genetix Pharmaceuticals, Inc. Method of treating arthritis using lentiviral vectors in gene therapy
CA2557910C (en) 2004-04-02 2012-05-29 Amgen Inc. Methods of reducing aggregation of il-1ra

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0318296A2 (de) * 1987-11-25 1989-05-31 Immunex Corporation Interleukin 1-Rezeptoren
WO1989004838A1 (en) * 1987-11-25 1989-06-01 Immunex Corporation Interleukin-1 receptors

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0318296A2 (de) * 1987-11-25 1989-05-31 Immunex Corporation Interleukin 1-Rezeptoren
WO1989004838A1 (en) * 1987-11-25 1989-06-01 Immunex Corporation Interleukin-1 receptors

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BRAIN RESEARCH BULLETIN vol. 24, no. 6 , 1990 pages 787 - 792 M. TSUDA ET AL. 'Retrovirus-mediated gene transfer into mouse cerebellar primary culture and its application to the neural transplantation.' *
NATURE vol. 320 , 20 March 1986 , LONDON, GB pages 213 - 214 M. ROBERTSON 'Gene therapy. Desperate appliances.' *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA vol. 86, no. 23 , December 1989 , WASHINGTON, DC, USA pages 9079 - 9083 P. ROUX ET AL. 'A versatile and potentially general approach to the targeting of specific cell types by retroviruses: Application to the infection of human cells by means of major histocompatibility complex class I and class II antigens by mouse ecotropic murine leukemia virus-derived viruses.' *
SCIENCE vol. 244, no. 4910 , 16 June 1989 , WASHINGTON, DC, USA pages 1275 - 1281 T. FRIEDMANN 'Progress toward human gene therapy.' *
See also references of WO9211359A1 *

Also Published As

Publication number Publication date
EP0563239A4 (de) 1994-10-12
CA2098848A1 (en) 1992-06-21
WO1992011359A1 (en) 1992-07-09
JPH06504440A (ja) 1994-05-26

Similar Documents

Publication Publication Date Title
EP0563239A1 (de) Zerstümmeltes interleukin-1-rezeptor-gen zur behandlung von arthritis
US5858355A (en) IRAP gene as treatment for arthritis
EP1932544B1 (de) Zusammensetzungen zur Behandlung von Bindegewebe eines Säugetierempfängers
US7037492B2 (en) Gene transfer for studying and treating a connective tissue of a mammalian host
EP0701563A1 (de) Gen transfer zur behandlung von bindegewebe eines säugetierwirtes
US6048524A (en) In vivo production and delivery of erythropoietin for gene therapy
Chen et al. Potent antitumour activity of a new class of tumour-specific killer cells
JP3784063B2 (ja) 異種移植耐性の増強およびブタサイトカイン
US6670178B1 (en) In Vivo production and delivery of insulinotropin for gene therapy
JPH07504812A (ja) 細胞付着を促進するための新規なポリペプチド
Kang et al. Orthopaedic applications of gene therapy: from concept to clinic.
JPH08508415A (ja) 結合組織疾患の全身的遺伝子治療
JP2014221055A (ja) インテグリンヘテロ二量体およびそのサブユニット
US20030220283A1 (en) Gene transfer for treating a connective tissue of a mammalian host
US6228356B1 (en) Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
Ueblacker et al. In vivo analysis of retroviral gene transfer to chondrocytes within collagen scaffolds for the treatment of osteochondral defects
EP0781344B1 (de) Implantat und vektor zur behandlung von erworbenen krankheiten
Ghivizzani et al. Gene therapy approaches for treating rheumatoid arthritis
DE60120131T2 (de) Antiangiogene Eigenschaften von Vascostatin und Fragmenten und Varianten davon
US6531124B1 (en) In vivo production and delivery of insulinotropin for gene therapy
Kang et al. Methods for gene transfer to synovium
AU627710B2 (en) Rapid immunoselection cloning method
Evans et al. Gene therapy with the interleukin-1 receptor antagonist for the treatment of arthritis
Reinecke et al. Current status of gene therapy for rheumatoid arthritis
DiGirolamo The potential of human bone marrow stromal cells as vehicles for ex vivo gene therapy applications

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19930715

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU MC NL SE

A4 Supplementary search report drawn up and despatched

Effective date: 19940824

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU MC NL SE

RBV Designated contracting states (corrected)

Designated state(s): CH DE ES FR GB IT LI NL SE

17Q First examination report despatched

Effective date: 19980623

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

18D Application deemed to be withdrawn

Effective date: 20010911