EP0563239A1 - A truncated interleukin-1 receptor gene for the treatment of arthritis - Google Patents
A truncated interleukin-1 receptor gene for the treatment of arthritisInfo
- Publication number
- EP0563239A1 EP0563239A1 EP92902630A EP92902630A EP0563239A1 EP 0563239 A1 EP0563239 A1 EP 0563239A1 EP 92902630 A EP92902630 A EP 92902630A EP 92902630 A EP92902630 A EP 92902630A EP 0563239 A1 EP0563239 A1 EP 0563239A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- interleukin
- gene
- receptor
- cell line
- synovial cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13041—Use of virus, viral particle or viral elements as a vector
- C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13041—Use of virus, viral particle or viral elements as a vector
- C12N2740/13045—Special targeting system for viral vectors
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Rheumatology (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Toxicology (AREA)
- Pain & Pain Management (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
La présente invention se rapporte à un procédé d'utilisation in vivo d'un gène codant un domaine de liaison extracellulaire d'interleukine-1 d'un récepteur d'interleukine-1 susceptible de se lier à l'interleukine-1 et de la neutraliser, lequel procédé consiste à utiliser des techniques de recombinaision pour produire une lignée cellulaire placée sous le contrôle d'un promoteur ecaryote approprié comprenant le gène codant pour le domaine de liaison extracellulaie d'interleukine-1 du récepteur d'interleukine-1; et à amorcer la transfection d'ADN du gène au moyen de l'introduction de particules virales obtenues de la lignée cellulaire directement dans des cellules synoviales recouvrant un espace d'articulation d'un hôte mammifère. Selon une variante, des cellules synoviales provenant de l'articulation du patient peuvent être échangées par transduction avec le vecteur rétroviral portant le gène thérapeutique et un marqueur choisi pour la sélection de cellules de transduction uniquement, et les cellules devenues autologues d'un point de vue thérapeutique peuvent être réintroduites dans l'articulation par une transplantation. En outre, on décrit un procédé de préparation d'un gène codant un domaine de liaison extracellulaire d'interleukine-1 d'un récepteur d'interleukine-1 et qui est susceptible de se lier à l'interleukine-1 et de la neutraliser. Un composé destiné à une administration parentérale en doses prophylactiques ou thérapeutiques à un patient, et contenant le gène de l'invention et un véhicule pharmaceutiquement approprié est aussi décrit.The present invention relates to a method for the in vivo use of a gene encoding an extracellular binding domain of interleukin-1 of an interleukin-1 receptor capable of binding to interleukin-1 and of the neutralize, which method involves using recombination techniques to produce a cell line under the control of an appropriate ecaryotic promoter comprising the gene encoding the interleukin-1 extracellular binding domain of the interleukin-1 receptor; and initiating DNA transfection of the gene by introducing viral particles obtained from the cell line directly into synovial cells covering a joint space of a mammalian host. Alternatively, synovial cells from the patient's joint can be exchanged by transduction with the retroviral vector carrying the therapeutic gene and a marker chosen for the selection of transduction cells only, and cells that have become autologous from a point of therapeutic view can be reintroduced into the joint through a transplant. In addition, a method of preparing a gene encoding an interleukin-1 extracellular binding domain of an interleukin-1 receptor and which is capable of binding and neutralizing interleukin-1 is described. . A compound intended for parenteral administration in prophylactic or therapeutic doses to a patient, and containing the gene of the invention and a pharmaceutically suitable vehicle is also described.
Description
D I NTERLEU IN- 1 RECEPTOR GENE FOR THE TREATMENT OF AR-
BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates to a method of using a gene encoding a truncated interleukin-1 receptor to resist the deleterious pathological changes associated with arthritis. More specifically, this invention provides a method wherein a gene coding for an extracellular interleukin-1 binding domain of an interleukin-1 receptor is introduced into synovial cells of a mammalian host iri vivo for neutralizing the destructive activity of interleukin-1 upon cartilage and other soft tissues. As an alternative, the patients own cells are transduced iii vitro and introduced back into the affected joint, using surgical transplantation procedures. Brief Description of the Prior Art
Arthritis involves inflammation of a joint that is usually accompanied by pain and frequently changes in struc¬ ture. Arthritis may result from or be associated with a number of conditions including infection, immunological disturbances, trauma and degenerative joint diseases such as, for example, osteoarthritis. The biochemistry of cartilage degradation in joints and cellular changes have received considerable investigation.
In a healthy joint, cells in cartilage (chondrocytes) and the surrounding synovium (synoviocytes) are in a resting state. In this resting state, these cells secrete basal levels of prostaglandin E2 and various neutral proteinases, such as, for example, collagenase, gelatinase and stromelysin, with the ability to degrade cartilage. During the development of an arthritic condition, these
cells become activated. In the activated state, synoviocytes and chondrocytes synthesize and secrete large amounts of prostaglandin E2 and neutral proteinases. In efforts to identify pathophysiologically relevant cell activators, it has been known that the cytokine interleukin-1 activates chondrocytes and synoviocytes and induces cartilage breakdown in vitro and in vivo. Additionally, interleukin-1 is a growth factor for synoviocytes and promotes their synthesis of matrix, two properties suggesting the involvement of interleukin-1 in the synovial hypertrophy that accompanies arthritis. In contrast, interleukin-1 inhibits cartilaginous matrix synthesis by chondrocytes, thereby suppressing repair of cartilage. Interleukin-1 also induces bone resorption and thus may account for the loss of bone density seen in rheumatoid arthritis. Interleukin-1 is inflammatory, serves as a growth factor for lymphocytes, is a chemotactic factor and a possible activator of poly orphonuclear leukocytes (PMNs) . When present in a sufficient concentration, interleukin-1 may cause fever, muscle wasting and sleepiness.
The major source of interleukin-1 in the joint is the synovium. Interleukin-1 is secreted by the resident synoviocytes, which are joined under inflammatory conditions by macrophages and other white blood cells.
Much attention has been devoted to the development of a class of agents identified as the "Non-Steroidal Anti- Inflammatory Drugs" (hereinafter "NSAIDs"). The NSAIDs inhibit cartilage synthesis and repair and control inflammation. The mechanism of action of the NSAIDs appears to be associated principally with the inhibition of prosta¬ glandin synthesis in body tissues. Most of this development has involved the synthesis of better inhibitors of cyclo-
oxygenase, a key enzyme that catalyzes the formation of prostaglandin precursors (endoperoxides) from arachidonic acid. The anti-inflammatory effect of the NSAIDs is thought to be due in part to inhibition of prostaglandin synthesis and release during inflammation. Prostaglandins are also believed to play a role in modulating the rate and extent of leukocyte infiltration during inflammation. The NSAIDs include, such as, for example, acetylsalicylic acid (aspirin), fenoprofen calcium (Nalfon® Pulvules*, Dista Products Company), ibuprofen (Motrin®, The Upjohn Company), and indomethacin (Indocin®, Merck, Sharp & Dohme).
In contrast, the studies upon which the present invention is based show that production of the various neutral proteinases with the ability to degrade cartilage occurs even if prostaglandin synthesis is completely blocked.
It has been shown that genetic material can be introduced into mammalian cells by chemical or biologic means. Moreover, the introduced genetic material can be expressed so that high levels of a specific protein can be synthesized by the host cell. Cells retaining the introduced genetic material may include an antibiotic resistance gene thus providing a selectable marker for preferential growth of the transduced cell in the presence of the corresponding antibiotic. Chemical compounds for inhibiting the production of interleukin-1 are also known. U.S. Patent No. 4,778,806 discloses a method of inhibiting the production of interleukin-1 by monocytes and/or macrophages in a human by administering through the parenteral route a 2-2'-[l,3-propan-2-onediyl-bis (thio)] bis-1 H-imidazole or a pharmaceutically acceptable salt thereof. This patent discloses a chemical compound for inhibiting the production of interleukin-1. By contrast, in
the present invention, gene therapy is employed that is capable of binding to and neutralizing interleukin-1.
U.S. Patent No. 4,780,470 discloses a method of inhibiting the production of interleukin-1 by monocytes in a human by administering a 4,5-diaryl-2 (substituted) imidazole. This patent also discloses a chemical compound for inhibiting the production of interleukin-1.
U.S. Patent No. 4,794,114 discloses a method of inhibiting the 5-lipoxygenase pathway in a human by administering a diaryl-substituted imidazole fused to a thiazole, pyrrolidine or piperidine ring or a pharmaceutically acceptable salt thereof. This patent also discloses a chemical compound for inhibiting the production of interleukin-1. U.S. Patent No. 4,870,101 discloses a method for inhibiting the release of interleukin-1 and for alleviating interleukin-1 mediated conditions by administering an effective amount of a pharmaceutically acceptable anti- oxidant compound such as disulfiram, tetrakis [3-(2,6-di- tert-butyl-4-hydroxyphenyl) propionyloxy methyl] methane or 2,4-di-isobutyl-6-(N,N-dimethylamino methyl)-phenol. This patent discloses a chemical compound for inhibiting the release of interleukin-1.
U.S. Patent No. 4,816,436 discloses a process for the use of interleukin-1 as an anti-arthritic agent. This patent states that interleukin-1, in association with a pharmaceutical carrier, may be administered by intra- articular injection for the treatment of arthritis or inflammation. In contrast, the present invention discloses a method of using and preparing a gene that is capable of binding to and neutralizing interleukin-1 as a method of resisting arthritis.
U.S. Patent No. 4,935,343 discloses an immunoassay method for the detection of interleukin-l(^ that employs a monoclonal antibody that binds to interleukin-l ' but does not bind to interleukin-lo*- . This patent discloses that the monoclonal antibody binds to interleukin-1^ and blocks the binding of interleukin-1 to interleukin-1 receptors, and thus blocking the biological activity of interleukin- l . The monoclonal antibody disclosed in this patent may be obtained by production of an immunogen through genetic engineering using recombinant DNA technology. The immunogen is injected into a mouse and thereafter spleen cells of the mouse are immortalized by fusing the spleen cells with myeloma cells. The resulting cells include the hybrid continuous cell lines (hybridomas) that may be later screened for monoclonal antibodies. This patent states that the monoclonal antibodies of the invention may be used therapeutically, such as for example, in the immunization of a patient, or the monoclonal antibodies may be bound to a toxin to form an immunotoxin or to a radioactive material or drug to form a radio pharmaceutical or pharmaceutical.
U.S. Patent No. 4,766,069 discloses a recombinant DNA cloning vehicle having a DNA sequence comprising the human interleukin-1 gene DNA sequence. This patent provides a process for preparing human interleukin-1^5 , and recovering the human interleukin-lφ . This patent discloses use of interleukin-1 as an immunological reagent in humans because of its ability to stimulate T-cells and 3- cells and increase immunoglobulin synthesis.
U.S. No. 4,396,601 discloses a method for providing mammalian hosts with additional genetic capability. This patent provides that host cells capable of regeneration are removed from the host and treated with genetic material including at least one marker which allows
for selective advantage for the host cells in which the genetic material is capable of expression and replication. This patent states that the modified host cells are then returned to the host under regenerative conditions. In the present invention, genetic material may be directly introduced (a) into host cells in vivo or (b) into synoviocytes iri vitro for subsequent transplantation back into the patient's joints.
In spite of these prior art disclosures, there remains a very real and substantial need for a process wherein a gene encoding a truncated interleukin-1 receptor is used to resist the deleterious pathological changes associated with arthritis. More specifically there is a need for such a process where a gene coding for the extracellular interleukin-1 binding domain of the interleukin-1 receptor, capable of binding to and neutralizing interleukin-1 is expressed in host synovial cells in vivo.
SUMMARY OF THE INVENTION The present invention has met the hereinbefore described need. A method of using the gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor is provided for in the present invention. This gene is capable of binding to and neutralizing interleukin-1 in vivo to substantially resist the degradation of cartilage in a mammalian host. Unlike previous pharmacological efforts, the method of this invention employs gene therapy n vivo to address the chronic debilitating effects of arthritis.
A preferred method of using the gene coding for the truncated interleukin-1 receptor of this invention involves employing recombinant techniques to generate a cell line which produces infectious retroviral particles containing the gene coding for the truncated interleukin-1 receptor. The producer cell line is generated by inserting the gene coding into a retroviral vector under the regulation of a suitable eukaryotic promoter, transfecting the retroviral vector containing the gene coding into the retroviral packaging cell line for the production of a viral particle that is capable of expressing the gene coding, and infecting the synovial cells of a mammalian host using the viral particle.
More specifically, the method of using the hereinbefore described gene involves introducing the viral particles obtained from the retroviral packaging cell line directly by intra-articular injection into a joint space of a mammalian host that is lined with synovial cells. The method of using the gene of this invention may be employed both prophylactically and in the treatment of arthritis.
In another embodiment of this invention, a method of using the hereinbefore described gene involves infecting synovial cells in culture with the viral particles and subsequently transplanting the infected synovial cells back into the joint. This method of using the gene of this invention may also be employed prophylactically and in the treatment of arthritis.
In another embodiment of this invention, a method of using the gene coding for an extracellular interleukin-1 binding domain of the interleukin-1 receptor that is capable of binding to and neutralizing interleukin 1 includes employing recombinant techniques to produce a retrovirus vector carrying two genes. The first gene encodes the
extracellular interleukin-1 binding domain of the interleukin receptor, and the second gene encodes for selectable antibiotic resistance. This method of use involves transfecting the retrovirus vector into a 5. retrovirus packaging cell line to obtain a cell line producing infectious retroviral particles carrying the gene.
Another embodiment of this invention provides a method of preparing a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor including synthesizing the gene by a polymerase chain reaction, introducing the amplified interleukin-1 receptor coding sequence into a retroviral vector, transfecting the retroviral vector into a retrovirus packaging cell line and collecting viral particles from the retrovirus packaging cell line.
In another embodiment of this invention, a compound for parenteral administration to a patient in a therapeutically effective amount is provided for that contains a gene encoding an extracellular intεrleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
Another embodiment of this invention provides for a compound for parenteral administration to a patient in a prophylactically effective amount that includes a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
It is an object of the present invention to provide a method of using iri vivo a gene coding for the extracellular interleukin-1 binding domain of the interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1, including interleukin-lt*. and interleukin-lf? .
It is an object of the present invention to provide a method of using a gene iri vivo in a mammalian host that is capable of binding to and neutralizing substantially all isoforms of interleukin-1 and thus, substantially resist the degradation of cartilage and protect surrounding soft tissues of the joint space.
It is an object of the present invention to provide a method of using iri vivo a gene coding for the extracellular interleukin-1 binding domain of the interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1 for the prevention of arthritis in patients that demonstrate a high susceptibility for developing the disease.
It is an object of the present invention to provide a method of using iji vivo a gene coding for an extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1 for the treatment of patients with arthritis. It is an object of the present invention to provide a method of using ij vivo a gene or genes that address the chronic debilitating pathophysiology of arthritis.
It is a further object of the present invention to provide a compound for parenteral administration to a patient which comprises a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
These and other objects of the invention will be more fully understood from the following description of the invention, the referenced drawings attached hereto and the claims appended hereto.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the interleukin-1 binding domain amino acid arrangement.
Figure 2 shows the amino acid and nucleotide sequence of the human and mouse interleukin-1 receptors. Figure 3 shows gene encoding a truncated interleukin-1 receptor inserted into a retroviral vector. DESCRIPTION OF THE PREFERRED EMBODIMENTS As used herein, the term "patient" includes members of the animal kingdom including but not limited to human beings.
The gene and method of using the gene of this invention provide for the neutralization of interleukin-1. Interleukin-1 is a key mediator of cartilage destruction in arthritis. Interleukin-1 also causes inflammation and is a very powerful inducer of bone resorption. Many of these effects result from the ability of interleukin-1 to increase enormously the cellular synthesis of prostaglandin E2, the neutral proteinases— collagenase, gelatinase, and stromelysin, and plasminogen activator. The catabolic effects of interleukin-1 upon cartilage are exacerbated by its ability to suppress the synthesis of the cartilaginous matrix by chondrocytes. Interleukin-1 is present at high concentrations in synovial fluids aspirated from arthritic joints and it has been demonstrated that intra-articular injection of recombinant interleukin-1 in animals causes cartilage breakdown and inflammation.
Interleukin-1 exists as several species, each an unglycosylated polypeptide of 17,000 Daltons. Two species have previously been cloned, interleukin-1 ©c, and interleukin-1-^ . The « • form has a pi of approximately 5, and the <φ form has a pi around 7. Despite the existence of these isoforms, interleukin-1 d and interleukin-1 φ have
substantially identical biological properties and share a common cell surface receptor. The interleukin-1 receptor is a 80kDa (kilodalton) glycoprotein and contains an extracellular, interleukin-1 binding portion of 319 amino acids which are arranged in three immunoglobulin-like domains held together by disulfide bridges as shown in Figure 1. A 21 amino acid trans-membrane domain joins the extracellular portion to the 217 amino acid cytoplasmic domain. Figure 2 shows the amino acid and nucleotide sequence of the human and mouse interleukin-1 receptors. In Figure 2, the 21 amino acid trans-membrane region of the interleukin-1 receptor is marked by the solid line. The position of the 5' and 3' oligonucleotides for PCR are also marked by a short solid line. The lysine amino acid just 5' to the trans-membrane domain to be mutated to a stop codon is marked by a solid circle in Figure 2.
Synovium is by far the major, and perhaps the only, intra-articular source of interleukin-1 in the arthritic joint. Snyovia recovered from arthritic joints secrete high levels of interleukin-1. Both the resident synoviocytes and infiltrating blood mononuclear cells within the synovial lining produce interleukin-1.
The present invention provides a method of using in vivo a gene coding for a truncated form of the interleukin-1 receptor which retains its ability to bind interleukin-1 with high affinity but which is released extracellularly and therefore inactive in signal transduction. The binding of this truncated and modified receptor to interleukin-1 inhibits the intra-articular activity of interleukin-1.
This method of using a gene encoding the extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and
neutralizing interleukin-1 includes employing a retroviral vector carrying a truncated interleukin-1 receptor gene which encodes a truncated and soluble active form of the receptor. The expression of the novel interleukin-1 receptor gene is controlled by regulatory sequences contained within the vector that are active in eukaryotic cells. This recombinant viral vector is transfected into cell lines stably expressing the viral proteins iri trans required for production of infectious virus particles carrying the recombinant vector. These viral particles are used to deliver the recombinant interleukin-1 receptor to the recipient synovial cells by direct virus infection i vivo.
The soluble human interleukin-1 receptor to be inserted into the retroviral vector may be generated by a polymerase chain reaction (PCR). An oligonucleotide complementary to the 5' leader sequence of the human interleukin-1 receptor (GCGGATCCCCTCCTAGAAGCT) and an oligonucleotide complementary to a region just upstream from the trans-membrane domain of the interleukin-1 receptor
(GCGGATCCCATGTGCTACTGG) are used as primers for PCR. The primer for the region of the interleukin-1 receptor adjacent to the trans-membrane domain contains a single base change so that the lys codon at amino acid 319 (AAG) is changed to a stop codon (TAG). By inserting a translation stop codon just upstream from the transmembrane domain, a truncated form of interleukin-1 receptor that is secreted by the cell is generated. A BamHI recognition sequence (GGATCC) is added to the 5' end of the PCR primers, and following amplification, the resulting interleukin-1 receptor fragment is cloned into a BamHI site. A cDNA library from human T- cells is used as a source for the interleukin-1 receptor cDNA. To amplify the appropriate region of the interleukin-1
receptor from the cDNA library, the complementary primers are added to the DNA and 50 cycles of annealing, primer extension and denaturation are performed using a thermocycler and standard PCR reaction conditions well known by those persons skilled in the art. Following amplification of the interleukin-1 soluble receptor using the PCR process, the resulting fragment is digested with BamHI and inserted into the pLJ retroviral vector. The pLJ retroviral vector is available from A. J. Kor an and R. C. Mulligan. See also Proc. Natl. Acad. Sci. , Vol. 84, pp. 2150-2154 (April 1987) co-authored by Alan J. Korman, J. Daniel Frantz, Jack . Strominger and Richard C. Mulligan. Restriction analysis was performed to determine the correct orientation of the insert. The retrovirus vector carrying the truncated interleukin-1 receptor is transferred into the CRIP (Proc. Natl. Acad. Sci. , Vol. 85, pp. 6460-6464 (1988), O. Danos and R. C. Mulligan) packaging cell line using a standard CaP04 transfection procedure and cells wherein the viral vector is stably integrated and is selected on the basis of resistance to the antibiotic G418. The viral vector containing the neomycin resistant (neo-r) gene is capable of imparting resistance of the cell line to G418. The CRIP cell line expresses the three viral proteins required for packaging the vector viral RNAs into infectious particles.
Moreover, the viral particles produced by the CRIP cell line are able to efficiently infect a wide variety of mammalian cell types including human cells. All retroviral particles produced by this cell line are defective for replication but retain the ability to stably integrate into synovial cells thereby becoming an heritable trait of these cells. Virus stocks produced by this method are substantially free of
contaminating helper-virus particles and are also non- pathogenic.
More specifically, the truncated interleukin-1 gene can be inserted into a retroviral vector under the regulation of a suitable eukaryotic promoter such as the retroviral promoter already contained within the gene transfer vector, such as for example, the pLJ vector shown in Figure 3. It will be understood by those persons skilled in the art that other vectors containing different eukaryotic promoters may also be utilized to obtain a generally maximal level of interleukin-1 receptor expression. The vectors containing the truncated, and modified interleukin-1 receptor will be introduced into a retroviral packaging cell line (CRIP) by transfection and stable transformants isolated by selection for the expression of the neomycin resistance gene also carried by the pLJ vector. The CRIP cell line expresses all the proteins required for packaging of the exogenous retroviral RNA. Viral particles produced by the G418-selected CRIP cell lines will carry a recombinant retrovirus able to infect mammalian cells and stably express the interleukin-1 truncated receptor. The viral particles are used to infect synovial cells directly _in vivo by injecting the virus into the joint space. Another embodiment of this invention provides a method for using the hereinbefore described viral particles to infect in culture synovial cells obtained from the lining of the joint of a mammalian host. The advantage of the • infection of synovial cells in culture is that infected cells harboring the interleukin-1 receptor retroviral construct can be selected using G418 for expression of the neomycin resistance gene. The infected synovial cells expressing the interleukin-1 receptor can then be
transplanted back into the joint by intra-articular injection. The transplanted cells will express high levels of soluble interleukin-1 receptor in the joint space thereby binding to and neutralizing substantially all isoforms of interleukin-1, including interleukin-l«^ and interleukin- l φ •
The method used for transplantation of the synovial cells within the joint is a routine and relatively minor procedure used in the treatment of chronic inflammatory joint disease. Although synovium can be recovered from the joint during open surgery, it is now common to perform synovectomies, especially of the knee, through the arthroscope. The arthroscope is a small, hollow rod inserted into the knee via a small puncture wound. In addition to permitting the intra-articular insertion of a fibre-option system, the arthroscope allows access to surgical instruments, such that snyovial tissue can be removed arthroscopically. Such procedures can be carried out under "spinal" anesthetic and the patient allowed home the same day. In this manner sufficient synovium can be obtained from patients who will receive this gene therapy.
The synovial cells (synoviocytes) contained within the excised tissue may be aseptically recovered by enzymic digestion of the connective tissue matrix. Generally, the synovium is cut into pieces of approximately 1 millimeter diameter and digested sequentially with trypsin (0.2% w/v in Grey's Balanced Salt Solution) for 30 minutes at 37° centigrade, and collagenase (0.2% w/v in Grey's Balanced Salt Solution) for 2 hours at 37° centigrade. Cells recovered from this digestion are seeded into plastic culture dishes at a concentration of 104 - 105 cells per square centimeter with Hank's F12 medium supplemented with 10% foetal bovine serum and antibiotics. After 3-7 days,
the culture medium is withdrawn. Non-adherent cells such as lymphocytes are removed by washing with Grey's Balanced Salt Solution and fresh medium added. The adherent cells can now be used as they are, allowed to grow to confluency or taken through one or more subcultures. Subcultivating expands the cell number and removes non-dividing cells such as macrophages.
Following genetic manipulation of the cells thus recovered, they can be removed from the culture dish by trypsinising, scraping or other means, and made into a standard suspension. Grey's Balanced Salt Solution or other isogenic salt solutions of suitable composition, or saline solution are suitable carriers. A suspension of cells can then be injected into the recipient mammalian joint. Intra- articular injections of this type are routine and easily carried out in the doctor's office. No surgery is necessary. Very large numbers of cells can be introduced in this way and repeat injections carried out as needed.
Another embodiment of this invention is the gene produced by the hereinbefore described method of preparation. This gene carried by the retrovirus may be incorporated in a suitable pharmaceutical carrier, such as for example, buffered physiologic saline, for parenteral administration. This gene may be administered to a patient in a therapeutically effective dose. More specifically, this gene may be incorporated in a suitable pharmaceutical carrier at a therapeutically effective dose and administered by intra-articular injection.
In another embodiment of this invention, this gene may be administered to patients as a prophylactic measure to prevent the development of arthritis in those patients determined to be highly susceptible of developing this disease. More specifically, this gene carried by the
retrovirus may be incorporated in a suitable pharmaceutical carrier at a prophylactically effective dose and administered by parenteral injection, including intra- articular injection. It will be appreciated by those persons skilled in the art that this invention provides a method of using and a method of preparing a gene encoding an extra cellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1, and thus substantially protect cartilage of a mammalian host from pathological degradation. In addition, it will be understood by those persons skilled in the art that the method of using the gene of this invention will reduce inflammation, protect soft tissues of the joint and suppress the loss of bone that occurs in patients suffering with arthritis.
It will be appreciated by those persons skilled in the art that the viral vectors employed in the hereinbefore described invention may be employed to transfect synovial cells in vivo or in culture, such as by direct intra- articular injection or transplantation of autologous synovial cells from the patient transduced with the retroviral vector carrying the truncated interleukin-1 receptor gene. Whereas particular embodiments of this invention have been described above for purposes of illustration, it will be evident to those persons skilled in the art that numerous variations of the details of the present invention may be made without departing from the invention as defined in the appended claims.
Claims
1. A method of using a gene coding for a truncated interleukin-1 receptor to resist deleterious pathological changes associated with arthritis which comprises: employing recombinant techniques to produce a retroviral packaging cell line which contain said gene coding for said truncated interleukin-1 receptor; inserting said gene coding for said truncated interleukin-1 receptor into a retroviral vector wherein said retroviral vector is under the regulation of a suitable eukaryotic promoter; transfecting said retroviral vector containing said gene coding for said truncated interleukin-1 receptor into said retroviral packaging cell line for the production of a viral particle that is capable of expressing said gene coding for said truncated interleukin-1 receptor; and infecting synovial cells of a mammalian host using said viral particle obtained from said retroviral packaging cell line.
2. The method of Claim 1 employing said gene having DNA that is capable of replication and expression in said synovial cells lining a joint space of said mammalian host.
3. The method of Claim 1 including employing said method to substantially prevent the development of arthritis in a patient having a high susceptibility of developing arthritis.
4. The method of Claim 1 including employing said method to treat an arthritic patient.
5. The method of Claim 1 including effecting the infection of said synovial cells of a mammalian host by introducing said viral particle directly into said synovial cells lining a joint space of said mammalian host.
6. The method of Claim 5 including effecting said introduction of said viral particle by parenteral injection.
7. The method of Claim 5 including effecting said introduction of said viral particle by intra-articular injection.
8. The method of Claim 1 including effecting said infection of said synovial cells of a mammalian host by introducing said viral particles directly into synovial cells in culture to form transduced synovial cells which may be subsequently transplanted into a patient's joint.
9. The method of Claim 8 including effecting said transplantation of said transduced synovial cells into a patient's joint by employing intra-articular injection.
10. The method of Claim 1 including effecting said infection of said synovial cells of a mammalian host by introducing said viral particles to outer synovial cells.
11. A method of using a gene having a coding for a extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 which comprises: employing recombinant techniques to produce a retrovirus vector carrying two genes wherein a first gene encodes said extracellular interleukin-1 binding domain of said interleukin-1 receptor and a second gene encodes for selectable antibiotic resistance; and transfecting said retrovirus vector into a retrovirus packaging cell line to obtain a cell line producing nonpathogenic, replication deficient but integration competent, amphitrophic infectious retroviral particles carrying said gene.
12. The method of Claim 11 including initiating introduction of said gene by infection with said retroviral particles from said cell line directly into synovial cells lining a joint space of a mammalian host.
13. The method of Claim 11 including initiating introduction of said gene by transduction of autologous synovial cells in culture, selecting a synoviocyte cell line by treatment of cultures with antibiotic, and transplanting said selected synoviocyte cells into an affected mammalian joint.
14. The method of Claim 11 wherein effecting said introduction of said viral particles is by parenteral injection.
15. The method of Claim 11 wherein effecting said introduction of said viral particles is by intra-articular injection.
16. A method for preparing a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to an neturalizing interleukin-1 which comprises: synthesizing said gene by a polymerase chain reaction of said extracellular interleukin-1 binding domain including a signal sequence for secretion of a protein; introducing amplified interleukin-1 receptor coding sequence into a retroviral vector; transfecting said retroviral vector into a amphitrophic retrovirus packaging cell line; and collecting viral particles obtained from said retrovirus packaging cell line, wherein said viral particles contain said gene.
17. The gene prepared by the process of Claim 16.
18. A compound for parenteral administration to a patient in a therapeutically effective amount which comprises a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor and a suitable pharmaceutical carrier.
19. A compound for parenteral administration to a patient in a prophylactically effective amount which comprises a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor and a suitable pharmaceutical carrier.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US63098190A | 1990-12-20 | 1990-12-20 | |
| US630981 | 1990-12-20 | ||
| PCT/US1991/009231 WO1992011359A1 (en) | 1990-12-20 | 1991-12-09 | A truncated interleukin-1 receptor gene for the treatment of arthritis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP0563239A1 true EP0563239A1 (en) | 1993-10-06 |
| EP0563239A4 EP0563239A4 (en) | 1994-10-12 |
Family
ID=24529337
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP19920902630 Withdrawn EP0563239A4 (en) | 1990-12-20 | 1991-12-09 | A truncated interleukin-1 receptor gene for the treatment of arthritis. |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP0563239A4 (en) |
| JP (1) | JPH06504440A (en) |
| CA (1) | CA2098848A1 (en) |
| WO (1) | WO1992011359A1 (en) |
Families Citing this family (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6228356B1 (en) | 1990-12-20 | 2001-05-08 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints |
| US6156304A (en) * | 1990-12-20 | 2000-12-05 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Gene transfer for studying and treating a connective tissue of a mammalian host |
| US5858355A (en) * | 1990-12-20 | 1999-01-12 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | IRAP gene as treatment for arthritis |
| US6413511B1 (en) * | 1990-12-20 | 2002-07-02 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Cartilage alterations by administering to joints chondrocytes comprising a heterologous polynucleotide |
| US6159464A (en) * | 1990-12-20 | 2000-12-12 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints |
| US5792751A (en) * | 1992-04-13 | 1998-08-11 | Baylor College Of Medicine | Tranformation of cells associated with fluid spaces |
| JPH07508988A (en) * | 1992-07-13 | 1995-10-05 | ベイラー・カレッジ・オブ・メディシン | Targeting somatic gene therapy to joints |
| EP0701563A4 (en) * | 1993-03-08 | 1997-07-02 | Univ Pittsburgh | Gene transfer for treating a connective tissue of a mammalian host |
| US5645829A (en) * | 1993-06-18 | 1997-07-08 | Beth Israel Hospital Association | Mesothelial cell gene therapy |
| AU7516594A (en) * | 1993-07-28 | 1995-02-28 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Pre-binding of retroviral vector particles with complement components to enable the performance of human gene therapy (in vivo) |
| EP0690673A4 (en) * | 1993-12-14 | 1996-05-29 | Univ Pittsburgh | Systemic gene treatment of connective tissue diseases |
| JPH083058A (en) * | 1994-06-17 | 1996-01-09 | Hoechst Japan Ltd | New medicine for bone metabolic disease |
| DK0807183T3 (en) * | 1994-08-26 | 2001-03-05 | Aventis Pharma Gmbh | Gene therapy of diseases caused by the immune system by a cell-specific active substance regulated by cellec |
| US6096728A (en) * | 1996-02-09 | 2000-08-01 | Amgen Inc. | Composition and method for treating inflammatory diseases |
| US6294170B1 (en) | 1997-08-08 | 2001-09-25 | Amgen Inc. | Composition and method for treating inflammatory diseases |
| JP2001514235A (en) * | 1997-09-02 | 2001-09-11 | カイロン コーポレイション | Compositions and methods for treating arthritis utilizing gene therapy |
| EP1939300A1 (en) | 1999-05-28 | 2008-07-02 | Targeted Genetics Corporation | Methods and compositions for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
| US6537540B1 (en) | 1999-05-28 | 2003-03-25 | Targeted Genetics Corporation | Methods and composition for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
| WO2001013960A1 (en) * | 1999-08-20 | 2001-03-01 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Methods for in vivo gene delivery to sites of cartilage damage |
| WO2002083080A2 (en) * | 2001-04-17 | 2002-10-24 | Genetix Pharmaceuticals, Inc. | Method of treating arthritis using lentiviral vectors in gene therapy |
| US7619066B2 (en) | 2004-04-02 | 2009-11-17 | Amgen Inc. | IL-1ra variants |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0318296A2 (en) * | 1987-11-25 | 1989-05-31 | Immunex Corporation | Interleukin-1 receptors |
| WO1989004838A1 (en) * | 1987-11-25 | 1989-06-01 | Immunex Corporation | Interleukin-1 receptors |
-
1991
- 1991-12-09 JP JP4502854A patent/JPH06504440A/en active Pending
- 1991-12-09 WO PCT/US1991/009231 patent/WO1992011359A1/en not_active Application Discontinuation
- 1991-12-09 CA CA002098848A patent/CA2098848A1/en not_active Abandoned
- 1991-12-09 EP EP19920902630 patent/EP0563239A4/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0318296A2 (en) * | 1987-11-25 | 1989-05-31 | Immunex Corporation | Interleukin-1 receptors |
| WO1989004838A1 (en) * | 1987-11-25 | 1989-06-01 | Immunex Corporation | Interleukin-1 receptors |
Non-Patent Citations (5)
| Title |
|---|
| BRAIN RESEARCH BULLETIN vol. 24, no. 6 , 1990 pages 787 - 792 M. TSUDA ET AL. 'Retrovirus-mediated gene transfer into mouse cerebellar primary culture and its application to the neural transplantation.' * |
| NATURE vol. 320 , 20 March 1986 , LONDON, GB pages 213 - 214 M. ROBERTSON 'Gene therapy. Desperate appliances.' * |
| PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA vol. 86, no. 23 , December 1989 , WASHINGTON, DC, USA pages 9079 - 9083 P. ROUX ET AL. 'A versatile and potentially general approach to the targeting of specific cell types by retroviruses: Application to the infection of human cells by means of major histocompatibility complex class I and class II antigens by mouse ecotropic murine leukemia virus-derived viruses.' * |
| SCIENCE vol. 244, no. 4910 , 16 June 1989 , WASHINGTON, DC, USA pages 1275 - 1281 T. FRIEDMANN 'Progress toward human gene therapy.' * |
| See also references of WO9211359A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO1992011359A1 (en) | 1992-07-09 |
| EP0563239A4 (en) | 1994-10-12 |
| JPH06504440A (en) | 1994-05-26 |
| CA2098848A1 (en) | 1992-06-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0563239A1 (en) | A truncated interleukin-1 receptor gene for the treatment of arthritis | |
| EP1932544B1 (en) | Compositions for treating a connective tissue of a mammalian host | |
| US7037492B2 (en) | Gene transfer for studying and treating a connective tissue of a mammalian host | |
| EP0701563A1 (en) | Gene transfer for treating a connective tissue of a mammalian host | |
| US6048524A (en) | In vivo production and delivery of erythropoietin for gene therapy | |
| EP0806967A1 (en) | Gene transfer for treating a connective tissue of a mammalian host | |
| Chen et al. | Potent antitumour activity of a new class of tumour-specific killer cells | |
| JP3784063B2 (en) | Enhanced xenograft resistance and porcine cytokines | |
| US6670178B1 (en) | In Vivo production and delivery of insulinotropin for gene therapy | |
| JPH07504812A (en) | Novel polypeptides to promote cell attachment | |
| JPH08508415A (en) | Systemic gene therapy for connective tissue disease | |
| JP2014221055A (en) | Integrin heterodimer and subunit thereof | |
| US6159464A (en) | Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints | |
| US6228356B1 (en) | Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints | |
| US6475781B1 (en) | Trans-dominant suppressor genes for oligomeric proteins | |
| Ueblacker et al. | In vivo analysis of retroviral gene transfer to chondrocytes within collagen scaffolds for the treatment of osteochondral defects | |
| EP0781344B1 (en) | Novel implant and novel vector for the treatment of acquired diseases | |
| Dao et al. | Molecular control of cell cycle progression in primary human hematopoietic stem cells: methods to increase levels of retroviral-mediated transduction | |
| Ghivizzani et al. | Gene therapy approaches for treating rheumatoid arthritis | |
| DE60120131T2 (en) | Antiangiogenic properties of vascostatin and fragments and variants thereof | |
| US6531124B1 (en) | In vivo production and delivery of insulinotropin for gene therapy | |
| AU627710B2 (en) | Rapid immunoselection cloning method | |
| Evans et al. | Gene therapy with the interleukin-1 receptor antagonist for the treatment of arthritis | |
| Reinecke et al. | Current status of gene therapy for rheumatoid arthritis | |
| DiGirolamo | The potential of human bone marrow stromal cells as vehicles for ex vivo gene therapy applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 19930715 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU MC NL SE |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 19940824 |
|
| AK | Designated contracting states |
Kind code of ref document: A4 Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU MC NL SE |
|
| RBV | Designated contracting states (corrected) |
Designated state(s): CH DE ES FR GB IT LI NL SE |
|
| 17Q | First examination report despatched |
Effective date: 19980623 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20010911 |