CA2098848A1 - Truncated interleukin-1 receptor gene for the treatment of arthritis - Google Patents

Truncated interleukin-1 receptor gene for the treatment of arthritis

Info

Publication number
CA2098848A1
CA2098848A1 CA002098848A CA2098848A CA2098848A1 CA 2098848 A1 CA2098848 A1 CA 2098848A1 CA 002098848 A CA002098848 A CA 002098848A CA 2098848 A CA2098848 A CA 2098848A CA 2098848 A1 CA2098848 A1 CA 2098848A1
Authority
CA
Canada
Prior art keywords
interleukin
gene
receptor
binding
extracellular
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002098848A
Other languages
French (fr)
Inventor
Joseph C. Glorioso
Christopher H. Evans
Paul D. Robbins
Geethani Bandara
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pittsburgh Of Commonwealth System Of Higher Educatio, University of
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2098848A1 publication Critical patent/CA2098848A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13045Special targeting system for viral vectors

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Rheumatology (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Pain & Pain Management (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The subject invention concerns a method of using in vivo a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 which includes employing recombinant techniques to produce a cell line under the control of a suitable eukaryotic promoter having the gene coding for the extracellular interleukin-1 binding domain of the interleukin-1 receptor; and initiating transfection of DNA of the gene by introducing viral particles obtained from the cell line directly into synovial cells lining a joint space of a mammalian host. Alternatively, synovial cells from the patient's joint may be transduced with the retroviral vector carrying the therapeutic gene and a selectable marker for selection of only transduced cells, and the now therapeutic autologous cells may be introduced back into the joint by transplantation.
Additionally, a method of preparing a gene encoding an extracellular interleukin-1 receptor binding domain of an interleukin-1 that is capable of binding to and neutralizing interleukin-1 is disclosed. A compound for parenteral administration to a patient in prophylactically or therapeutically effective amounts containing the gene of the invention and a suitable pharmaceutical carrier is also provided.

Description

A TRUNCATED INTERLEUKIN.I RECEPTOR GENE FOR THE TRE.1TMENT OF AR-TH RITIS
BACKGROUND OF THE INVENTION
Field of the Invention The present invention relates to a method of using a gene encoding a truncated interleukin-1 receptor to resist the deleterious pathological changes associated. with arthritis. More specifically, this invention provides a method Wherein a~gene coding for an extracellular interleukin-1 binding domain of an interleukin-1 receptor is introduced into synovial cells of a mammalian host _in vivo l0 for neutralizing the destructive activity of interleukin-1 upon cartilage and other soft tissues. As an alternative, the patients own cells are transduced _in vitro and introduced back into the affected joint, using surgical transplantation procedures.
Brief Description of the Prior Art Arthritis involves inflammation of a joint that is usually accompanied by pain and frequently changes in struc-ture. Arthritis may result from or be associated with a number of conditions including infection, immunological disturbances, trauma and degenerative joint diseases such as, for example, osteoarthritis. The biochemistry of cartilage degradation in joints and~cellular changes have received considerable investigation.
In a healthy joint, cells in cartilage (chondrocytes) and the surrounding synovium (synoviocytes) are in a resting state. In this resting state, these cells secrete basal levels of prostaglandin EZ and various neutral proteinases, such as, for example, collagenase, gelatinase and stromelysin, with the ability to degrade cartilage.
During the development of an arthritic condition, these cells become activated. In the activated state, synoviocytes and chondrocytes synthesize and secrete large amounts of prostaglandin EZ and neutral proteinases.
In efforts to identify pathophysiologically relevant cell activators, it has been known that the cytokine interleukin-1 activates chondrocytes and synovio~ytes and induces cartilage breakdown _in vitro and _in vivo. Additionally, interleukin-l is a growth factor for synoviocytes and promotes their synthesis of matrix, two l0 properties suggesting the involvement of interleukin-1 in the synovial hypertrophy that accompanies arthritis. In contrast, interleukin-1 inhibits cartilaginous matrix synthesis by chondrocytes, thereby suppressing repair of cartilage. Interleukin-1 also induces bone resorption and thus may account for the loss of bone density seen in rheumatoid arthritis. Interleukin-1 is inflammatory, serves as a growth factor for lymphocytes, is a chemotactic factor and a possible activator of polymorphonuclear leukocytes (PMNs). When present in a sufficient concentration;
2o interleukin-1 may cause Fever, muscle wasting and sleepiness.
The major source of interleukin-1 in the joint is the synovium. Inte-rleukin-1 is secreted by the resident synoviocytes, which are joined under inflammatory conditions by macrophages and other white blood cells.
Nuch attention has been devoted to the development of a class of agents identified as the "Non-Steroidal Anti-Inflammatory Drugs" (hereinafter "NSAIDs"). The NSAIDs inhibit cartilage synthesis and repair and control inflammation. The mechanism of action of the NSAIDs appears to be associated principally with the inhibitiow of prosta-glandin synthesis in body tissues. Most of this development has involved the synthesis of better inhibitors of cyclo-oxygenase, a key enzyme that catalyzes the formation of prostaglandin precursors (endoperoxides) from arachidonic acid. The anti-inflammatory effect of the NSAIDs is thought to be due in part to inhibition of prostaglandin synthesis and release during inflammation. Prostaglandins are also believed to play a role in modulating the rate and extent of leukocyte infiltration during inflammation. The NSAIDs include, such as, for example, acetylsalicylic acid (aspirin), Fenoprofen calcium (Nalfon~ Pulvules~, aista i0 Products Company)., ibuprofen (Motrin~, The Upjohn Company).
and indomethacin (Indocin~, Merck, Sharp & Dohme).
In contrast, the studies upon which the present invention is based show that production of the various neutral proteinases with the ability to degrade cartilage occurs even if prostaglandin synthesis is completely blocked.
It has been shown that genetic material can be introduced into mammalian cells by chemical or biologic means. Moreover, the introduced genetic material can be 2o expressed so that high levels of a specific protein can be synthesized by the host cell. Cells retaining the introduced genetic material may include an antibiotic resistance gene thus providing a selectable marker for preferential growth of the transduced cell in the presence of the corresponding antibiotic. Chemical compounds for inhibiting the production of interleukin-l are also known.
U.S. Patent No. 4,778,806 discloses a method of inhibiting the production of interleukin-1 by monocytes and/or macrophages in a human by administering through the parenteral route a 2-2'-(1,3-propan-2-onediyl-bis (thio)~
bis-1 H-i~idazole or a pharmaceutically acceptable salt thereof. This patent discloses a chemical compound for inhibiting the production of interleukin-1. Hy contrast, in the present invention, gene therapy is employed that is capable of binding to and neutralizing interleukin-1.
U.S. Patent No. 4,780,470 discloses a method of inhibiting the production of interleukin-1 by monocytes in a human by administering a 4,5-diaryl-2 (substituted) imidazole. This patent also discloses a chemical compound for inhibiting the production of interleukin-1.
0.S. Patent No. 4,?94;114 discloses a method of inhibiting the 5-lipoxygenase pathway in a human by administering a diaryh-substituted imidazole fused to a thiazole. pyrrolidine or piperidine ring or a pharmaceutically acceptable salt thereof. This patent also discloses a chemical compound for inhibiting the production of interleukin-1.
U.S. Patent No. 4,870,101 discloses a method for inhibiting the release of fnterleukin-1 and for alleviating interleukin-1 mediated conditions by administering an effective amount of a pharmaceutically acceptable anti-oxidant compound such as disulfiram, tetrakis [3-(2,6-di-2o tert-butyl-4-hydroxyphenyl) propionyloxy methyl] methane or 2,4-di-isobutyl-6-(N,N-dimethylamino methyl)-phenol. This patent discloses a chemical compound for inhibiting the release of interleukin-1.
U.S....Patent No. 4,816,436 discloses a process for the~use of interleukin-1 as an anti-arthritic agent. This patent states that interleukin-1, in association with a pharmaceutical carrier, may be administered by intra-articular injection for the treatment of arthritis or inflammation. In contrast, the present invention discloses a method of using and preparing a gene that is capable of binding to and neutralizing interleukin-1 as a method of resisting arthritis.

-S-U.S. Patent No. 4,935,343 discloses an immunoassay method for the detection of interleukin-lp that employs a monoclonal antibody that binds to interleukin -la but does not bind to interleukin -la . This patent discloses that the monoclonal antibody binds to interleukin-la and blocks the binding of interleukin -la to interleukin-lareceptors, and thus blocking the biological activity of interleukin -1R . The monoclonal antibody disclosed in this patent may be obtained by production of an immunogen through genetic engineering using recombinant DNA technology. The immunogen is injected into a mouse and thereafter spleen cells of the mouse are immortalized by fusing the spleen cells with myeloma cells. The resulting cells include the hybrid continuous cell lines (hybridomas) that may be later screened for monoclonal antibodies. This patent states that the monoclonal antibodies of the invention may be used therapeutically, such as for example, in the immunization of a patient. or the monoclonal antibodies may be bound to a toxin to form an immunotoxin or to a radioactive material or 10 drug to~form a radio ph8rmaceutical or pharmaceutical.
U.S. Patent No: 4,766,069 discloses a recombinant DNA cloning vehicle having a DNA sequence comprising the human interleukin-1 gene DNA sequence. This patent provide=_ a process for preparing human interleukin-1R , and recovering the human interleukin -1~ , This patent discloses use of interleukin-1 as an immunological reagent in humans because of its ability to stimulate T-cells and 3-cells and increase immunoglobulin synthesis.
U.S. No. 4,396,601 discloses a method for providing mammalian hosts with additional genetic capability. This patent provides that host cells capable ~:
regeneration are removed from the host and treated with genetic material including at least one marker which allows for selective advantage for the host cells in which the genetic material is capable of expression and replication.
This patent states that the modified host cells are then returned to the host under regenerative conditions. In the present invention, genetic material may be directly introduced (a) into host cells in vivo or (b) into synoviocytes in vitro for subsequent transplantation back into the patient's joints.
In spite of these prior art disclosures, there l0 remains a very real and substantial need for a process wherein a gene encoding a truncated interleukin-1 receptor is used to resist the deleterious pathological changes associated with arthritis. More specifically there is a need for such a process where a gene coding for the extracellular interleukin-1 binding domain of the interleukin-1 receptor, capable of binding to and cieutralizing interleukin-1 is expressed in host synovial cells in vivo.
SUMMARY OF TFiE INVENTION
The present invention has met the hereinbefore described need. A method of using the gene encoding an extracellular interleukin-1 binding docaain of the interleukin-1 receptor is provided for in the present invention. This gene is capable of binding to and neutralizing interleukin-1 in vivo to substantially resist the degradation of cartilage in a mammalian host. Unlike previous pharmacological efforts, the method of this invention employs gene therapy in vivo to address the chronic debilitating effects of arthritis.

A preferred method of using the gene coding for the truncated interleukin-1 receptor of this invention involves employing recombinant techniques to generate a cell line which produces infectious retroviral particles 5 containing the gene coding for the truncated interleukin-1 receptor. The producer cell line is generated by inserting the gene coding into a retroviral vector under the regulation of a suitable eukaryotic promoter, transfecting the retroviral vector containing the gene coding into the l0 retroviral packaging cell line for the production of a viral particle that is capable of expressing the gene coding, and infecting the synovial cells of a mammalian host using the viral particle.
More specifically, the method of using the 15 hereinbefore described gene involves introducing the viral particles obtained from the retroviral packaging cell line directly by intra-articular injection into a joint space of a mammalian host that is lined with synovial cells. The method of using the gene of this invention may be employed 20 both prophylactically and in the treatment of arthritis.
In another embodiment of this invention, a method of using the hereinbefore described gene involves infecting synovial cells in culture with the viral particles and subseguently transplanting the infected synovial cells back 25 into the joint. This method of using.the gene of this invention may also be employed prophylactically and in the treatment of arthritis.
In another embodiment of this invention, a method of using the gene coding for an extracellular interleukin-' 30 binding domain of the interleukin-1 receptor that is capable of binding to and neutralizing interleukin 1 includes employing recombinant techniques to produce a retrovirus vector carrying two genes. The first gene encodes the - g -extracellular interleukin-1 binding domain of the interleukin receptor, and the second gene encodes for selectable antibiotic resistance. This method of use involves transfecting the retrovirus vector into a retrovirus packaging cell line to obtain a cell line producing infectious retroviral particles carrying the gene.
Another embodiment of this invention provides a method of preparing a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor including synthesizing the gene by a polymerase chain reaction, introducing the amplified interleukin-1 receptor coding sequence into a retroviral vector, transfecting the retroviral vector into a retrovirus packaging cell line and collecting viral particles from the retrovirus packaging cell line.
In another embodiment of this invention, a pharmaceutical composition for parenteral administration to a patient in a therapeutically effective amount is provided for that contains a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
Another embodiment of this invention provides for a pharmaceutical composition for parenteral administration to a patient in a prophylactically effective amount that includes a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
In one aspect, the invention provides for the use of a gene encoding soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 for the prevention and/or treatment of cartilage degradation, - 8a -deleterious pathological changes associated with arthritis, arthritis, and inflammation.
In another aspect, the invention provides a genetically modified synovial cell that expresses a gene encoding a soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1.
In a further aspect, the invention provides a pharmaceutical composition comprising a synovial cell as described herein and a pharmaceutical carrier.
It is an object of the present invention to provide a method of using in vivo a gene coding for the extracellular interleukin-1 binding domain of the interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1, including interleukin-la and interleukin-1(3 .

.,.
_g_ It is an object of the present invention to provide a method of using a gene is vivo in a mammalian hose that is capable of binding to and neutralizing substantially all isoforms of interleukin-1 and thus, substantially resist the degradation of cartilage and protect surrounding soft tissues of the joint space.
It is an object of the present invention to provide a method of using in vivo a gene coding for the extracellular interleukin-1 binding domain of the to interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1 for the prevention of arthritis in patients that demonstrate a high susceptibility for developing the disease.
It is an object of the present invention to provide a method of using in vivo a gene coding for an extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing substantially all isoforms of interleukin-1 for the treatment of patients with arthritis.
It is an object of the present invention to provide a method of using in vivo a gene or genes that address the chronic debilitating pathophysiology of arthritis.
It is a further object of the present invention to provide a compound for parenteral administration to a patient which comprises a gene encoding an extracellular interleukin-1 binding domain of the interleukin-1 receptor and a suitable pharmaceutical carrier.
These and other objects of the invention will be 3o more fully understood from the following description of the invention. the referenced drawings attached hereto and the claims appended hereto.

.. . , BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the interleukin-1 binding domain amino acid arrangement.
Figure 2 shows the amino acid and nucleotide sequence of the human and mouse interleukin-1 receptors.
Figure 3 shows gene encoding a truncated interlet~,kin-1 receptor inserted into a retroviral vector.
DESCRIPTION OF THE'PREFERRED EM80DIMENTS
As used.herein. the term "patient" includes l0 members-of the animal kingdom.including but not limited to human beings.
The gene and method of using the gene of this invention provide for the neutralization of interleukin-1:
Interleukin-1 is a key mediator of cartilage destruction in arthritis. Interleukin-1 also causes inflammation and is a very powerful inducer of bone resorption. Many of these effects result from the ability of interleukin-1 to increase enormously the cellular synthesis of prostaglandin E2, the neutral proteinases-- collagenase, gelatinase, and 2o stromelysin, and plasminogen activator. The catabolic effects of interleukin-1 upon cartilage are exacerbated by its ability to suppress the synthesis of the cartilaginous matrix by chondrocytes. Interleukin-1 is present at high concentrations in synovial fluids aspirated,from arthritic joints.and.it has been demonstrated that intra-articular injectioa.of recombinant interleukin-1 in animals causes cartilage breakdown and inflammation.
Interleukin-1 exists as several species, each an unglycosylated polypeptide of 17,000 Oaltons. Two species have previously been cloned, interleukin -la and interleukin~-lp . The a form has a pI of approximately 5, and the ~ form has a-pI around 7. Despite the existence ci these isoforms. interleukin -la and interleukin -lei have Y n 1 substantially identical biological properties and share a common cell surface receptor. The interleukin-1 receptor is a 80kDa (kilodalton) glycoprotein and contains an extracellular. interleukin-1 binding portion of 319 amino acids which are arranged in three immu~oglobulin-like domains held together by disulfide bridges as shown in Figure 1. A 21 amino acid traps-membrane domain joins the extracellular portion to the 217 amino acid cytoplasmic domain. Figure 2 shows the amino acid and nucleotide sequence of the human and mouse interleukin-1 receptors. In Figure 2, the 21 amino acid traps-membrane region of the interleukin-1 receptor is marked by the solid line. The position of the 5' and 3' oligonucleotides for PCR are also marked by a short solid line. The lysine amino acid just 5' to the traps-membrane domain to be mutated to a stop codon is marked by a solid circle in Figure 2.
Synovium is by far the major, and perhaps the only, intra-articular source of interleukin-1 in the arthritic joint. Snyovia recovered from arthritic joints secrete high levels of interleukin-1. Hoth the resident synoviocytes and infiltrating blood mononuclear cells within the synovial lining produce interleukin-1.
The present invention provides a method of using in vivo a gene coding for a truncated form of the interleukin-1 receptor which retains its ability to bind interleukin-1 with high afginity but which is released a:tracellularly and therefore inactive in signal transduction. The binding of this truncated and modified receptor to interleukin-1 inhibits the intra-articular activity of interleukin-1.
This method of using a gene encoding the extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and ~~

neutralizing interleukin-1 includes employing a tetroviral vector carrying a truncated interleukin-1 receptor gene which encodes a truncated arid soluble active form of the receptor. The expression of the novel interleukin-1 receptor gene is controlled by regulatory sequences contained within the vector that are active in eukaryotic cells.~~~This recombinant viral vector is transfected into cell lines stably expressing the viral proteins _in traps required for production of infectious virus particles carrying the recombinant vector. These viral particles are used to deliver the recombinant interleukin-1 receptor to the recipient synovial cells by direct virus infection _in vivo.
The soluble human interleukin-1 receptor to be inserted into the retroviral vector may be generated by a polymerase chain reaction (PCR). An oligonucleotide complementary to the 5' leader sequence of the human interleukin-1 receptor (GCGGATCCCCTCCTAGAAGCT) and an oligonucleotide complementary to a region just upstream from 2o the traps-membrane domain of the interleukin-1 receptor (GCGGATCCCATGTGCTACTGG) are used as primers for PCR. The primer for the region of the interleukin-1 receptor adjacent to the traps-membrane domain contains a single base change so that the lys codon at amino.acid 319 (AAG) is changed to a stop codon (TAG). By inserting a translation stop codon just upstream from the transmembrane domain, a truncated form of interleukin-1 receptor. that is secreted by the cell is generated.. A HamBI recognition sequence (GGATCC) is added to the 5' end of the PCR primers, and following amplification, the resulting interleukin-1 receptor fragmen=
is cloned into a BamBI site. A cDNA library from human T-cells is used as a source for the interleukin-1 receptor cDNA. To amplify the appropriate region of the interleuki::-.

receptor from the cDNA library, the complementary primers are added to the DNA and 50 cycles of annealing, primer extension and denaturation are performed using a thermocycler and standard PCR reaction conditions well known by those persons skilled in the art. Following amplification of the interleukin-1 soluble receptor using the PCR~process, the resulting fragment is digested with HamBI and inserted into the pLJ retroviral vector. The pLJ
retroviral vector.is available from A. J. Korman and R. C.
1o Mulligan. See also Proc. Natl. Acad. Sci:, Vol. 84, pp.
2150-2154 (April 1987) co-authored by Alan J. Korman, J.
Daniel Frantz, Jack L. Strominger and Richard C. Mulligan.
Restriction analysis was performed to determine thecorrect orientation of the insert.
The retrovirus vector carrying the truncated interleukin-1 receptor is transferred into the CRIP (Proc.
Natl. Acad. Sci., Vol. 85, pp. 6460-6464 (1988), O. Danos and R. C. Mulligan) packaging cell line using a standard CaP04 transfection procedure and cells wherein the viral vector is stably integrated and is selected on the basis of resistance to the antibiotic 6418. The viral vector containing the neomycin resistant (neo-r) gene is capable of imparting resistance of the cell line to 6418. The CRIP
cell line expresses the three viral proteins required for packaging the vector viral RNAs into infectious particles.
Moreover, the viral particles produced by the CRIP cell line are able to efficiently infect a.wide variety of mammalian cell types including human cells. All retroviral particles produced by this cell line are defective for replication but retain the ability to stably integrate into synovial cells thereby becoming an heritable trait of these cells. Virus stocks produced by this method are substantially free of contaminating helper-virus particles and are also non-pathogenic.
More specifically, the truncated interleukin-1 gene can be inserted into a retroviral vector under the regulation of a suitable eukaryotic promoter such as the retroviral promoter already contained within the gene transfer vector, such as for example, the pLJ.vector shown in Figure 3. It will be understood by those persons skilled in the art that. other vectors containing different l0 eukaryotic promoters may also be utilized to obtain a generally maximal level of interleukin-1 receptor expression. The vectors containing the truncated, and modified interleukin-1 receptor will be introduced into a retroviral packaging cell line (CRIP) by transfection and stable transformants isolated by selection for the expression of the neomycin resistance gene also carried by the pLJ vector. The CRIP cell line expresses all the proteins required for packaging of the exogenous retroviral RNA. Viral particles. produced by the 0418-selected CRIP
2o cell lines will carry a recombinant retrovirus able to infect mammalian cells and stably express the interleukin-1 truncated receptor. The viral particles are used to infect synovial cells directly _in vivo by injecting the virus into the joint space.
. Another embodiment of this invention provides a method for using the hereinbefore described viral particles to infect in culture synovial cells obtained from the lining of the joint of a mammalian host. The advantage of the infection of synovial cells in culture is that infected cells harboring the interleukin-1 receptor retroviral construct can be selected using Gala for expression of the neomycin resistance gene. The infected synovial cells expressing the interleukin-1 receptor can then be transplanted back into the joint by fntra-articular injection. The transplanted cells will express high levels of soluble interleukin-1 receptor in the joint space thereby binding to and neutralizing substantially all isoforms of interleukin-l, including interleukin -la and interleukin -1 (3 .
The method used for transplantation of the synovial cells within the joint is a routine and relatively minor procedure used in the treatment of chronic l0 inflammatory joint disease. Although synovium can be recovered from the joint during open surgery, it is now common to perform synovectomies, especially of the knee, through the arthroscope. The arthroscope is a small, hollow rod inserted into the knee via a small puncture wound. In addition to permitting the intra-articular insertion of a fibre-option system, the arthroscope allows access to surgical instruments, such that snyovial tissue can be removed arthroscopically. Such procedures can be carried out under "spinal" anesthetic and the patient allowed home the same day. In this manner sufficient synovium can be obtained from patients who will receive this gene therapy.
The synovial cells (synoviocytes) contained within the excised tissue may be aseptically recovered by enzymic digestion of the connective tissue matrix. Generally, the syno~rium is cut into pieces of approximately 1 millimeter diameter and digested sequentially with trypsin (0.2t w/v in Grey's Balanced Salt Solution) for 30 minutes at 37°
centigrade, and collagenase (0.2% w/v in Grey's Balanced Salt Solution) for 2 hours at 37° centigrade. Cells recovered from this digestion are seeded into plastic culture dishes at a concentration of 104 - 105 cells per square centimeter with Hank's F12 medium supplemented with 10% foetal bovine serum and antibiotics. After 3-7 days.

the culture medium is withdrawn. Non-adherent cells such as lymphocytes are removed by washing with Grey's Balanced Salt Solution and fresh medium added. The adherent cells can now be used as they are. allowed to grow to confluency or taken through one or more subcultures. Subcultivating expands the cell number and removes non-dividing cells such as macrophages.
Following genetic manipulation of the cells thus recovered, they can be removed from the culture.dish by to trypsinising, scraping or other means. and made into a standard suspension. Grey's Balanced Salt Solution or other isogenic salt solutions of suitable composition, or saline solution are suitable carriers. A suspension °of cells can then be injected into-the recipient mammalian joint. Intra-articular injections of this type are routine and easily carried out in the doctor's office. ~No surgery is necessary. Very large numbers of cells canwbe introduced in this way and repeat injections carried out as needed.
Another embodiment of this invention is the gene 2o produced by the hereinbefore described method of preparation. ~ This gene carried by the retrovirus may be incorporated in a suitable pharmaceutical carrier, such as for example, buffered physiologic saline, for parenteraT
administration. This gene may be administered to a patient in a therapeutically effective dose. More_specifically, this gene may be incorporated in a suitable'pharmaceutical carrier at a therapeutically effective dose and administered by intra-articular injection.
In another embodiment of this invention, this gene may be administered to patients as a prophylactic measure to prevent the development of arthritis in those patients determined to be highly susceptible of developing this disease. More specifically, this gene carried by the ,~

retrovirus may be incorporated in a suitable pharmaceutical carrier at a prophylactically effective dose and administered by parenteral injection, including intra-articular injection.
It will be appreciated by those persons skilled in the art that this invention provides a method of using and a method of preparing a gene encoding an extra cellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing substantially l0 all isoforms of interleukin-1, and thus substantially protect cartilage of a mammalian host from pathological degradation. In addition, it will be understood by those persons skilled in the art that the method of using the gene of this invention will reduce inflammation, protect soft 15 tissues of the joint and suppress the loss of bone that occurs in patients suffering with arthritis.
It will be appreciated by those persons skilled in the art that the viral vectors employed in the hereinbefore described invention may be employed to transfect synovial 2o cells in vivo or in culture, such as by direct intra-articular injection or transplantation of autologous synovial cells from the patient transduced with the retroviral vector carrying the truncated interleukin-1 receptor gene.
25 ~. Whereas particular embodiments of this invention have been described above for purposes of illustration, it will be evident to those persons skilled in the art that numerous variations of the details of the present invention may be made without, departing from the invention as defined 3o in the appended claims.

Claims (18)

1. Use of a gene encoding a soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 for the prevention or treatment of cartilage degradation.
2. Use of a gene encoding a soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 for the prevention or treatment of deleterious pathological changes associated with arthritis.
3. Use of a gene encoding a soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 for the treatment of arthritis.
4. Use of a gene encoding a soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 for the prevention or treatment of inflammation.
5. A genetically modified synovial cell that expresses a gene encoding a soluble interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1.
6. A synovial cell according to claim 5, wherein the gene encodes an extracellular binding domain of human interleukin-1 receptor.
7. A synovial cell according to claim 5 or 6 comprising a viral particle capable of expressing the gene.
8. The synovial cell according to claim 7,, wherein said viral particle is produced by transferring a retroviral vector containing said gene into a retroviral packaging cell line.
9. A pharmaceutical composition comprising a suitable pharmaceutical carrier and the synovial cell of any one of claims 5 to 8.
10. A method of using a gene coding for an extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to and neutralizing interleukin-1 which comprises:
employing recombinant techniques to produce a retrovirus vector carrying two genes wherein a first gene encodes said extracellular interleukin-1 binding domain of said interleukin-1 receptor and a second gene encodes for selectable antibiotic resistance; and transfecting said retrovirus vector into a retrovirus packaging cell line to obtain a cell line producing nonpathogenic, replication deficient but integration competent, amphitrophic infectious retroviral particles carrying said gene.
11. The method of claim 10, including initiating introduction of said gene by infection with said retroviral particles from said cell line directly into synovial cells lining a joint space of a mammalian host.
12. The method of claim 10, including initiating introduction of said gene by transduction of autologous synovial cells in culture, selecting a synoviocyte cell line by treatment of cultures with antibiotic, and transplanting said selected synoviocyte cells into an affected mammalian joint.
13. The method of claim 10, wherein effecting said introduction of said viral particles is by parenteral injection.
14. The method of claim 10, wherein effecting said introduction of said viral particles is by intra-articular injection.
15. A method for preparing viral particles containing a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor that is capable of binding to a neutralizing interleukin-1, which method comprises:
synthesizing said gene by a polymerase chain reaction of said extracellular interleukin-1 binding domain including a signal sequence for secretion of a protein;
introducing amplified interleukin-1 receptor coding sequence into a retroviral vector;
transfecting said retroviral vector into an amphitrophic retrovirus packaging cell line; and collecting viral particles obtained from said retrovirus packaging cell line, wherein said viral particles contain said gene.
16. The viral particles prepared by the method of claim 15.
17. A pharmaceutical composition for parenteral administration to a patient in a therapeutically effective amount which comprises a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor and a suitable pharmaceutical carrier.
18. A pharmaceutical composition for parenteral administration to a patient in a prophylactically effective amount which comprises a gene encoding an extracellular interleukin-1 binding domain of an interleukin-1 receptor and a suitable pharmaceutical carrier.
CA002098848A 1990-12-20 1991-12-09 Truncated interleukin-1 receptor gene for the treatment of arthritis Abandoned CA2098848A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US630,981 1975-11-12
US63098190A 1990-12-20 1990-12-20

Publications (1)

Publication Number Publication Date
CA2098848A1 true CA2098848A1 (en) 1992-06-21

Family

ID=24529337

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002098848A Abandoned CA2098848A1 (en) 1990-12-20 1991-12-09 Truncated interleukin-1 receptor gene for the treatment of arthritis

Country Status (4)

Country Link
EP (1) EP0563239A4 (en)
JP (1) JPH06504440A (en)
CA (1) CA2098848A1 (en)
WO (1) WO1992011359A1 (en)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6159464A (en) * 1990-12-20 2000-12-12 University Of Pittsburgh Of The Commonwealth System Of Higher Education Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
US6413511B1 (en) * 1990-12-20 2002-07-02 University Of Pittsburgh Of The Commonwealth System Of Higher Education Cartilage alterations by administering to joints chondrocytes comprising a heterologous polynucleotide
US6156304A (en) * 1990-12-20 2000-12-05 University Of Pittsburgh Of The Commonwealth System Of Higher Education Gene transfer for studying and treating a connective tissue of a mammalian host
US6228356B1 (en) 1990-12-20 2001-05-08 University Of Pittsburgh Of The Commonwealth System Of Higher Education Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
US5858355A (en) * 1990-12-20 1999-01-12 University Of Pittsburgh Of The Commonwealth System Of Higher Education IRAP gene as treatment for arthritis
US5792751A (en) * 1992-04-13 1998-08-11 Baylor College Of Medicine Tranformation of cells associated with fluid spaces
EP0653943A4 (en) * 1992-07-13 1996-10-02 Baylor College Medicine Targeting somatic gene therapy to joints.
JPH08511507A (en) * 1993-03-08 1996-12-03 ユニバーシティー オブ ピッツバーグ オブ ザ コモンウェルス システム オブ ハイヤー エデュケーション Gene transfer for treating connective tissue in a mammalian host
US5645829A (en) * 1993-06-18 1997-07-08 Beth Israel Hospital Association Mesothelial cell gene therapy
AU7516594A (en) * 1993-07-28 1995-02-28 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Pre-binding of retroviral vector particles with complement components to enable the performance of human gene therapy (in vivo)
CA2155929A1 (en) * 1993-12-14 1995-06-22 Christopher H. Evans Systemic gene treatment of connective tissue diseases
JPH083058A (en) * 1994-06-17 1996-01-09 Hoechst Japan Ltd New medicine for bone metabolic disease
ES2153045T3 (en) * 1994-08-26 2001-02-16 Aventis Pharma Gmbh GENE THERAPY OF DISEASES CONDITIONED BY THE IMMUNE SYSTEM, WITH HELP OF A SPECIFIC ACTIVE ACTIVE SUBSTANCE OF THE CELL AND REGULATED BY THE CELL CYCLE.
US6096728A (en) * 1996-02-09 2000-08-01 Amgen Inc. Composition and method for treating inflammatory diseases
US6294170B1 (en) 1997-08-08 2001-09-25 Amgen Inc. Composition and method for treating inflammatory diseases
EP1009444A2 (en) * 1997-09-02 2000-06-21 Chiron Corporation Compositions and methods for treating arthritis utilizing gene therapy
US6537540B1 (en) 1999-05-28 2003-03-25 Targeted Genetics Corporation Methods and composition for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders
EP1939300A1 (en) 1999-05-28 2008-07-02 Targeted Genetics Corporation Methods and compositions for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders
AU6919300A (en) * 1999-08-20 2001-03-19 University Of Pittsburgh Methods for in vivo gene delivery to sites of cartilage damage
AU2002311777A1 (en) * 2001-04-17 2002-10-28 Genetix Pharmaceuticals, Inc. Method of treating arthritis using lentiviral vectors in gene therapy
DK1729810T3 (en) 2004-04-02 2018-12-03 Swedish Orphan Biovitrum Ab Publ PROCEDURE FOR REDUCING AGGREGATION OF IL-1RA

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989004838A1 (en) * 1987-11-25 1989-06-01 Immunex Corporation Interleukin-1 receptors
US4968607A (en) * 1987-11-25 1990-11-06 Immunex Corporation Interleukin-1 receptors

Also Published As

Publication number Publication date
JPH06504440A (en) 1994-05-26
WO1992011359A1 (en) 1992-07-09
EP0563239A4 (en) 1994-10-12
EP0563239A1 (en) 1993-10-06

Similar Documents

Publication Publication Date Title
CA2098848A1 (en) Truncated interleukin-1 receptor gene for the treatment of arthritis
US5858355A (en) IRAP gene as treatment for arthritis
EP1932544B1 (en) Compositions for treating a connective tissue of a mammalian host
WO1994020517A1 (en) Gene transfer for treating a connective tissue of a mammalian host
US7037492B2 (en) Gene transfer for studying and treating a connective tissue of a mammalian host
Bandara et al. Intraarticular expression of biologically active interleukin 1-receptor-antagonist protein by ex vivo gene transfer.
US6048724A (en) Method of producing clonal cell strains which express exogenous DNA encoding glucagon-like peptide 1
Ghivizzani et al. Direct retrovirus-mediated gene transfer to the synovium of the rabbit knee: implications for arthritis gene therapy
JP3784063B2 (en) Enhanced xenograft resistance and porcine cytokines
Chen et al. Potent antitumour activity of a new class of tumour-specific killer cells
US6670178B1 (en) In Vivo production and delivery of insulinotropin for gene therapy
EP0591462B1 (en) Universal donor cells
JPH07504812A (en) Novel polypeptides to promote cell attachment
JPH08508415A (en) Systemic gene therapy for connective tissue disease
US6159464A (en) Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
JP2011217745A (en) Integrin heterodimer and subunit thereof
US6228356B1 (en) Viral vectors to inhibit leukocyte infiltration or cartilage degradation of joints
US6475781B1 (en) Trans-dominant suppressor genes for oligomeric proteins
Ueblacker et al. In vivo analysis of retroviral gene transfer to chondrocytes within collagen scaffolds for the treatment of osteochondral defects
JPH10505745A (en) Novel implants and new vectors for the treatment of acquired diseases
US6531124B1 (en) In vivo production and delivery of insulinotropin for gene therapy
AU627710B2 (en) Rapid immunoselection cloning method
Coles et al. Retroviral gene transduction of circulating progenitor cells in patients with metastatic breast cancer
Ojeifo Endothelial Cell-Based Gene Therapy of Breast Cancer
EP1210420A1 (en) Cd154 ligand, and recombinant cells expressing it

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued