EP0190254A1 - Gene clone et son procede de preparation et d'utilisation - Google Patents

Gene clone et son procede de preparation et d'utilisation

Info

Publication number
EP0190254A1
EP0190254A1 EP85903899A EP85903899A EP0190254A1 EP 0190254 A1 EP0190254 A1 EP 0190254A1 EP 85903899 A EP85903899 A EP 85903899A EP 85903899 A EP85903899 A EP 85903899A EP 0190254 A1 EP0190254 A1 EP 0190254A1
Authority
EP
European Patent Office
Prior art keywords
gly
glu
ala
protein
antigenic protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP85903899A
Other languages
German (de)
English (en)
Other versions
EP0190254A4 (fr
Inventor
David M. Anderson
Russell John Mccandliss
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genex Corp
Original Assignee
Genex Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genex Corp filed Critical Genex Corp
Publication of EP0190254A1 publication Critical patent/EP0190254A1/fr
Publication of EP0190254A4 publication Critical patent/EP0190254A4/fr
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/455—Eimeria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • Coccidiosis is a disease of both invertebrates and vertebrates, including man, caused by intracellular parasitic protozoa which generally invade the epithelial cells lining the alimentary tract and the cells of associated glands.
  • the crowded conditions under which many domestic animals are raised have contributed to increased incidence of the disease.
  • Virtually every domestic animal is susceptible to infection, and distribution of the parasite is world-wide.
  • Coccidiosis is therefore the cause of significant economic loss throughout the world.
  • Eimeria contains the most economically important species.
  • Eimeria are highly host specific but life cycles are similar. Eimeria tenella, which proliferates in the cecum of the chicken, can be used to illustrate those developmental stages of the avian coccidia which are relevant to this invention.
  • the life cycle begins when the host ingests previously sporulated oocysts during ground feeding or by inhalation of dust. Mechanical and chemical action in the gizzard and intestinal tract of the chicken ruptures the sporulated oocyst, liberating eight sporozoites. The sporozoites are carried in the digestive contents and infect various portions of the intestinal tract by penetration of epithelial cells. Subsequent life stages involve asexual multiple fission, the infection of other epithelial cells, development of gametes, and fertilization to produce a zygote which becomes an oocyst which is passed out of the host with the droppings.
  • E. tenella The oocyst undergoes nuclear and cellular division resulting in the formation of sporozoites, with sporulation being dependent upon environmental conditions. Ingestion of the sporulated oocyst by a new host transmits the disease.
  • E. tenella has received the most attention.
  • E. tenella is an extremely pathogenic species, with death often occurring on the fifth or sixth day of infection. Mortalities of 100 percent in laboratory and up to 20 percent in field infection have been reported.
  • chemotherapeutic agents poultry producers' attempts to control coccidiosis were limited to various management programs. These programs were directed toward attempts at sanitation through disinfection, or by mechanical removal of litter. Despite these efforts, sufficient oocysts usually remained to transmit the disease.
  • Another means of combating coccidia is drug treatment after the poultry is infected.
  • One drug that has been used is sulfanilamide which has shown anticoccidial activity against six species of coccidia.
  • the problem with this technique is, however, that initiation of treatment of the flock usually follows diagnosis of the disease in some birds and, therefore, medication is frequently started too late to be effective.
  • Such expression vectors are derived from either plasmids or bacteriophage and contain: (1) an origin of replication functional in a microbial host cell; (2) genes encoding selectable markers, and (3) regulatory sequences including a promoter, operator, and a ribosome binding site which are functional in a microbial host cell and which direct the transcription and translation of foreign DNA inserted downstream from the regulatory sequences.
  • eukaryotic proteins are often produced in prokaryotic cells as a fusion with sequences from the amino-terminus of a prokaryotic protein.
  • ⁇ -Galactosidase or the product of one of the E. coli tryptophan operon genes have been used successfully in this manner.
  • Expression vectors have also been developed for expression of foreign proteins in eukaryotic host cells, e.g., yeast and Chinese hamster ovary tissue culture cells.
  • Host cells transformed with expression vectors carrying foreign genes are grown in culture under conditions known to stimulate production of the foreign protein in the particular vector.
  • Such host cell/expression vector systems are often engineered so that expression of the foreign protein may be regulated by chemical or temperature induction.
  • Proteins which are secreted may be isolated from the growth media, while intracellular proteins may be isolated by harvesting and lysing the cells and separating the intracellular components. In this manner, it is possible to produce comparatively large amounts of proteins that are otherwise difficult to purify from native sources.
  • Such microbially produced proteins may be characterized by many well-known methods, including the use of monoclonal antibodies, hereinafter referred to as "MCAs," which are homogeneous antibodies that react specifically with a single antigenic determinant and display a constant affinity for that determinant, or by use of polyvalent antibodies derived from infected birds, which react with a variety of different antigens and often with multiple determinants on a single antigen.
  • MCAs monoclonal antibodies
  • Alternate technology to the production of "subunit” or “synthetic” vaccines is the use of a fowl pox virus vector.
  • the pox virus vaccinia has a long history of use as a vaccine and has been employed to virtually irradicate smallpox in humans.
  • vaccinia virus can be effectively genetically engineered to express foreign antigens (Smith, et al., Nature, 302, 490-495 (1983); Panicali, et al., Proc. Nat'l Acad. Sci. USA, 80, 5364-5368, (1983); Mackett, et al., J. of Virology, 49, 857-864 (1984)) and the engineered viruses can serve as a live vaccine. against other viruses and infections besides smallpox.
  • Fowl pox virus is very similar to vaccinia virus and many of the methods developed for vaccinia for the creation of recombinants expressing foreign antigens can be applied to fowl pox.
  • Attenuated fowl pox virus engineered to produce avian coccidia antigens thus is another method to produce an anticoccidial vaccine.
  • Live vaccines have the advantage of being inexpensive to produce and are characterized by the production of rapid immunity development.
  • a second type of live vaccine results in the presentation of antigen in the gut where coccidia normally invades.
  • This method utilizes secretion or outer surface expression of the antigen by harmless bacteria introduced into the intestinal microbial population by incorporation in feed. Secretion is obtained by fusion of an antigen gene to the gene coding for a protein which is normally secreted, leaving the necessary secretion signal sequence intact.
  • Outer surface expression is achieved by fusion of the antigen genes to the genes that code for proteins normally localized on the outer surface.
  • This type of live vaccine is especially advantageous since manufacturing costs are minimal and the immune response stimulated is of a type particularly effective against coccidia invasion of the gut.
  • a cloned gene that specifies an antigenic protein that binds with a monoclonal or polyvalent antibody that is directed against an antigenic protein of avian coccidia. Also disclosed is the use of the above gene to produce an antigenic protein to be used in a vaccine against avian coccidia.
  • Figure 1 sets forth the DNA sequence of the 5' -> 3' strand of cDNA encoding an antigenic protein that binds with a monoclonal or polyvalent antibody directed against an antigenic protein of avian coccidia and the amino acid sequences specified by that DNA sequence.
  • the present invention relates to a cloned gene that encodes an antigenic protein that binds with a specific monoclonal antibody or with polyvalent antibodies from infected chickens which is directed against an antigenic protein of avian coccidia.
  • a cloned gene that encodes an antigenic protein that binds with a specific monoclonal antibody or with polyvalent antibodies from infected chickens which is directed against an antigenic protein of avian coccidia.
  • U.S. Department of Agriculture U.S. Department of Agriculture
  • MCA monoclonal antibodies
  • Eimeria i.e., E. tenella, E. acervulina, E. maxima, E. necatrix, E. brunetti, E. mivati, E. mitus, E. meleagrimitis and E. adenoides.
  • the MCA cell lines were produced by injecting mice with sporozoites that had been isolated from oocysts of each of the species named above. Spleen cells from these mice were fused with mouse myeloma cells and cell lines derived from single cells were isolated, characterized, and analyzed for species specificity.
  • the United States Department of Agriculture also has produced polyvalent immune chicken serum by immunizing chickens (which were raised in coccidia-free environments) against E. tenella by infecting the chickens with doses of from 10 2 - 10 5 oocysts and recovering serum from the birds at 4 - 14 days post-infection.
  • This antiserum was tested in an enzyme-linked immunosorbent assay (ELISA), using extracts of E. tenella sporozoites as an antigen, and the antiserum was shown to contain antibodies against E. tenella sporozoite proteins.
  • the various MCAs were tested by an indirect immunofluorescent antibody test for binding to air-dried sporozoites. Binding patterns seen for the MCAs varied from a general internal fluorescence (similar to that seen with the chicken antiserum) to fluorescence on the tip, pellicle, and refractile body of the parasite, or a combination thereof.
  • MCAs bound to sporozoites of species other than the one to which they were raised, while others were species specific. A few MCAs were tested, in vitro, and found to inhibit the parasite's penetration of epithelial cells and development, to varying degrees. (Danforth, Amer. J. Vet. Res. 44, 1722-1727 (1983)).
  • coccidial antigenic proteins have not previously been identified and isolated, no amino acid sequence data is available for them. Therefore, antibodies directed against coccidial antigens are used to identify, by immunological methods, transformed cells containing DNA encoding coccidial antigens.
  • the MCAs are used as a tool for identifying cells containing DNA sequences encoding coccidial antigens that are either species specific or common to all nine species.
  • Screening transformants with polyvalent chicken antiserum is used to identify DNA sequences encoding a wide spectrum of coccidial proteins which are antigenic in chickens upon infection. DNA sequences from the transformants thus identified then may be incorporated into a microorganism for large scale protein production.
  • the antigenic proteins, as native proteins or as hybrids with other proteins, may be used as vaccines to immunize birds to protect them from subsequent infection.
  • mRNA messenger RNA
  • cDNA complementary DNA
  • cDNA complementary DNA
  • insertion of the cDNA into a suitable expression vector and transformation of bacterial cells with that vector and (4) recovery and isolation of the cloned gene or gene fragment.
  • This route is referred to as the mRNA route.
  • the advantage to this route is that only "expressed" genes are cloned, reducing the number of individual transformants required to represent the entire population of genes.
  • This route is referred to as the nuclear DNA route.
  • the advantage to this route is that all genes are cloned, allowing the identification of genes not expressed at the time from which mRNA is isolated. These may include genes which are expressed during stages of the life cycle which are not easy to isolate.
  • the cloned DNA sequence is advantageously transferred to a suitable expression vector/host cell system for large scale production of the antigenic protein.
  • the DNA sequence that is to be isolated encodes an antigenic protein that will elicit an immune response when administered to chickens which will protect them from subsequent infections. It is not necessary to isolate a complete coccidial gene encoding such a protein, since those portions of a protein termed antigenic determinants are sufficient for triggering a protective immune response (Lerner, supra). This antigenic determinant should be on the surface of the folded microbiallyproduced protein to trigger the response (Lerner, supra).
  • the sequence may be isolated from the sporozoite life stage of the parasite. It has been demonstrated that part of the protective immune response in chickens is directed against the sporozoite.
  • MCAs or polyvalent antibodies which bind to various sporozoite proteins can be used to identify cloned DNA sequences encoding those proteins. Such proteins can be isolated and used to elicit a protective immune response in chickens.
  • Sporozoites can be obtained from oocysts by excystation using the method of Doran and Vetterling, Proc. Helminthol Soc. Wash., 34, 59-65 (1967) and purified by the leucopak filter technique of Bontemps and Yvore, Ann. Rech. Vet., 5 , 109-113 (1974).
  • the method of Doran and Vetterling has been found suitable for obtaining sporozoites from oocysts, any method is suitable as long as the nucleic acids within the sporozoites remain intact.
  • sporozoite mRNA may be isolated from intact sporulated oocysts, which contain the sporozoites.
  • RNA isolation for the antigenic proteins of interest is advantageously accomplished by lysis of intact sporulated oocysts under conditions which minimize nuclease activity. This is accomplished using a modification of the procedure described by Pasternak, et al., Molec. Biochem. Parisitol., 3 , 133-142 (1982).
  • Total RNA may be isolated by grinding the oocysts with glass beads in a solution containing sodium dodecyl sulfate (SDS) and proteinase K. After denaturation and degradation of oocyst proteins, the RNA is isolated by extraction of the solution with phenol and precipitation with ethanol. Oligo (dT)-cellulose chromatography then can be used to isolate mRNA from the total RNA population.
  • SDS sodium dodecyl sulfate
  • Oligo (dT)-cellulose chromatography then can be used to isolate mRNA from the total RNA population.
  • Proteins coded for by the isolated mRNA can be synthesized, in vitro, using a cell-free translation. system.
  • a number of cell-free translation systems have been devised, such as wheat germ extract (Martial, et al.,
  • rabbit reticulocyte lysate (Pelham and Jackson, Eur. J. Biochem., 67, 247-256 (1976)), and oocytes from Xenopus laevis (Sloma, et al., Methods in Enzymology, 79, 68-71 (1981)).
  • the rabbit reticulocyte lysate is preferred for the testing of sporozoite mRNA.
  • the rabbit reticulocyte lysate can be supplemented with a radioactively labeled amino acid, such as [ 35 S]-methionine, so that the resulting proteins contain a tracer.
  • the various protein products may be reacted with polyvalent chicken antisera or MCAs previously described, followed by reaction with goat anti-chicken IgG in the case of the polyvalent antibodies and Staphylococcus aureus Protein A, or in the case of the MCAs, just Protein A.
  • Protein A binds any of the mouse or goat antibodies to form an immunoprecipitated complex.
  • the products of the translation and of the immunoprecipitation are visualized by gel electrophoresis followed by fluorography.
  • the mRNA fractions found to produce proteins that react with the antisera in this system are used for ds-cDNA synthesis.
  • total mRNA is used for cDNA synthesis.
  • Synthesis of cDNA employs avian myeloblastosis virus reverse transcriptase. This enzyme catalyzes the synthesis of a single strand of DNA from deoxynucleoside triphosphates on the mRNA template. (Kacian and Myers, Proc. Nat'l Acad. Sci. USA, 73, 2191-2195 (1976).)
  • the poly r(A) tail of mRNA permits oligo(dT) (of about 12-18 nucleotides) to be used as a primer for cDNA synthesis.
  • the use of a radioactively-labeled deoxynucleoside triphosphate facilitates monitoring of the synthesis reaction.
  • a 32 P-containing deoxynucleoside triphosphate such as [ ⁇ - 32 P]dCTP
  • the cDNA synthesis is generally conducted by incubating a solution of the mRNA, the deoxynucleoside triphosphates, the oligo (dT) 12-18 and reverse transcriptase for 10 minutes at 46°C.
  • the solution also preferably contains small amounts of actinomycin D and dithiothreitol to promote full length synthesis. (Kacian and Myers, supra.)
  • ethylenediaminetetraacetic acid (EDTA) is added to the solution, and the solution is extracted with phenol: chloroform.
  • the aqueous phase is advantageously purified by gel filtration chromatography, and the cDNA-mRNA complex in the eluate is precipitated with alcohol.
  • the mRNA can be selectively hydrolyzed in the presence of the cDNA with dilute sodium hydroxide at an elevated temperature. Neutralization of the alkaline solution and alcohol precipitation yields a singlestranded cDNA copy.
  • the single-stranded cDNA copy has been shown to have a 5'-poly (dT) tail, and to have a 3' terminal hairpin structure, which provides a short segment of duplex DNA. (Efstratiadis, et al., Cell, 7 , 279-288 (1976)).
  • This 3' hairpin structure can act as a primer for the synthesis of a second DNA strand. Synthesis of this second strand is conducted under essentially the same conditions as the synthesis of the cDNA copy, except that the Klenow fragment of E. coli DNA polymerase I (Klenow, et al., Eur. J. Biochem., 22, 371-381 (1971)) is substituted for reverse transcriptase.
  • the duplex cDNA recovered by this procedure has a 3' loop, resulting from the 3' hairpin structure of the single-stranded cDNA copy.
  • This 3' loop can be cleaved by digestion with the enzyme, S1 nuclease, using essentially the procedure of Ullrich, et al., Science, 196, 1313-1319 (1977).
  • S1 nuclease digest may be extracted with phenol-chloroform, and the resulting ds-cDNA precipitated from the aqueous phase with alcohol.
  • the dscDNA prepared as described above is generally inserted into a suitable cloning vector, which is used for transforming appropriate host cells.
  • suitable cloning vectors include various plasmids and phages, but a bacteriophage lambda is preferred.
  • a cloning vector For a cloning vector to be useful for the expression of foreign proteins which are to be detected with antibodies, it should have several useful properties. Most importantly, it should have a cloning site within a gene which is expressed in the host being used. There should also be a means of controlling expression of the gene. The vector should be able to accept DNA of the size required for synthesis of the desired protein product and replicate normally. It is also useful to have a selectable property which allows identification of vectors carrying inserts. A cloning vector having such properties is the bacteriophage ⁇ gt11 (ATCC 37194) (Young and Davis, Proc. Nat'l Acad. Sci. USA 80, 1194-1198 (1983)).
  • This vector has a unique EcoRl site near the end of the bacterial gene coding for ⁇ -galactosidase. That site can be used for insertion of foreign DNA to make hybrid proteins made up of ⁇ -galactosidase and the foreign gene product.
  • the expression of ⁇ -galactosidase is under contol of the lac promoter and can be induced by the addition of isopropyl- ⁇ -D-thiogalactopyranoside (IPTG).
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • the ⁇ gt11 phage contains 43.7 kb of DNA which is considerably smaller than wild type ⁇ . This allows insertion of pieces of DNA up to 8.3 kb in length, before the DNA becomes too large to fit inside the phage head.
  • the ds-cDNA can be conveniently inserted into the phage by addition of EcoRI linkers to the DNA and liga- tion into the EcoRI-cut ⁇ gt11 DNA. After ligation of the cDNA into the phage DNA, the DNA is packaged, in vitro, into ⁇ phage heads (Enquist and Sternberg, Methods in Enzymology, 68, 281-298 (1979) and those phages are used to infect a suitable ⁇ -sensitive host. With the proper choice of host, the phage may be screened as plaques or lysogens (colonies).
  • Cloning vectors have been constructed which transform both yeast and E. coli. Such vectors are termed “shuttle vectors" and may be transferred, along with the cDNA they carry, between the two host microorganisms (Storms, et al.. Journal of Bacteriology, 140, 1, 73-82 (1979); and Blanc, et al., Molec. Gen. Genet., 176, 335-342 (1979). Shuttle vectors also exist which replicate in (and may carry cloned genes into) both E. coli and B.
  • subtilis (Old and Primrose, supra, at p. 53).
  • Vectors derived from the other bacteriophages such as M13 have also proven useful in the cloning of foreign genes (Old and Primrose, supra. Chap. 5). Any of these techniques can be employed, if desired, in the constructions of the present invention.
  • the DNA described herein may be inserted into the above vectors by various techniques including homopolymeric tailing, blunt-end ligation or by use of linker molecules (Old and Primrose, supra, at p. 92).
  • linker molecules Old and Primrose, supra, at p. 92.
  • Many immunological methods for screening clone banks for those expressing a desired protein are known and include procedures described by Engvall and Pearlman, Immunochemistry, 8, 871-874 (1971); Koenen, et al.. The European Molecular Biology Organization Journal, Vol. 1, No. 4, pp. 509-512 (1982); Broome and Gilbert, Proc. Nat'l Acad. Sci. USA, 75, 2746-2749 (1978); VillaKomaroff, et al., Proc. Nat'l Acad. Sci.
  • Both screening methods depend upon expression of the coccidial antigenic protein either alone or as a fusion protein with a bacterial gene.
  • the coccidial antigens are produced as fusions with E. coli. ⁇ - galactosidase.
  • the screening methods therefore, depend on expression of the fusion product and detection of the product by reaction with antibodies, either monoclonal or polyvalent, directed against that antigen.
  • the recombinant bacteriophages can be used to infect a suitable 13. coli host which allows the formation of phage plaques on agar (or agarose) plates.
  • the plaques can be transferred to nitrocellulose membranes while being induced with IPTG.
  • the proper antibodies are then reacted with the filters. After reaction of the primary antibodies with the filters, the positive reactions are detected by reaction with either [ 125 I] Staphylococcus aureus Protein A or a second antibody conjugated with horseradish peroxidase.
  • the recombinant bacteriophages can be used to infect an E. coli host in which lysogens are produced at a high frequency.
  • the transformants can be screened as colonies. The colonies are grown on a cellulose acetate filter under non-induced conditions. After the colonies have reached a suitable size, the cellulose acetate filter is placed over a nitrocellulose filter which is on an agar plate containing IPTG. The colonies are incubated at elevated temperatures to induce phage production, while expression of the ⁇ -galactosidase gene is induced by inclusion of IPTG.
  • the nitrocellulose filter is processed as described above for screening of plaques.
  • the phages giving positive signals in the antibodyscreening procedure can be shown to contain sequences coding for coccidial proteins by excision of the DNA originally inserted into the phage DNA and examination of the ability of that DNA to hybridize with coccidia mRNA or coccidia genomic DNA.
  • the nucleotide sequence of the cDNA insert is determined using the methods of Sanger, et al., Proc. Nat'l Acad. Sci. USA, 74, 5463-5467 (1977); or Maxam and Gilbert, Proc. Nat'l Acad. Sci. USA, 74, 560-564 (1977).
  • Another method of cloning coccidial antigens begins with isolation of nuclear DNA from oocysts. This DNA is then broken into fragments of a size suitable for insertion into a cloning vector. To obtain such fragments. one can use mechanical shearing methods such as sonication or high-speed stirring in a blender to produce random breaks in the DNA. Intense sonication with ultrasound can reduce the fragment length to about 300 nucleotide pairs. (Old and Primrose, supra, p.
  • nuclear DNA may be partially digested with DNAsel, which gives random fragments, with restriction endonucleases, which cut at specific sites, or with mung bean nuclease in the presence of formamide, which has been shown with some related organises (McCutchan, T.F. et al., Science, 225, 625-628 (1984)) to produce DNA fragments containing intact genes.
  • nuclear DNA fragments may be inserted into any of the cloning vectors listed for the cloning of cDNA in the mRNA experimental method. If the nuclear DNA is digested with a restriction endonuclease, it can be inserted conveniently into a cloning vector digested with the same enzyme, provided the vector has only one recognition site for that enzyme. Otherwise, DNA fragments may be inserted into appropriate cloning vectors by homopolymeric tailing or by using linker molecules (Old and Primrose, supra, at p. 92).
  • the nuclear DNA fragments are cloned into "open reading frame" vectors which are designed to simultaneously clone and express foreign genes or fragments thereof.
  • "open reading frame" vectors are known in the art, including those described by Weinstock, et al., Proc. Nat'l Acad. Sci. USA, 80, 4432-4436 (1983); Keonen et al., The European Molecular Biology Organization Journal, 1, 4, pp. 509-512 (1982); Ruther, et al., Proc. Nat'l Acad. Sci. USA, 79, 6852-6855 (1982); Young and Davis, supra; and Gray et al., Proc. Nat'l Acad. Sci. USA, 79, 6598-6602 (1982).
  • Open reading frame (ORF) vectors have been used to clone both prokaryotic and eukaryotic genomic DNA or cDNA. These vectors generally contain a bacterial promoter operably linked to an amino terminal fragment of a prokaryotic gene.
  • a carboxy terminal fragment of a gene which encodes a product for which an assay is known e.g., the E. coli lacZ gene which encodes ⁇ - qalactosidase
  • the sequences between the amino terminal gene fragment and the lacZ fragment include restriction endonuclease recognition sites useful for insertion of foreign genes and, in some cases, also place the lacZ fragment out of reading frame for translation with respect to the amino terminal gene fragment.
  • Such recombinants are identified on MacConkey agar plates or on agar plates containing "Xgal" (5-bromo-4-chloro-3-indolyl- ⁇ -D galactoside) because the ⁇ -galactosidase activity of the tribrid protein cleaves the dye in such plates, turning colonies red (MacConkey agar) or blue (Xgal).
  • Xgal Xgal
  • ⁇ -galactosidase can carry a wide range of protein sequences at its amino terminus and still retain biological activity.
  • the insert may be inserted to inactivate a gene by interrupting the sequence.
  • the insert may be in the correct reading frame to produce a hybrid gene consisting of the amino-terminus of the bacterial gene and sequences from the insert gene at the carboxy terminus.
  • ORF vectors are useful for cloning genes for which no DNA or protein sequence data exists, if antibodies against the gene products exist. Screening of the clone bank may be accomplished by immunological methods which make RNA or DNA hybridization probes unnecessary. The immunological screening methods mentioned for the mRNA route can be used.
  • Plasmid DNA is isolated from transformants found to be "positive” by the above screening methods.
  • the nuclear DNA inserts of these plasmids are then subjected to DNA sequencing. Once the nucleotide sequence is known, it is possible by known methods to chemically synthesize all or part of the cloned coccidial genes. The synthesis of fragments of the cloned genes, followed by insertion of the gene fragments into expression vectors as described below and reaction of the polypeptides produced with MCAs allows detection of those portions of the gene which are antigenic determinants.
  • a cloned DNA sequence is identified as encoding a protein that binds antibodies directed against coccidial proteins, it may be transferred to expression vectors engineered for high-level production of the desired antigenic protein.
  • the expression vectors are transformed into suitable microbial host cells for production of the antigenic protein.
  • Coccidial antigens advantageously may be produced at high levels in E. coli as a fusion protein comprising the antigen and an amino-terminal portion of the ⁇ -subunit of the enzyme tryptophan synthetase (the product of the E. coli trpB gene.) This fusion is accomplished by inserting a DNA sequence encoding a coccidial antigen into a plasmid vector carrying the trpB gene.
  • the expression vector used may be one in which expression of the fusion antigenic protein is highly regulatable, e.g., by chemical induction or temperature changes.
  • An expression vector with such regulatory capability is the plasmid pGX2606, which contains a hybrid ⁇ O L PR regulatory region as described in copending application serial number 534,982 filed
  • Coccidial antigens also may be produced in high levels as fusions at the carboxy-terminal of E. coli ⁇ -galactosidase, as they are directly obtained by use of the cloning vector ⁇ gt11.
  • the fused ⁇ -galactosidasecoccidia antigen gene is transferred with all of the associated regulatory elements to a small plasmid, where synthesis of the gene product is regulated by the lac promoter, which is transferred along with the fusion gene from the phage to the plasmid.
  • a small plasmid is pGX1066 (plasmid pGX1066 is present in E. coli strain
  • GX1186, ATCC 39955) which carries the gene for ampicillin resistance and has a bank of restriction sites which are useful for insertion of DNA fragments. Synthesis of the fusion protein is induced by addition of IPTG,, the inducer of the lac operon.
  • An effective subunit vaccine against avian coccidiosis may consist of a mixture of antigen proteins derived from several species of Eimeria. Alternatively, production costs may be decreased by producing two or more antigen proteins as one fusion protein thus reducing the required number of fermentations and purifications.
  • Such a fusion protein would contain the amino acid sequence comprising an antigenic epitope of each antigen protein (or repetitions of those sequences) with variable amounts of surrounding nonantigenic sequence.
  • a hybrid gene designed to code for such a protein in E. coli would contain bacterial regulatory sequence (promoter/operator) and the 5' end of an E.
  • E. coli gene (the ribosome binding site and codons for several amino acids) to ensure efficient translation initiation followed by the coding sequences for the antigenic epitopes all fused in the same reading frame.
  • E. coli cells transformed with the expression vector carrying a cloned coccidial antigen sequence are grown under conditions that promote expression of the antigenic polypeptide.
  • the antigenic protein is then purified from the cells and tested for ability to elicit an immune response in chickens that will protect them from subsequent Eimeria infections.
  • the purified protein may be used to immunize the birds.
  • the purified protein may be combined with suitable carriers and adjuvants and administered to birds in their feed or by injection.
  • live microorganisms containing the DNA sequences encoding the coccidial antigens may be fed to chickens.
  • Such microorganisms are advantageously those which normally inhabit the avian intestinal tract, such as E. coli or coryneform bacteria.
  • the microorganisms are transformed with an expression vector in which the sequences encoding the coccidial antigen are fused in frame to a gene or gene fragment encoding a host cell outer membrane protein or secreted protein, such as the E. coli lamB protein, the ⁇ receptor.
  • the antigenic protein is therefore continuously presented in the host at the location of infection by the parasites. It is known that foreign proteins fused in expression vectors to outer membrane or secreted proteins have been presented at the cell surface or secreted from their host cells. (Weinstock, supra, and Silhavy, U.S. Patent No. 4,336,336 which is herein incorporated by reference.)
  • an attenuated fowl pox virus expression vector is utilized.
  • Fowl pox has the capacity to accommodate several coccidia genes allowing the production of multivalent vaccines.
  • attenuated fowl pox virus is utilized as a vaccine to protect commercial flocks against fowl pox infection.
  • Virus preparation and treatment of birds with fowl pox virus genetically engineered to produce coccidia antigens is the same as the conventional methods of pox vaccine use currently practiced.
  • Pox viruses are among the most complex viruses known with very high molecular weight double-stranded DNA genomes. With the most studied pox virus, vaccinia, it has been demonstrated that the pox genome can easily accommodate inserts of foreign DNA capable of coding for foreign antigenic proteins (Smith, et al., supra; Panicali, et al., supra; Mackett, et al., supra). When a foreign gene is incorporated into the pox virus genome under the control of a pox promoter regulatory sequence, the foreign antigen is expressed upon infection in the cytoplasm of the cell where the pox virus replicates.
  • Plasmid DNA is not infectious presumably because its cytoplasmic location requires the presence of pox virus specific RNA and DNA polymerases that are normally carried into the cell by the virion, DNA sequence information from vaccinia virus (Weir and Moss, J. of Virology, 46, 530-537 (1983); Venkatesan, et al.. Cell, 125, 805-813 (1981)) demonstrates sequence patterns in regulatory regions that are likely to be unique to vaccinia genes and thus not recognized by cellular enzymes.
  • plasmid DNA that includes the coccidia antigen gene placed under the control of a promoter functional in fowl pox, and DNA sequence homology with fowl pox.
  • a promoter functional in fowl pox a promoter functional in fowl pox
  • DNA sequence homology with fowl pox During the course of the infection recombination occurs. If a coccidia DNA sequence is inserted within the fowl pox homologous sequence on the transfected plasmid, upon recombination the coccidia DNA sequence is, in some cases, inserted into the pox virus genome.
  • the infected cells and virus from a recombination attempt are harvested and fresh chick embryo fibroblast cells grown as a monolayer in tissue culture are infected at a low multiplicity such that individual plaques resulting from an initial single virus infection can be identified using conventional techniques.
  • Desired recombinant viruses are identified using an in situ hybridization technique (Villarreal and Berg, Science, 196, 183-185 (1977)) using radioactive coccidia DNA sequence as probe.
  • viral DNA immobilized on nitrocellulose paper prepared from cells infected by plaque purified virus or cells infected with pools of potential recombinant viruses can be used for identification of desired recombinant viruses.
  • Immunological screening of fixed cells (Gremer et al., Science, 228: 737:740 (1985)) is an alternative to hydrbridation.
  • the region of fowl pox DNA included in the plasmid vector must be from a nonessential region, and is chosen by randomly testing segments of fowl pox DNA for regions that allow recombinant formation without seriously affecting virus viability using the method described above.
  • Fowl pox DNA is purified (Muller et al., J. Gen. Virology 38:135, 1977; Gafford et al., Virology 89:229, 1978), randomly sheared to about 3 kilobases and cloned into a small bacterial plasmid, such as pGXl066, creating several different isolates.
  • Fowl pox DNA regions with partial sequence homology to the thymidine kinase gene of vaccinia identified by hybridization experiments are also useful for inclusion in the cotransfection plasmid since the thymidine kinase gene of vaccinia has been shown to be nonessential (Weir, (1982), supra; Mackett, et al., Proc. Nat'l Acad. Sci. USA, 79, 4927-4931 (1982); Hruby and Ball, J. Virology,43, 403-408 (1982)).
  • Placement of the coccidia antigen gene under the control of a fowl pox promoter is carried out by conventional in vitro manipulation of the plasmid before con current transfection and fowl pox infection.
  • Promoter sequences useful for driving expression of the coccidia antigens could be identified by determination of the DNA sequence located 5' to fowl pox genes.
  • Promotor sequences are then synthesized chemically and included in the plasmid vector adjacent to endonuclease cloning sites within the fowl pox homologous region of the plasmid.
  • Putative promoter sequences identified through DNA sequencing of vaccinia DNA are also chemically synthesized and compared with fowl pox promoters for optimal effect.
  • Putative fowl pox promoters are verified by cloning them 5' of a test gene with an easily measured translation product such as chloramphenicol acetyltransferase (Gorman et al., Molecular and Cellular Biology, 2:1044-1057, 1982) in a bacterial plasmid.
  • the plasmid is used to transfect fowl pox infected tissue culture cells and the cells are assayed for transient expression of the test gene.
  • Vaccinia virus has a broad host range and does infect chickens.
  • the vectors and methods already developed for vaccinia could be utilized to develop vaccines for avian coccidia and coccidiosis in any other genus included in the vaccinia host range. This approach requires caution since vaccinia is severely pathogenic to a small proportion of the human population.
  • a good alternative to pox vectors would be to utilize a herpes virus such as Marek's Disease Virus or Herpes virus of turkeys. Attenuated forms of both viruses are currently used as live vaccines to prevent Marek's disease in poultry. Similar to pox viruses, herpes viruses have large double stranded DNA genomes and are good candidates for genetic engineering using in vivo recombination methods similar to those developed for vaccinia. The advantage of engineering Marek's disease virus to also provide protection against coccidia infection is that coccidia protection is provided at no additional production cost above the Marek's Disease Vaccine that is already generally in use.
  • coccidia antigen by fowl pox recombinants is verified by immunological analysis of the protein produced in chick embryo fibroblast tissue culture cells after infection and also by testing the circulating antibody of birds infected with recombinant fowl pox virus for crossreaction with whole coccidia or protein isolated from coccidia of the appropriate species.
  • the cloned antigenic proteins used in vaccines above are tested for their ability to elicit an immune response in chickens that protects the birds from subsequent infection by any of the important species of Eimeria, including E. tenella, E. acervulina, E. brunetti, 13. mivati, E. maxima and E. necatrix.
  • the cloning procedures described above may be repeated until DNA sequences encoding coccidial antigens that collectively protect chickens against coccidiosis are isolated and used as a vaccine by the methods above.
  • antigenic proteins which may be useful as vaccines to protect against coccidiosis
  • another useful alternative which may be derived from cloning antigen genes is the use of small, synthetic peptides in vaccines (see Lerner, supra). After the sequence of antigenic proteins is determined, it is possible to make synthetic peptides based on that sequence. The peptides are conjugated to a carrier protein such as hemocyanin or serum albumin and the conjugate then can be used to immunize against coccidia. It is contemplated that the procedures described may also be used to isolate antigenic proteins from other coccidia species that can be used in vaccines to protect other domestic animals from coccidiosis.
  • Oocysts float on top of the cushion while most of the other debris is pelleted at the bottom of the centrifuge tube.
  • the purified oocysts were again washed thoroughly with cold water and were stored at 4°C in Hank's medium (Gibco, Grand island. New York) containing 10 units/ml penicillin and 10 ⁇ g/ml streptomycin.
  • RNA was pelleted by centrifugation and resuspended in 5 ml (per 1 g wet weight) of lysis buffer consisting of 10 mM Trisacetate, 75 mM sodium acetate, 2 mM EDTA, 1% SDS, and 200 ⁇ g/ml Proteinase K (pH 7.5).
  • lysis buffer consisting of 10 mM Trisacetate, 75 mM sodium acetate, 2 mM EDTA, 1% SDS, and 200 ⁇ g/ml Proteinase K (pH 7.5).
  • acidwashed glass beads 0.45-0.50 mm
  • the resulting mixture of lysed oocysts was centrifuged at 15,000 rpm for 15 minutes at 4°C in a Sorvall SM-24 rotor. The supernatant solution was removed, the pellet was resuspended in 5 ml of the lysis buffer, the mixture was centrifuged as before, and the supernatant solution was combined with the first one. The solution was incubated at 37oC for 30 minutes.
  • RNA in the aqueous layer was precipitated by addition of 0.1 volume of 2.4M sodium acetate, pH 5.5., and 2.5 volumes of ethanol. After 1 hour at -20 °C, the RNA was collected by centrifugation in a Sorvall HB-4 rotor at 13,000 rpm at 4oC. The RNA was dried in a vac- cuum desiccator, dissolved in sterile water, and stored at -80°C. The absorbance at 260 nm was measured to determine the amount RNA present. An A 260 of 1.0 corresponds to an RNA concentration of about 40 ⁇ g/ml. From 1 gram (wet weight) of oocysts, approximately 0.5 mg of total RNA was obtained.
  • Poly(A) + mRNA was obtained by hybridization to oligo (dT)-cellulose.
  • the column of oligo (dT)-cellulose was equilibrated with binding buffer having a composition of 10 mM Tris-HCl pH 7.4, 1 mM EDTA, and 500 mM NaCl, and the total RNA preparation of Example I was cycled through the column two times. Unbound RNA was removed by washing the column with several column volumes of binding buffer.
  • Elution buffer having a composition of 10 mM Tris-HCl, pH 7.4, 1 mM EDTA was used to wash bound poly(A) + RNA from the column, which was precipitated as before.
  • the fol lowing describes the process of oligo (dT)-cellulose column chromatography in greater detail.
  • Oligo (dT) elution buffer 10 mM Tris-HCl, pH 7.4,
  • RNA solution was then adjusted to 5-10 mg/ml with the elution buffer and heated for 5 minutes at 65°C, quick-cooled and mixed with an equal volume of the 2X oligo (dT) binding buffer.
  • RNA solution was chromatographed on an oligo (dT)-cellulose column (about 2 grams oligo (dT)-cellulose in a 1.5 x 15 cm column) which had previously been washed with 5 column volumes of 1X oligo (dT) binding buffer; the column was eluted at a rate of about 10-15 ml/hr.
  • the oligo (dT)-cellulose column was washed with about 5 column volumes of 1X oligo (dT) binding buffer, and the RNA was eluted with about two to three column volumes of elution buffer and collected in fractions of about 25-35 drops with the aid of a Gilson fraction collector. 6. Absorbances of the fractions were determined and the UV-absorbing material pooled to produce the 1X oligo (dT) purified "poly A + RNA".
  • RNA fractions were either rechromatographed on an oligo (dT)-cellulose column to further purify the poly A + RNA (step 7a) or precipitated with ethanol and stored until used or further purified on oligo (dT)-cellulose (step 7b): a.
  • RNA solution was made 0.3M in sodium acetate and 2.5 volumes of 95% ethanol were added; after at least 2 hours at -20°C, RNA was pelleted by centrifugation at 10,000xg for 15 min., washed 2X with 70% EtOH and drained; RNA was then processed, starting with step 1, but the initial concentration of poly A + RNA was about 1 mg/ml or less.
  • oligo (dT)-cellulose column was cleaned by passing 2-3 column volumes of 0.1N NaOH through it. The column was then washed with 5-7 column volumes of oligo (dT) binding buffer containing 0.02% sodium azide, and stored at room temperature.
  • Example III
  • Coccidia mRNA isolated in Example II was translated in a rabbit reticulocyte lysate which had been made dependent on added RNA by treatment with micrococcal nuclease (commercially available from New England Nuclear, Boston, Massachusetts, and other sources).
  • the reagents were prepared according to the manufacturer's instructions, and 0.1-0.5 ⁇ g of RNA were added. [ 35 S]- methionine was included to radioactively label the translation products.
  • Samples run as controls were water (no RNA), rabbit globin mRNA, and poly A + RNA from the coccidia RNA preparation. The samples were incubated at 30°C for 90 minutes.
  • the dry filters were placed in scintillation vials with 5 ml of OCSTM (Amersham, Arlington Heights, Illinois) and counted in a liquid scintillation counter. Generally about 5- to 20-fold stimulation of incorporation relative to the water control was observed.
  • AMV Avian myeloblastosis virus reverse transcriptase
  • mRNA prepared in Example II was employed as a template for cDNA synthesis.
  • a radioactive marker [ ⁇ - 32 p]dCTP) was used. This allows monitoring of all steps by counting Cerenkov radiation, which does not result in any loss of sample.
  • RNA 50 ⁇ g/ml, final concentration
  • oligo (dT) 12-18 25 ⁇ g/ml
  • actinomycin D 40 ⁇ g/ml
  • AMV reverse transcriptase 800 units/ml
  • the solution was extracted one time with an equal volume of phenol: chloroform (1/1; v/v) and the aqueous phase was chromatographed on a column of Sephadex G-100 (0.7 x 20 cm) equilibrated with 10 mM Tris.HCl, pH 8.0, 1 mM EDTA, 0.1 M NaCl.
  • the mRNA:cDNA hybrid in the excluded volume was precipitated by addition of 0.1 volume of 3 M sodium acetate and 2 volumes of 95% ethanol (-20°C to -80°C).
  • the pelleted hybrid was dissolved in 300 ⁇ l 0.1 M NaOH and incubated at 70°C for 20 minutes. The solution was cooled on ice and neutralized with 30 ⁇ l of 1N HCl.
  • the cDNA was precipitated as described above.
  • a 2X reaction mixture consisting of 0.2M potassium phosphate, pH 7.4, 20 mM MgCl 2 , 2 mM DTT, 0.4 mM each of dATP, dGTP, dCTP, and dTTP was prepared and kept on ice. To this mixture was added an aqueous solution of cDNA containing the Klenow fragment of E. coli DNA polymerase I (100 units/ml. final concentration), and water was added to dilute the reaction mixture to 1X. The solution was incubated overnight at 15°C.
  • EDTA was added to 25 mM, the solution was extracted once with an equal volume of phenol: chloroform (1/1; v/v), and the aqueous phase was chromatographed on a 0.7 x 20 cm column of Sephadex G-100 equilibrated with 10 mM TrisHCl, pH 8.0, 1 mM EDTA, and 0.1M NaCl. The DNA in the excluded fractions was precipitated with ethanol as described above.
  • the ds cDNA is in the form of a hairpin.
  • the single-stranded loop was removed by digestion with S1 nuclease.
  • the ds cDNA was dissolved in water and 0.1 volume of 10X S1 buffer was added.
  • An appropriate amount of S1 nuclease was added and the solution was incubated 20 min. at 37°.
  • the amount of enzyme added was determined empirically for each enzyme preparation, since the activity varied from one preparation to another. This was done by measuring the decrease in TCAprecipitable counts from the ds cDNA. Generally, a decrease of 20-40% was observed.
  • the S1-digested cDNA was extracted once with phenol: chloroform and the cDNA in the aqueous phase was precipitated with ethanol as described above.
  • SAM S-adenosyl methionine
  • bovine serum albumin (BSA) — solution in water, sterile filtered. 8 base pair EcoRI linkers — 10 A 260 /ml, obtained from Collaborative Research, Waltham, Massachusetts. 10 mM ATP, pH 7.0.
  • [ ⁇ - 32 P]-ATP 10 mCi/ml., > 2,000 Ci/mmol, stabilized aqueous solution.
  • 10 x T4 ligase buffer 0.5M Tris-HCl, pH 7.8., 0.1M MgCl 2 , 0.2M dithiothreitol.
  • 10 x DNA polymerase buffer 0.5M Tris-HCl, pH 7.2, 0.1M MgSO 4 .
  • the cDNA from Example IV was dissolved in 20 ⁇ l of 5 x EcoRI methylase buffer, SAM was added to 80 ⁇ M, BSA was added to 0.4 mg/ml, water was added to bring the volume to 99 ⁇ l, and 1 ⁇ l of EcoRI methylase (20,000 units/ml. New England Biolabs) was added. The reaction was incubated at 37°C for 60 minutes. The reaction was then extracted 2 times with phenol and ethanol precipitated. The methylated cDNA was collected by centrifugation and dried.
  • the cDNA was treated with DNA polymerase I (Klenow fragment) in the presence of deoxynucleoside triphosphates to make the ends of the cDNA blunt.
  • the cDNA was dissolved in 24 ⁇ l of 1X DNA polymerase buffer containing 80 ⁇ M each dATP, dCTP, dGTP, and dTTP. Two units of DNA polymerase (Klenow fragment) were added and the reaction mixture was incubated at 23°C for 10 minutes. EDTA was added to 20 mM and the cDNA was extracted 2 times with phenol, once with CHCl 3 , and ethanol precipitated.
  • the cDNA which was EcoRI- methylated and blunt-ended, was collected by centrifugation, washed once with cold 70% ethanol, and dried. To prepare the linkers for addition to the cDNA, they must first be phosphorylated. 400 picomoles of 8- base pair EcoRI linkers were phosphorylated in 1X polynucleotide kinase buffer with 20 ⁇ Ci of [ ⁇ - 32 P]-ATP and 5 units of polynucleotide kinase. The reaction was incubated at 37°C for 15 minutes. Unlabeled ATP was then added to 1 mM and the reaction was incubated at 37°C for 30 minutes. The enzyme was inactivated by heating the reaction at 65°C for 10 minutes.
  • 160 picomoles of the phosphorylated linkers were then ligated to the cDNA.
  • the blunt-ended, methylated cDNA was dissolved in 10 ⁇ l of water, 160 picomoles of linkers were added, 10 x T4 ligase buffer was added to 1X, ATP was added to 1 mM, and 2 units of T4-DNA ligase (Boehringer Mannheim) were added.
  • the reaction mixture (a total of 20 ⁇ l) was incubated at 15°C for 16 hours. The ligase was inactivated by heating the reaction at 65°C for 10 minutes.
  • the cDNA had multiple linkers at the ends. Excess linkers were removed by digestion with EcoRI.
  • the ligation reaction was diluted with 5 ⁇ l of 10 x EcoRI buffer, 5 ⁇ l of 1 mg/ml BSA and 19 ⁇ l of water. Prior to addition of EcoRI, 1 ⁇ l of the mix was removed for analysis by gel electrophoresis. Ten units of EcoRI (New England Biolabs., 10 units/ ⁇ l) were added and the reaction was incubated at 37°C for 1 hour. The reaction was extracted 1 time with phenol and run over a column of Sepharose CL-4B in 10 mM Tris-HCl, pH 8, 1 mM EDTA, 0.3 M NaCl. This removed excess linkers and short pieces of DNA (up to about 100 b.p.). The fractions containing the cDNA were pooled and ethanol precipitated. The cDNA was collected by centrifugation.
  • Bacteriophage ⁇ gt11 DNA (available from the American Type Culture Collection, Accession Number 37194) prepared by standard methods (Maniatis, et al., Molecular Cloning, Cold Spring Harbor, (1982)) was linearized by digestion with EcoRI, phenol-extracted, and precipitated with ethanol. Fifty ng cDNA from Example V was mixed with
  • the recombinant DNA prepared in Example VI was packaged into bacteriophage ⁇ heads for introduction into E. coli, by procedures described by Enquist and Sternberg, Methods in Enzymology, 68, 281-298 (1979).
  • Packaging extracts are available commercially (Promega Biotec, Madison, Wisconsin, and other sources) and were used according to the manufacturer's instructions.
  • the ligated DNA was mixed with the packaging extracts (50 ⁇ l), incubated at 23°C for 2 hours, the phages were diluted to 0.5 ml with 10 mM MgSO 4 , 10 mM Tris-HCl, pH 7.5., 0.01% gelatin, and a few drops of chloroform were added to the mixture.
  • the packaged phages were stored at 4°C.
  • the phage were diluted serially in 10 mM MgSO 4 , 10 mM Tris-HCl, pH 7.5, and 0.01% gelatin. Fifty ⁇ l of diluted phage were added to 0.2 ml of E . coli cells, and the mixture was incubated at 37°C for 15 minutes to allow absorption of the phage. The infected cells were mixed with molten (47°C) LB broth containing 0.7% agar and poured on an LB-agar plate. After the top agar hardened, the plates were incubated at 37°C for 5-6 hours, at which time plaques could clearly be seen in the lawn of bacteria.
  • Recombinant bacteriophages were distinguished from the vector by addition of Xgal (.04%) and IPTG (0.4 mM) to the top agar. After 6-8 hours, nonrecombinant phages were blue while those carrying inserts were colorless.
  • the library of recombinant phages was amplified. Phages were diluted, mixed with E. coli Y1088, and plated as above at a density of about 10,000 phages/85 mm petri plate. After about 6 hours of growth, the plates were transferred to 4°C and 4 ml of 50 mM Tris-HCl, pH 7.5, 10 mM MgSO 4 , 100 mM NaCl, 0.01% gelatin (SM) were added to the surface of the plates. The plates were rocked gently for 2 hours and the phage suspension was removed with a pipet. The combined phage suspensions were mixed with chloroform, the bacterial debris was removed by low-speed centrifugation and the phage library was stored in the presence of chloroform at 4oC.
  • SM gelatin
  • Recombinant bacteriophages were screened for their ability to produce a protein which is recognized by antibodies present in serum from chickens which have been infected with E. tenella.
  • the phages were screened as lysogens, where they were grown as colonies and then induced for both phage and ⁇ -galactosidase production.
  • E. coli Y1089 ( ⁇ lacU169 proA + ⁇ lon araD139 strA hflA [chr::Tn10] (pMC9)) (available from the American Type Culture Collection, accession number 37196) in LB + 0.2% maltose was collected by centrifugation and the cells were resuspended in 12.5 ml of 10mM MgSO 4 . Phages from the amplified library described in Example VII were added to the cells at a multiplicity of infection of 2.5. The cells were incubated at 30oC for 20 minutes and then plated on a cellulose acetate filter placed on an LB agar plate at a density of 5-10,000 colonies per 85 mm plate.
  • the colonies were grown 8-12 hours at 30°C.
  • a nitrocellulose filter pre-moistened with LB was pressed on top of the colonies on the cellulose acetate filter, removed and placed colony-side up on a fresh LB agar plate, and stored at 4°C.
  • the cellulose acetate filter with the remaining parts of colonies was placed on top of a nitrocellulose filter which was already in place on a fresh LB agar plate containing 0.4 mM IPTG.
  • the lysogens were grown at 42°C for another 2 hours to allow for induction of ⁇ and of ⁇ -galactosidase.
  • the nitrocellulose filter was removed from the plate and washed (batchwise if more than one filter was being processed) with four 50 ml changes of Tris-buffered saline (TBS; 50 mM Tris-HCl, pH 8.0, 0.5 M NaCl).
  • TBS Tris-buffered saline
  • the filters were then blocked with a solution of 3% gelatin in TBS.
  • the filters could be blocked together if they were placed back-to-back.
  • Ten ml of the blocking solution was used per 2 filters in an 85 mm petri dish. After 60 minutes, the blocking solution was removed and the primary antibody was added.
  • the primary antibody consisted of 10 ⁇ l of chicken anticoccidia antiserum in 5 ml of 1% gelatin in TBS and 0.5 ml of normal rabbit serum.
  • the primary antibody was allowed to react with the filters for 4 hours at room temperature with gentle rocking. After the incubation period, the filters were washed (also batchwise) with four 100 ml changes of TBS. The second antibody solution was then reacted with the filter to allow detection of the positive transformants.
  • the second antibody solution consisted of 10 ⁇ l of rabbit antichicken IgG conjugated with horseradish peroxidase (available commercially). The second antibody was allowed to react with the filters for 1 hour at room temperature with gentle rocking. After the incubation, the filters were washed 4 times with 100 ml of TBS.
  • the filters were then developed by placing them in the developing solution, which consisted of 32 mg of 4-chloro-1- naphthol, 12 ml methanol, 60 ml of TBS, and 120 ⁇ l of 30% H 2 O 2 .
  • the developing solution was prepared freshly with components added in the order listed.
  • the filters were left in the developing solution until color development was maximum (about 5 minutes).
  • the filters were then washed with water, dried, and used to locate the positive colonies on the replicate nitrocellulose filter.
  • Phages from the amplified library of recombinant phages in Example VII were transfected into a host in which lysis and plaque formation occurs. The plaques were transferred to a nitrocellulose filter and were screened for their ability to bind to anticoccidia antibodies.
  • the host was E . coli Y1090 ( ⁇ lacU169 proA + ⁇ lon araD139 strA supF [trpC::Tn10] (pMC9)) (available from the American Type Culture Collection, accession number 37197), which was grown overnight in LB + .2% maltose, centrifuged, and resuspended in 0.5 volume of 10 mM MgSO 4 . Cells were used for 1-2 days.
  • the amplified phage library was diluted in SM such that 50 ⁇ l contained 5-10,000 plaque-forming units. Fifty ⁇ l of the suitably-diluted phage was added to 100 ⁇ l of the cell suspension. The mixture was incubated for 15 minutes at 37oC to allow absorption of the phages. To the infected cells were added 2.5 ml of molten LB + 0.7% agarose. The suspension was mixed briefly and plated on an LB-agar plate. After the top agarose had solidified, the plates were incubated at 42°C for 5-6 hours. A nitrocellulose filter saturated with 0.01 M IPTG was laid over the plaques and the plate was incubated at 37°C for 2 hours.
  • the filter was removed, washed 4 times with 50 ml of TBS at room temperature, and incubated for at least 1 hour with gentle shaking at room temperature with 3% gelatin in TBS to reduce nonspecific binding of the antibodies.
  • the blocking solution was removed and the primary antibody solution, consisting of 10 ⁇ l of chicken immune serum in 4.5 ml of 1% gelatin and 0.5 ml normal rabbit serum, was added.
  • the filters were rocked gently in the primary antibody solution for at least 1 ⁇ our.
  • the filter was then washed 4 times with 50 ml of TBS at room temperature and the second antibody solution, consisting of 10 ⁇ l of rabbit antichicken IgG conjugated with horseradish peroxidase in 5 ml of 1% gelatin in TBS, was added.
  • the filter was rocked gently for 1 hour and then washed 4 times with 50 ml of TBS.
  • the filters were developed by placing the filter in a freshly-prepared solution of 32 mg of 4-chloro-1-naphthol in 12 ml methanol, 60 ml of TBS, and 120 ⁇ l of 30% H 2 O 2 . After a short period of time, positive plaques turned dark blue and negative plaques were lighter blue or colorless.
  • Phage DNA was isolated from positive lysogens or plaques by procedures described by Maniatis, et al., supra. DNA was analyzed first by restriction enzyme analysis to determine the size of the insert in the vector .
  • the mixture was left at room temperature for 30 minutes and then centrifuged for 20 minutes at 20,000 rpm in a Sorvall SS-34 rotor at 4oC.
  • the supernatant solution was removed, pancreatic DNase and RNase were added to a final concentration of 1 ⁇ g/ml and the solution was incubated at 37oC for 30 minutes.
  • the phage particles then were collected by centrifugation at 28,000 rpm in a Beckmann 70.1 Ti rotor for 1 hour.
  • the pellet was resuspended in 50 mM Tris-HCl, 5 mM EDTA, 0.1% SDS, pH 7.5, and heated at 68 oC for 30 minutes.
  • the solution was extracted once with phenol, once with phenol: chloroform (1:1) and once with chloroform.
  • the DNA in the aqueous phase was precipitated with ethanol.
  • phages were used to infect E. coli Y1088 and the infected cells were plated in 0.7% top agarose at a density of about 50,000 plaques per 150 mm petri plate. After 5-6 hours at 42°C when nearly confluent lysis had occurred, 6.5 ml of SM were poured on the plates and they were incubated with gentle shaking at 4oC for 2 hours.
  • the phage suspension was removed from the plates, a few drops of chloroform were added, and the debris was removed by centrifugation for 10 minutes at 5,000 rpm in a Sorvall SS-34 rotor at 4oC. The supernatant was removed and filtered through a 0.45 ⁇ filter. The phages in the filtrate then were collected by centrifugation through a discontinuous glycerol gradient.
  • the glycerol gradients were prepared by placing 3 ml of 40% glycerol in SM in a polyallomer tube for a Beckman SW40 rotor and layering 3 ml of 5% glycerol in SM on top.
  • the phage solution was layered carefully over the 5% glycerol layer and centrifuged for 1 hour at 35,000 rpm at 4°C in an SW40 rotor. At the end of the run, the solutions were removed and the pelleted phages were resuspended in 0.5 ml of SM. Pancreatic RNase A was added to 10 ⁇ g/ml, pancreatic DNase I was added to 1 ⁇ g/ml, and the solution was incubated at 37°C for 30 minutes. Following the incubation, 5 ⁇ l of 0.5M EDTA, pH 8.0 and 5 ⁇ l of 10% SDS were added and the solution was incubated at 68°C for 15 minutes.
  • the solution was extracted once with an equal volume of phenol, once with an equal volume of phenol: chloroform (1:1, v/v), and once with an equal volume of chloroform.
  • the lambda DNA was precipitated by addition of an equal volume of isopropanol.
  • the DNA was collected by centrifugation, washed once with 70% ethanol, dried, and resuspended in 10 mM Tris ⁇ Cl, pH8, 0.1mM EDTA. Typical yields from one 150mm plate were 10-50 ⁇ g of DNA.
  • DNA is isolated from highly-purified E. tenella oocysts by the procedure of Blin and Stafford, Nucleic Acids Res., 3, 2303-2308 (1976). Oocysts are suspended in 0.5 M EDTA, 100 ⁇ g/ml proteinase K, and 0.5% Sarcosyl, and incubated at 50°C for 3 hours. The solution containing lysed cell debris and high-molecular weight DNA is extracted 3 times with phenol, 3 times with sec-butanol to reduce the volume, and dialyzed exhaustively against 50 mM Tris-HCl, 10 mM EDTA, 10 mM NaCl, pH 8.
  • the DNA is then treated with RNase at 100 ⁇ g/ml for 30 minutes at 37oC, extracted twice with phenol/chloroform (1:1), and dialyzed against 10 mM Tris-HCl, 1 mM EDTA pH 8.0.
  • the E. tenella DNA is incubated in 33 mM Tris-HCl, pH 7.6, 0.01 M MgCl 2 at room temperature with DNase I (1 ng/10 ⁇ g of DNA, Boehringer Mannheim). After 10, 20, and 30 minutes, one-third of the reaction is transferred to a tube containing 1/8 volume of 0.1 M EDTA, pH 8.0, to stop the reaction. Digested DNA is analyzed by electrophoresis on a 6% polyacrylamide gel. The fraction containing mostly DNA in the size range of 200-600 base pairs is run on a large, preparative gel, the region of the gel containing fragments of 200-600 base pairs is excised, and the DNA is electroeluted in 0.1 x TBE. The DNA is concentrated and purified by use of an Elutip-d column (Schleicher and Schuell), used according to the manufacturer's instructions. The DNA is precipitated with ethanol.
  • Example XII The purified, concentrated DNA is collected by centrifugation, dried, resuspended in water, and prepared for insertion into ⁇ gtl 1 as described in Example V.
  • the DNA which is methylated and modified by addition of EcoRI linkers is ligated into ⁇ gt11 and packaged as described in Example VI. Recombinant phages are screened as described in Examples VII and VIII.
  • Example XII The DNA which is methylated and modified by addition of EcoRI linkers is ligated into ⁇ gt11 and packaged as described in Example VI. Recombinant phages are screened as described in Examples VII and VIII.
  • gene-length fragments are generated by digestion of E. tenella DNA with mung bean nuclease using procedures described by McCutchan et al. (Science, 225, 625-628 (1984)).
  • DNA isolated as described in Example XI is incubated in 0.2M NaCl, 1mM ZnSO 4 , 30mM sodium acetate, pH 4.6, and various concentrations of formamide (30, 35, 40 and 45%) with 1 unit of mung bean nuclease (P-L Biochemicals) per ⁇ g of DNA. Incubations are done at 50°C for 30 minutes.
  • the DNA is analyzed by agarose gel electrophoresis and
  • Example IX Southern blot analysis using a 32 P-labeled fragment from the positive phage described in Example IX as the probe.
  • the reaction mixture which gives an indication of the presence of full-length gene fragments by hybridization is diluted four-fold with 10 mM Tris-HCl, pH 8, 10mM EDTA, extracted with phenol and ethanol precipitated.
  • the DNA is prepared for insertion into ⁇ gt11 by EcoRI methylation and addition of EcoRI linkers as described in Example V.
  • the DNA is inserted into ⁇ gt11 and the recombinant phages are analyzed as described in Examles VI-IX.
  • Example IX The ⁇ -galactosidase/coccidia antigen fusion gene identified in Example IX was transferred to a plasmid for production of that fusion gene product.
  • GX5401 lambda DNA was digested with Kpnl, extracted with phenol and ethanol precipitated.
  • Plasmid pGX3213 constructed by inserting the cloning bank from plasmid pUC18 (commercially available from Pharmacia P-L Biochemicals, and other sources) into the EcoRI-Hindlll sites of PGX1066 [E. coli strain GX1186 (E.
  • coli strain GX1170 transformed with pGX1066) has been deposited with the American Type Culture Collection, Rockville, MD., as ATCC 39955]) was digested with Kpnl, extracted with phenol, and ethanol precipitated. The two Kpnl-cut DNAs were ligated at about 100 ⁇ g/ml DNA concentrations using T4 DNA ligase, phenol extracted, and ethanol precipitated. The ligated DNA was digested with Hindlll, diluted to about 1 ⁇ g/ml DNA concentration, and ligated with T4 DNA ligase. The ligation mixture was used to transform E. coli JM101 (ATCC 33876) which had been made competent for uptake of DNA by standard procedures.
  • the transformants were screened for the presence of the ⁇ -galactosidase/coccidia antigen fusion gene by restriction digestion of plasmid DNA prepared by standard procedures.
  • the plasmid carrying the coccidia antigen/ ⁇ -galactosidase fusion gene was designated pGX3215.
  • the plasmid is about 12 k.b. and carries the fusion gene and the E. coli lac operon regulatory elements such that synthesis of the fusion gene product is controlled by those regulatory elements.
  • E. coli strain GX5408 strain JM101 transformed by pGX3215
  • Example XIV Example XIV
  • E. coli strain GX5408 was grown overnight at 37°C in 10 ml of LB broth containing 100 ⁇ g/ml ampicillin.
  • One liter of LB broth containing 100 ⁇ g/ml ampicillin in a 2 liter flask was inoculated with the 10ml overnight culture and incubated with vigorous shaking at 37°C.
  • a 600 of the culture reached 0.6
  • 4 ml of 0.1M IPTG were added and incubation was continued for 2 hours.
  • the cells were harvested by centrifugation at 4°C at 7,000 rpm for 10 minutes in a Sorvall GS-3 rotor.
  • the cell pellet (about 2-3 g wet weight per liter culture) was resuspended in 100 ml of 0.05M sodium phosphate, pH 7.0, and centrifuged again.
  • the cells were resuspended in 0.05M sodium phosphate, pH 7.0 (5 ml/g wet weight of cells) and disrupted by sonication using a Branson Sonicator. Sonication was done for four 30-second bursts at full power with the cell suspension chilled in ice. The bursts were done at 1-minute intervals.
  • Cell debris was removed from the sonicated suspension by centrifugation at 4oC at 15,000 rpm for 20 minutes in a Sorvall SM-24 rotor. The supernatant was removed and the gene product was partially purified from it.
  • the protein solution was applied to a column (1.5 x 50 cm) of Sephacryl 5-300 (Pharmacia) equilibratd in 0.05M Tris.HCl, pH 7.5.
  • the protein was eluted with the same buffer.
  • Column fractions were monitored for the presence of the ⁇ -galactosidase/coccidia antigen fusion protein by SDS-polyacrylamide gel electrophoresis. Fractions containing the fusion protein were pooled and the proteins were precipitated by adding ammonium sulfate to 36% as above.
  • the protein was collected, dissolved in a minimum volume of 0.1 M sodium phosphate, pH 7.5 + 0.2mM dithiothreitol, and dialyzed extensively against the same buffer.
  • fusion protein has a molecular weight of 140,000-160,000 daltons of which 115,000 daltons is ⁇ -galactosidase and the remainder is coccidia antigen.
  • the typical yield of fusion protein from 1 liter of culture was 10-20 mg of protein which contained 10-20% ⁇ -galactosidase/coccidia antigen fusion protein.
  • Example XIV The antigenic protein purified in Example XIV was tested for ability to protect chickens against
  • E. coli lamB protein which is the maltose-binding protein located in the outer membrane.
  • the lamB sequence is set forth in Clement and Hofnung, Cell 27:507 (1981). See also Benson and Silhavy, Cell 32:1325-1335 (1983).
  • the DNA fragment coding for the coccidia antigen is excised using EcoRI and purified away from the vector.
  • the ends of the coccidia antigen DNA fragment are modified with EcoRI-Xmal adapter molecules so that the fragment can be inserted into the lamB gene which has been cut with Xmal.
  • a plsmid ⁇ GX3216 carrying the lamB gene regulated by a hybrid ⁇ O L PR regulatory region is used.
  • E. coli strain GX5409, which carries pGX3216, has been deposited with the American Type Culture Collection and given accession number .
  • E. coli strains expressing the lamB-coccidia fusion on their surface are added (10 2 to 10 6 cells/g feed) to a feed mixture .for chickens. Birds are allowed to feed freely. Following one, two, or three weeks of feeding, birds are challenged with E. tenella oocysts in the feed, and are monitored for the development of the disease state. Birds are monitored for feed conversion, weight gain, and lesion scores for up to 6 weeks. Serum from the test birds are also monitored for production of antibodies against the antigen protein. Antigens which show protection are tested in a similar test protocol for protection against other species of coccidia.
  • Synthetic peptides with an amino aeid sequence of a portion of the coccidia antigen sequence are synthesized automatically using a commercial peptide synthesizer (Biosearch, Vega, Beckman). Any synthetic peptide may be potentially immunogenic. One which may be useful is a peptide homologous to the repeated regions found in the antigen (see Figure 1). Others are chosen at random but selected for having a high content of hydrophilic residues and therefore likely to be exposed on the surface of the organism. Peptides are chosen to be longer than 6 amino acid residues.
  • the peptide is coupled to an immunogenic carrier protein such as bovine serium albumin or hemocyanin using known techniques (Peters and Richards, Am. Rev. Biochem. 46:523-55 (1977)) and the resulting peptide/carrier protein is tested for in vivo activity as described in Example XV.
  • an immunogenic carrier protein such as bovine serium albumin or hemocyanin
  • the 5' end of the gene can be confined using S1 nuclease mapping (Berk and Sharp, Cell, 12: 721, 1977).
  • Smal site is inserted using oligonucleotide directed mutagenesis (Zoller and Smith, Methods in Enzymology, 100: 468-500, 1983).
  • oligonucleotide directed mutagenesis Zaller and Smith, Methods in Enzymology, 100: 468-500, 1983.
  • one of the same endonuclease sites is placed on the 3' end of the gene several bases in the 3' direction past the polyadenylation signal sequence (Wickens and Stephenson, Science, 226: 1045-1051, 1984) in the DNA.
  • the coccidia antigen gene is also subcloned into phage M13 or a plasmid capable of single stranded replication.
  • the restriction endonuclease sites added at the 5' and 3' ends of the gene are chosen based on their absence in the coccidia antigen gene and their presence at the appropriate site in the cotransfection plasmid, pGS20 in this case.
  • Plasmid pGS20, ATCC 39249 which contains the vaccinia virus promoter for the 7.5 K gene followed by BamHI and Smal cloning sites all embedded within the vaccinia thymidine kinase gene, is digested with Smal.
  • the plasmid with the modified coccidia antigen gene is digested with the restriction enzyme specific for the inserted endonuclease sites and the antigen gene fragment is isolated.
  • the fragment is then cloned into ⁇ GS20 at the BamHI or Smal site 3' to the 7.5 K gene promoter in the proper orientation to be placed under its control.
  • the result is a "coccidia transfection plasmid" that will insert the coccidia gene into the vaccinia TK gene through an appropriate in vivo recombination event.
  • the coccidia transfection plasmid (1 ⁇ g) and calf thymus carrier DNA (20 ⁇ g) is precipitated with calcium phosphate (Gram and Van der Eb, Virology 52: 456-457, 1973; Stone et al., J. Virology, 28: 182-192, 1978), then used to transfect TK-143 cells two hours after infection with wild type vaccinia virus strain WR at 0.01 to 0.05 PFU/cell.
  • the virus infected, DNA cotransfected cells are allowed to grow for 2 days in Eagle's medium supplemented with 10% fetal bovine serum.
  • the cell monolayer is then harvested in Eagle's medium with 2% fetal bovine serum, frozen and thawed 3X to release virus, then assayed for the presence of TK- recombinants (Weir et al., Proc. Natl. Acad. Sci., 79: 1210-1214, 1982; Macket et al., supra) by infecting a monolayer of TK-143 cells with virus dilutions in the presence of 1% agarose in culture medium with 25 ⁇ g/ml bromodeoxyuridine (BrdUrd). In the presence of BrdUrd only TK- virus replicates.
  • Vaccinia virus TK- recombinants positive for the expression of coccidia antigen are used to infect chickens intradermally. Two weeks later live coccidia challenge is given in the drinking water. Birds are analyzed for weight gain, lesion scores and feed conversion as described in Example XV.
  • yeast invertase and the antigen is constructed.
  • the sequences controlling expression of the fusion protein encoded by this gene are derived from the invertase gene.
  • the invertase DNA sequence required in this invention exists in a plasmid designated YpGX610, which comprises the entire YEp13 sequence (Broach, et al.,
  • the YEp13 plasmid is available from the American Type Culture Collection, ATCC catalog number 37115) and a segment of the invertase gene encoding the signal and mature protein through amino acid #103.
  • the amino acid sequence of the invertase gene is given by Taussig and Carlson. Nucleic Acid Research 6:1943-1954 (1983). This plasmid has been identified as an invertase clone from a library of yeast DNA previously constructed.
  • Fusion of the genes encoding coccidia antigenc protein and invertase is accomplished by first adding appropriate restriction endonuclease recognition sites to the invertase and coccidia gene segments and ligating the DNA fragments to assemble the expression vector by standard techniques (Maniatis et al., supra).
  • the invertase encoding region is excised from YpGX610 as an approximately 6.8 kb Sail fragment.
  • Sail restriction endonuclease cleaves YpGX610 into two equal size fragments. These Sall fragments are ligated with Ml3mp8 (commercially available) which has been linearized with SalI restriction endonuclease.
  • the oligonucleotide sequence GAA GTG GAC CAA AGG can be used to identify the desired clone by standard DNA hybridization protocols.
  • the M13 clone containing invertase sequence is designated MGX1200.
  • An oligonucleotide primer then is used to insert a BamHI rstriction endonuclease recognition site near the end of the invertase sequence in MGX1200.
  • the oligonucleotide 5' ATT GAA AAA CCC ACT CGT GTG GAT CCT GTT GTA ATC AAC CAC is utilized for this purpose.
  • Oligonucleotide directed mutagenesis and screening of plaques potentially containing the desired mutation are completed using standard protocols (Zoller and Smith, supra, 100 (1983)).
  • Potential mutant clones are screened by hybridization with the same oligonucleotide used to prime the mutagenesis or by cutting double-stranded M13 DNA with BamHI restriction endonuclease.
  • the desired clones have two recognition sites for BamHI. Correct alignment of the new restriction site is confirmed by DNA sequence analysis.
  • the clone with an added BamHI site is designated MGX1201.
  • the invertase sequence of MGX1201 is excised by cutting double-stranded MGX1201 with Sall and BamHI restriction endonuclease.
  • the gene encoding the coccidia antigen protein is excised from pGX3215 (Example XIII) as a 1.8 kb EcoRI fragment and is ligated with EcoRI linearized M13mp8. This EcoRI fragment can exist in two orientations in M13mp8. The desired orientation of the gene sequence is clockwise.
  • Recombinant M13 plaques with the properly oriented gene are identified by DNA hybridization with the oligonucleotide 5' G C C C T C T T C T C CJ G. This M13 recombinant phage is designated MGX1202.
  • a recognition sequence for the enzyme Bglll is inserted by oligonucleotide directed mutagenesis at the start of the coccidia antigenic protein coding region.
  • the oligonucleotide 5' CTCCGGTTTGGCCACAGATCTCAATTCGTAATC ATGG is used to prime the mutagenesis.
  • plaques are screened either by identifying the new Bglll site by restriction endonuclease digestion or by hybridization screening with the mutagenic oligonucleotide. DNA sequence analysis is used to confirm insertion of the desired sequence.
  • the new vector is designated MGX1203.
  • the gene encoding the coccidia antigenic protein is excised from MGX1203 as a 1.8 kb Bglll - Hindlll restriction endonuclease fragment.
  • An expression vector containing the invertase- coccidia antigen fusion gene can be generated as follows.
  • the MGX1201 vector is digested with Sall and BamHI and the fragment containing the invertase partial seuqence excised in accordance with standard techniques.
  • MGX1203 is digested with Bglll and Hindlll to excise the fragment carrying the coccidia antigen gene.
  • coli strain HB101 (YpGXl) has been deposited with the American Type Culture Collection, Rockville, MD as ATCC 39692), which is the YEp13 vector with the yeast chromosomal Sall site removed. It contains a 2 micron (2 ⁇ ) sequence and the chromosomal marker leu-2 and can be digested with Sall and Hindlll to excise a fragment of the vector which contains these two sequences.
  • the three fragments are ligated; since BamHI and Bglll leave the same overhangs, the Bglll end will anneal and ligate with the BamHI end.
  • the desired vector designated YpGX611, is properly identified by digestion with Sall and Hindlll restriction endonuclease digests.
  • Various host strains carrying defects in the chromosomal LEU2 gene are transformed with YpGX611 by the protocol of Hinnen et al., PNAS 75:1929 (1978).
  • the segment of the yeast 2 ⁇ plasmid contained in YpGX611 permits autonomous replication of the vector in Saccharomyces, and the LEU2 gene complements the chromosomal defect.
  • invertase - avian coccidia fusion protein is detected by Western blot analysis (Burnett, Anal. Biochem. 112:195-203 (1981)) using antibody specific for the coccidia antigenic protein.
  • the cellular location of the fusion protein (cystoplasm or cell wall) is determined by Western blot analysis of fractionated cell extracts. Cytoplasmic location of the fusion protein allows production, isolation, and testing of the product as a "subunit"vaccine. Cell surface location of the fusion allows evaluation of the strain as a live vaccine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Un gène cloné ou un fragment de celui-ci code des protéines antigènes se liant avec un anticorps monoclonal ou polyvalent qui est dirigé contre une protéine antigène de la coccidia avienne.
EP19850903899 1984-07-05 1985-07-05 Gene clone et son procede de preparation et d'utilisation. Ceased EP0190254A4 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US62781184A 1984-07-05 1984-07-05
US627811 1984-07-05
US74652085A 1985-06-19 1985-06-19
US746520 1985-06-19

Publications (2)

Publication Number Publication Date
EP0190254A1 true EP0190254A1 (fr) 1986-08-13
EP0190254A4 EP0190254A4 (fr) 1987-03-09

Family

ID=27090539

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19850903899 Ceased EP0190254A4 (fr) 1984-07-05 1985-07-05 Gene clone et son procede de preparation et d'utilisation.

Country Status (2)

Country Link
EP (1) EP0190254A4 (fr)
WO (1) WO1986000528A1 (fr)

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4874705A (en) * 1985-05-16 1989-10-17 Solvay & Cie, S.A. DNA encoding an antigenic protein derived from Eimeria tenella and vaccines for prevention of coccidiosis caused by Eimeria tenella
US5187080A (en) * 1984-06-05 1993-02-16 Solvay & Cie S.A. DNA encoding an antigenic protein derived from Eimeria tenella and vaccines for prevention of coccidiosis caused by Eimeria tenella
US4639372A (en) * 1984-06-29 1987-01-27 Merck & Co., Inc. Coccidiosis vaccine
US5279960A (en) * 1984-07-05 1994-01-18 Enzon Corp. 25 KD coccidial antigen of eimeria tenella
US5273901A (en) * 1984-07-05 1993-12-28 Enzon Corp. Genetically engineered coccidiosis sporozoite 21.5 Kb antigen, ac-6b
EP0231537B1 (fr) * 1985-12-03 1992-03-11 Solvay Protéines antigènes et vaccins les contenant pour prévention de coccidiose
DE3752182T2 (de) * 1986-01-27 1998-08-06 Syntro Corp Abgeschwächte herpesviren, herpesviren, die eine für aminosäuresequenzen kodierende fremd-dns enthalten, sowie impfstoffe, die diese enthalten
US5310668A (en) * 1986-06-20 1994-05-10 Merck & Co., Inc. Varicella-zoster virus as a live recombinant vaccine
WO1988002022A1 (fr) * 1986-09-22 1988-03-24 Commonwealth Scientific And Industrial Research Or Virus de la variole recombinant
WO1988006629A1 (fr) * 1987-03-06 1988-09-07 Synergen Incorporated Polypeptides servant au diagnostic des coccidioses et procedes deproduction de ces polypeptides utilisant l'adn recombinant
JP2531729B2 (ja) * 1987-03-27 1996-09-04 日本ゼオン株式会社 組み換えアビポックスウイルス
AU605567B2 (en) * 1987-03-11 1991-01-17 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
DE10399032I1 (de) * 1987-08-28 2004-01-29 Health Research Inc Rekombinante Viren.
US5286639A (en) * 1987-09-16 1994-02-15 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
CA1340203C (fr) * 1987-09-16 1998-12-15 Noboru Yanagida Virus de la variole aviaire, recombinant
US5128284A (en) * 1987-10-23 1992-07-07 Allied-Signal Inc. Preparation of lanthanum chromite powders by sol-gel
GB8724885D0 (en) * 1987-10-23 1987-11-25 Binns M M Fowlpox virus promotors
FR2632863B2 (fr) * 1987-10-29 1990-08-31 Transgene Sa Virus du fowlpox recombinant et vaccins derives de ces virus
FR2622456B1 (fr) * 1987-10-29 1990-02-02 Transgene Sa Virus du fowlpox recombinant, vecteurs d'expression de proteines heterologues et vaccins pour la volaille derives de ce virus
NZ227597A (en) * 1988-01-15 1991-11-26 Merck & Co Inc Eimeria tenella group b immunogens and their production
US5824656A (en) * 1988-01-15 1998-10-20 Merck & Co., Inc. Recombinant and native group B eimeria tenella immunogens useful as coccidiosis vaccines
US4973551A (en) * 1988-01-15 1990-11-27 Merck & Co., Inc. Vector for the expression of fusion proteins and protein immunogens
ZA889230B (en) * 1988-02-12 1989-08-30 Us Agriculture Cloned genes coding for avian coccidiosis antigens which induce a cell-mediated immune response and method of producing the same
US5122471A (en) * 1988-02-12 1992-06-16 The United States Of America As Represented By The Secretary Of Agriculture Cloned genes coding for avian coccidiosis antigens which induce a cell-mediated immune response
US4863490A (en) * 1988-02-22 1989-09-05 Gte Laboratories Incorporated Titanium diboride-based composite articles with alumina dispersoids, having improved fracture toughness
US4889836A (en) * 1988-02-22 1989-12-26 Gte Laboratories Incorporated Titanium diboride-based composite articles with improved fracture toughness
ZA893740B (en) * 1988-06-03 1990-02-28 Hoffmann La Roche Recombinant coccidiosis vaccines
FR2632709B1 (fr) * 1988-06-10 1990-08-31 Frey Andre Dispositif de rehabilitation in situ de canalisations non visitables de l'interieur
US5631154A (en) * 1988-06-10 1997-05-20 Therion Biologics, Incorporated Self assembled, defective, non-self-propagating lentivirus particles
GB2220941B (en) * 1988-06-24 1991-09-11 Nat Res Dev Fowlpox virus non-essential regions
ZA894726B (en) * 1988-06-27 1990-03-28 Akzo Nv Coccidiosis vaccine
JPH03505970A (ja) * 1988-07-05 1991-12-26 ジェネックス・コーポレーション 遺伝子工学によるコクシジウム症ワクチン
US5093258A (en) * 1988-08-26 1992-03-03 Therion Biologics Corporation Recombinant fowlpox virus and recombination vector
US5252713A (en) * 1988-09-23 1993-10-12 Neorx Corporation Polymeric carriers for non-covalent drug conjugation
US6008342A (en) * 1991-07-12 1999-12-28 Roche Vitamins Inc. DNA encoding eimeria antigen
US5403581A (en) * 1991-07-12 1995-04-04 Hoffmann-La Roche Inc. Coccidiosis vaccines

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0135712A2 (fr) * 1983-08-19 1985-04-03 American Cyanamid Company Antigènes et anticorps monoclonaux réactifs contre les sporozoites d'Eiméria Spp.
EP0164176A2 (fr) * 1984-06-05 1985-12-11 Solvay Protéines antigéniques, vaccins les contenant, anticorps protecteurs dirigés contre elles pour la prévention de la coccibiose causée par Eimeria tenella
EP0167443A2 (fr) * 1984-06-29 1986-01-08 Merck & Co. Inc. Vaccin contre la coccidiose

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0135712A2 (fr) * 1983-08-19 1985-04-03 American Cyanamid Company Antigènes et anticorps monoclonaux réactifs contre les sporozoites d'Eiméria Spp.
EP0164176A2 (fr) * 1984-06-05 1985-12-11 Solvay Protéines antigéniques, vaccins les contenant, anticorps protecteurs dirigés contre elles pour la prévention de la coccibiose causée par Eimeria tenella
EP0167443A2 (fr) * 1984-06-29 1986-01-08 Merck & Co. Inc. Vaccin contre la coccidiose

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BIOLOGICAL ABSTRACTS / REVIEWS-REPORTS-MEETINGS, vol. 29, no. 90288; H.D. DANFORTH et al.: "Development of an avian coccidial antigen by recombinant DNA technology", & POULTRY SCIENCE (US) 1985, vol. 64, no. suppl. 1 p85 *
See also references of WO8600528A1 *

Also Published As

Publication number Publication date
EP0190254A4 (fr) 1987-03-09
WO1986000528A1 (fr) 1986-01-30

Similar Documents

Publication Publication Date Title
WO1986000528A1 (fr) Gene clone et son procede de preparation et d'utilisation
US5709862A (en) Isolated protein from Eimeria useful as a cross species vaccine
US5482709A (en) Eimeria antigenic composition which elicits antibodies against avian coccidiosis
US4973551A (en) Vector for the expression of fusion proteins and protein immunogens
AU596561B2 (en) Immunologically active peptides capable of inducing immunization against malaria and genes encoding therefor
KR0156545B1 (ko) 재조합 포자충증 백신
EP0134799B1 (fr) EXPRESSION DE POLYPEPTIDES DE $i(PLASMODIUM FALCIPARUM) A PARTIR D'ADNc
EP0162738A1 (fr) Production d'unités secondaires de vaccins de virus pseudorabique
US4874705A (en) DNA encoding an antigenic protein derived from Eimeria tenella and vaccines for prevention of coccidiosis caused by Eimeria tenella
KR0165115B1 (ko) 콕시듐증 백신
AU623624B2 (en) Recombinant and native group b eimeria tenella immunogens useful as coccidiosis vaccines
EP0432168B1 (fr) Vaccin contre la coccidiose prepare par genie genetique
US5387414A (en) Recombinant anticoccidial vaccine
KR100244828B1 (ko) 콕시디아증 백신
JP3215692B2 (ja) 組み換えコクシジウム症ワクチン
AU636290B2 (en) Recombinant eimeria tenella vaccines
US5597570A (en) Protein recognized by antibodies raised against native P28 of schistosoma mansoni
KR19990082086A (ko) 엠에스에이1 펩타이드의 첨가에 기초한 말라리아 백신
MXPA04000127A (es) Acidos nucleicos que codifican a antigenos recombinantes de gametocitos de eimeria maxima de 56 y de 86 kda y sus usos.
NZ264914A (en) Eimeria t-lymphocyte stimulatory proteins, their production and vaccines thereof
WO1992004461A1 (fr) Vaccin contre la coccidiose mis au point par genie genetique
EP0403698B1 (fr) Vaccin contre Eimeria tenella
AU747818B2 (en) Vaccines
AU701173B2 (en) New Toxoplasma gondii antigens
US5824656A (en) Recombinant and native group B eimeria tenella immunogens useful as coccidiosis vaccines

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): DE FR GB IT NL

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: GENEX CORPORATION

17P Request for examination filed

Effective date: 19860728

A4 Supplementary search report drawn up and despatched

Effective date: 19870309

17Q First examination report despatched

Effective date: 19890322

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 19930801

RIN1 Information on inventor provided before grant (corrected)

Inventor name: MCCANDLISS, RUSSELL, JOHN

Inventor name: ANDERSON, DAVID, M.