CN1920015B - Recombination tyrosine kinase expressed in pichia yeast organelle, gene, derivative fusion albumen and preparation method thereof - Google Patents

Abstract

The invention discloses the method for producing tyrosinase in pichia cell and restructuring tyrosinase, which has the structural formula: PTS2- tyrosinase or tyrosinase- PTS1, where PTS1 and PTS2 are framing signal. The PTS1 is amino acid sequence with S/A/C-K/H/R-L/M, the PTS2 is amino acid sequence with R/K-L/I/V-X5-H/Q-L/A, and X5 is any 5 amino acid. The invention also discloses the restructuring tyrosinase gene order and fusion protein, and preparing method. The restructuring tyrosinase has the advantages of high express, low cost, easy purifying and good activity.

Description

Recombination tyrosine kinase of in pichia yeast organelle, expressing and gene thereof, derivative fusion albumen and preparation method

Technical field

The present invention relates to genetically engineered and protein separation field, particularly a kind of recombination tyrosine kinase and gene, derivative fusion albumen and preparation method who in pichia spp (Pichiapastoris) organoid, expresses.

Background technology

Tyrosylprotein kinase (Tyrosine kinase) is a kind of enzyme that can optionally make the tyrosine residues phosphorylation of different substrates, can roughly be divided into receptor type tyrosine kinase and non-receptor type Tyrosylprotein kinase.Receptor type tyrosine kinase representative as: EGF-R ELISA (EGFR), platelet derived growth factor receptor (PDGFR), fibroblast growth factor acceptor (FGFR), human kinase insert district's acceptor (Homo sapiens kinase insert domain receptor is called for short KDR) etc.Wherein, KDR is also referred to as human vascular endothelial growth factor receptor 3 body 2 (being called for short vEGFR2), it is a kind of receptor type tyrosine kinase, its number of landing in the Genebank albumen database is: NP 002244, KDR has the vascular endothelial growth factor receptor activity, has critical function at aspects such as vascular development, blood vessel hyperplasia and adjusting vascular permeabilities.But not receptor type tyrosine kinase representative as: Src, ABL, FAK etc.

Though the tyrosine of phosphorylation only accounts for 0.5% of the interior phosphorylated amino acid of body, a series of evidences show that tyrosine phosphorylation plays an important role in many cell regulate processes.Processes such as the picked-up of the transduction of activation, reaction, mitotic division, cytodifferentiation and the formation of present T cell of these acting bodies and B cell, blood vessel hyperplasia, neurotransmitter, the growth control of cell cycle, transcriptional regulatory, glucose, the generation of tumour and apoptosis to external irritant.Therefore, the disorder of Tyrosylprotein kinase function can cause numerous disease.Under the normal circumstances, the Tyrosylprotein kinase phosphorylation of cell is to be regulated by Tyrosylprotein kinase and tyrosine phosphatase antagonism to keep equilibrated.But, as pathomechanisms such as transgenation, gene fusion, autocrine and paracrine circulations, can cause the continuous activation of Tyrosylprotein kinase, thereby block the regulatory function of its pair cell differentiation, growth and apoptosis etc., induced tumor.In view of the vital role of Tyrosylprotein kinase on tumour molecule etiology, potent tyrosine kinase inhibitor may have significance in tumor treatment.In recent years, protein tyrosine kinase is used as the target proteins of screening anti-tumor medicine widely.

The acquisition methods of Tyrosylprotein kinase is limited at present, and the cost costliness generally adopts following method:

1) separation and purification from tumour cell or tissue

(The Journal of Biological Chemistry such as Wolfgang Webe, 1984,259 (23): 14631～14636) with the method for immunoaffinity chromatography, separation and purification has obtained endothelial cell growth factor (ECGF) (EGF) acceptor from the A431 cell (people's vagina epithelium cancer cells) of great expression EGFR.But this method cost is high, output is few.

2) adopt the insect expression system to express

Greenfield etc. (The EMBO Journal, 1988,7 (1): 139～146) will the encode cDNA of EGFR is cloned into baculovirus vector pAc373, and transfection SF9 insect cell gives expression to and has active EGFR.But insect expression system is expressed shortcoming such as have the cost height, yield poorly.

3) adopt prokaryotic expression system to express

(The 2nd Army Medical College journal such as Li Lin, 2004,25 (12): 1353～1356) the cDNA fragment of EGFR-RTK is inserted the pQE30 plasmid, transfection Escherichia coli M15, IPTG abduction delivering fusion rotein, inclusion body protein affinity chromatography purifying after renaturation of expressing, ELISA method are measured albumen and are had biologic activity.Though the insect cell expression system that this method is more traditional is easy and economical, EGFR-RTK overwhelming majority in intestinal bacteria exists with the inclusion body form, and follow-up protein renaturation process recovery ratio is lower.

Summary of the invention

The topmost purpose of the present invention is to overcome the defective of prior art, and a kind of low cost, recombination tyrosine kinase that expression amount is high and preparation method thereof are provided.

For this reason, the inventor at first screens the expression system that growth and breeding is rapid, cost is low, wherein pichia spp (Pichiapastoris) is a kind of good expression system, has expression amount height, good stability, secretory volume height, can carry out advantages such as multiple translation post-treatment is modified, genetic background is clear, growth and breeding is rapid, technology is simple, production cost is low.

Yet because tyrosine kinase mediated cellular signal transduction pathways, and the multiple functions such as growth, apoptosis of regulating cell.Express recombinant protein in the general genetically engineered mycetocyte is accumulated in the tenuigenin.If directly express Tyrosylprotein kinase in pichia spp tenuigenin according to a conventional method, this kinases can influence the normal function of yeast cell, to the yeast cell toxigenicity even cause necrocytosis.So the report of successful expression Tyrosylprotein kinase in pichia spp is not arranged at present as yet.Produce to poison and avoid proteasome degradation for fear of pair cell, the inventor finds by many experimental studies, and Tyrosylprotein kinase is positioned to the organoid of pichia spp, but as expressing head it off in the peroxysome.

For being positioned in the organoid, Tyrosylprotein kinase expresses, the present invention the proteic C end of existing Tyrosylprotein kinase or N end add can make the albumen orientation be transported to the pichia yeast organelle peroxysome signal for locating (Peroxisomal Targeting Signal, PTS).Wherein, said peroxysome signal for locating PTS can be any peptide with above-mentioned functions of existing bibliographical information, the small peptide that it normally is made up of several amino acid, as the PTS1 that is added in the C end has following general structure: ser/ala/halfcystine-Methionin/Histidine/arginine-leucine/methionine(Met) (S/A/C-K/H/R-L/M) (is seen document Ann Rev Cell Biol, 1993,9:445-478); The PTS2 that is added in the N end has following general structure: arginine/Methionin-leucine/Isoleucine/Xie Ansuan-X ₅-Histidine/glutamine-leucine/L-Ala R/K-L/I/V-X ₅-H/Q-L/A (see document J Biol Chem, 1994,269:7558-7563), X ₅Represent any five amino acid.Wherein, above-mentioned symbol "/" representative " or " the meaning.

Therefore, the recombination tyrosine kinase that the present invention expresses in pichia yeast organelle, it has following general structure: the PTS2-Tyrosylprotein kinase, or Tyrosylprotein kinase-PTS1, wherein, PTS1 and PTS2 representative can make the kinase protein orientation be transported to the signal for locating of pichia spp peroxysome, and PTS 1 is the tripeptides with aminoacid sequence of following structural S/A/C-K/H/R-L/M; PTS2 has following structural R/K-L/I/V-X ₅The nonapeptide of the aminoacid sequence of-H/Q-L/A, wherein X ₅Represent any five amino acid.

The said Tyrosylprotein kinase of the present invention can be any enzyme that can make the tyrosine residues phosphorylation of different substrates, comprises receptor type tyrosine kinase EGFR, PDGFR, FGFR and KDR etc., and non-receptor type Tyrosylprotein kinase Src, ABL and FAK etc.

In the present invention's one preferable example, described Tyrosylprotein kinase is KDR (aminoacid sequence is shown in SEQ ID No.2 in the sequence table), the aminoacid sequence of described PTS1 is SKL (Serine-Methionin-leucine), the aminoacid sequence of this recombination tyrosine kinase that constitutes is the aminoacid sequence end of the KDR shown in the SEQ ID No.2 and adds SKL, specifically referring to the 261-629 amino acids sequence in the aminoacid sequence shown in the SEQ ID No.7 in the sequence table.

In another preferable example of the present invention, described Tyrosylprotein kinase is non-receptor type Tyrosylprotein kinase Src (aminoacid sequence is shown in SEQ ID No.16 in the sequence table), the aminoacid sequence of described PTS2 is RLNNLATQL (arginine-leucine-l-asparagine-l-asparagine-leucine-L-Ala-Threonine-glutamine-leucine), the aminoacid sequence of this recombination tyrosine kinase that constitutes is the aminoacid sequence front of the Src shown in the SEQ IDNo.16 and adds RLNNLATQL, specifically referring in the sequence table shown in the SEQ ID No.19 in the aminoacid sequence all or 3-547 amino acids sequence, wherein, the 1-2 position is that preferred pPIC3.5K plasmid is during as expression vector, in order to guarantee correctly to begin the translation purpose gene, and the Kozak sequence A TGGCT corresponding amino acid sequence that includes initiator codon ATG of adding.

Therefore, obviously the recombination tyrosine kinase of above-mentioned two preferable examples can also be through replacement, disappearance or the interpolation of one or more amino-acid residues and to have same enzyme active with described aminoacid sequence, by the 261-629 amino acids sequence of these sequences shown in SEQ ID No.7 in the sequence table or the 3-547 amino acids sequence deutero-protein shown in the SEQ IDNo.19, such as adding one or several amino acid, merge, do not influence the situations such as difference on the modified forms of sequence as amino acid with vector encoded at C-terminal and/or N-terminal.

Another object of the present invention provides the cDNA of above-mentioned recombination tyrosine kinase of expressing in pichia yeast organelle.

Obviously, this cDNA is that any nucleotide sequence by a kind of Tyrosylprotein kinase of encoding adds that the nucleotide sequence of the above-mentioned peroxysome signal for locating PTS of coding constitutes.

The nucleotide sequence of a kind of Tyrosylprotein kinase KDR of disclosed coding is shown in SEQ IDNo.1 in the sequence table.Yet, described Tyrosylprotein kinase behaviour source, and pichia spp translation system and zooblast translation system exist difference, the frequency of utilization difference of its amino acid code.When the Pichia anomala expression exogenous protein, if the distribution condition of codon is similar to pichia spp among the mRNA of transcription of foreign genes, then cell can normally carry out protein translation, and wrong frequency appears in albumen in translation process less.If instead mRNA has more rare codon, the tRNA amount of identification rare codon can not satisfy the needs in the translation process in the pichia spp, can make foreign protein occur degradation obstacle under phase shift mutation, the translation skill on the translation skill, thereby influence expression of gene.Therefore for improving expression level, more preferably, preferred pin of the present invention is to the proteic gene order of the Tyrosylprotein kinase of pichia spp codon-bias, the nucleotide sequence shown in SEQ ID No.3 in the sequence table.

When being SKL with the aminoacid sequence of peroxysome signal for locating PTS1 is example, the base sequence of coding SKL is TCCAAGTTG, so above-mentioned recombination tyrosine kinase one preferable example---the cDNA of reorganization KDR can be that the nucleotide sequence end shown in the SEQ ID No.1 adds TCCAAGTTG, is the nucleotide sequence shown in the SEQ ID No.5 in the sequence table; Or the nucleotide sequence end shown in the SEQ ID No.3 adds TCCAAGTTG, is the nucleotide sequence shown in the SEQ ID No.4 in the sequence table; The end that also can be other any pairing base sequence of can coding being made up of the aminoacid sequence shown in the SEQ ID No.2 in the sequence table of protein adds TCCAAGTTG.

Disclosed coding in addition-nucleotide sequence (the GeneBank number of landing is NM 005417) shown in SEQ ID No.15 of kind of Tyrosylprotein kinase Src.

When being RLNNLATQL with the aminoacid sequence of peroxysome signal for locating PTS2 is example, the base sequence of coding RLNNLATQL is AGATTGAACAACTTGGCTACTCAATTG, so above-mentioned another preferable example---the cDNA of reorganization Src can be that the nucleotide sequence front end shown in the SEQ ID No.15 adds AGATTGAACAACTTGGCTACTCAATTG, be the 7-1641 position nucleotide sequence in the nucleotide sequence shown in the SEQ ID No.17, when the 1-6 bit base is to use the pPIC3.5K plasmid as expression vector in the nucleotide sequence shown in the SEQ ID No.17, for guaranteeing correctly to begin the Kozak sequence A TGGCT that includes initiator codon ATG that the translation purpose gene adds; The recombinate cDNA of Src of the present invention also can be that the front end of other any pairing base sequence of can coding being made up of the aminoacid sequence shown in the SEQ ID No.16 in the sequence table of protein adds AGATTGAACAACTTGGCTACTCAATTG.

More preferably, the present invention is with Tyrosylprotein kinase and labelled protein amalgamation and expression, the technical superiority of doing like this is and can be convenient to monitor in real time the activity and the output of Tyrosylprotein kinase in bacterial screening, fermentation and purge process by the mensuration of labelled protein being come the kinase whose expression amount of indirect detection.

Therefore, a further object of the present invention provides a kind of derivative fusion albumen of above-mentioned recombination tyrosine kinase, and it is the fusion rotein of labelled protein and Tyrosylprotein kinase.

The preferred labelled protein of the present invention is a fluorescin.Because no matter fluorescin expresses, when exciting, can both produce a kind of very bright fluorescence (physiological science progress, 2002,33:(4), 364～366) with certain wavelength in protokaryon or eukaryotic cell.In addition, fluorescin also has hypotoxicity, does not disturb advantages such as normal cellular activity.

With Tyrosylprotein kinase and fluorescin amalgamation and expression, can come the kinase whose expression amount of indirect detection by rapid detection fluorescence intensities such as fluorescent microscope, fluorescence microplate reader or flow cytometers, and can in bacterial screening, fermentation and purge process, detect the activity and the output of monitoring Tyrosylprotein kinase in real time by fluorescence intensity.

Those skilled in the art knows, and fluorescin comprises green, yellow, red fluorescent protein etc., and the fluorescin of these different colours all can be used for the present invention.

For the ease of from the fusion rotein of purifying, obtaining the recombination tyrosine kinase monomer, the present invention has introduced zymoplasm (thrombin) restriction enzyme site (aminoacid sequence LVPRGS) between fluorescin and Tyrosylprotein kinase, can cut with zymoplasm enzyme from fusion rotein like this and obtain Tyrosylprotein kinase.

Those skilled in the art knows, for the ease of from the fusion rotein of purifying, obtaining the recombination tyrosine kinase monomer, except between fluorescin and Tyrosylprotein kinase, having introduced the zymoplasm restriction enzyme site, other restriction enzyme sites also have enteropeptidase site (aminoacid sequence DDDDK), Xa factor site (aminoacid sequence IEGR), HRV 3C sites (aminoacid sequence LEVLFQGP) etc., these restriction enzyme sites all can be used for the present invention.

In a preferred embodiment of the present invention, the labelled protein that contains in the described derivative fusion albumen is selected green fluorescent protein (GFP) for use, GFP is a polypeptide chain of being made up of 238 amino acid (its aminoacid sequence is shown in SEQ ID No.10 in the sequence table, and nucleotide sequence is shown in SEQ ID No.9) that derives from jellyfish (Aequorea victoria); Described restriction enzyme site is selected the zymoplasm restriction enzyme site for use; This derivative fusion albumen has the 15-629 amino acids sequence shown in the SEQ ID No.7 in the sequence table, wherein the 15th～252 is the aminoacid sequence of GFP, the 253-254 position is nuclease EcoRI site, the 255-260 position is the aminoacid sequence of zymoplasm restriction enzyme site, and the 261-629 position is the aminoacid sequence of recombination tyrosine kinase KDR; The encode 43-1887 position nucleotide sequence of cDNA nucleotide sequence shown in SEQ ID No.6 in the sequence table of this derivative fusion albumen.

More preferably, in order to simplify purifying process, reduce production costs, the present invention has added purifying labelled protein or the peptide of being convenient to affinity purification at the N of fluorescin and tyrosine-kinase enzyme fusion proteins end, as poly Histidine (His-tag) sequence (6-10 Histidine), can pass through nickel ion affinity chromatograph or other method purifying kinases like this.Certainly, except poly Histidine sequence, other existing purifying labelled protein or peptides of being convenient to purifying all can be used for the present invention, and for example GST Tag, S Tag, T7Tag, CBD Tag etc. (see pET system manual, www.novagen.com).

The above-mentioned derivative fusion albumen of poly Histidine sequence that comprises has the whole or 3-629 amino acids sequence shown in the SEQ ID No.7 in the sequence table, wherein, the 1-2 position is 2 amino acid that include the Kozak sequence A TGGCT coding of initiator codon ATG, and the 3-12 position is His-tag (10 Histidines is formed); Encode the cDNA nucleotide sequence of this derivative fusion albumen shown in the whole or 7-1887 bit base sequence of SEQ IDNo.6 in the sequence table, and correspondingly, the 1-6 position among the SEQ ID No.6 is the Kozak sequence A TGGCT that includes initiator codon ATG.

The present invention's said " Kozak sequence " is meant when using the pPIC3.5K plasmid as expression vector, in order to guarantee correctly to begin the translation purpose gene, usually need add one section Kozak sequence (Multi-Copy Pichia Expression Kit that includes ATG at the goal gene front end, Version E, Invitrogen).Wherein ATG is equivalent to the initiator codon of goal gene subsequently, and three Nucleotide of ATG back can be any three Nucleotide of G beginning.The ATGGCT that adds in two preferred embodiments of the present invention is one section suitable Kozak sequence, knows as known to persons skilled in the art certainly, and three Nucleotide of ATG back can be not limited only to GCT.

Certainly, the present invention also can be with Tyrosylprotein kinase list and above-mentioned purifying labelled protein or peptide amalgamation and expression.In of the present invention one preferable example, (its aminoacid sequence is shown in SEQ ID No.21 in the sequence table as the purifying mark to adopt GST-tag, nucleotide sequence is shown in SEQ ID No.20), and between Tyrosylprotein kinase Src and purifying mark, introduced enteropeptidase (EK) restriction enzyme site (aminoacid sequence DDDDK), can cut with enteropeptidase enzyme from fusion rotein like this and obtain Tyrosylprotein kinase.Derivative fusion albumen in this example has the whole or 3-777 amino acids sequence shown in the SEQ ID No.19 in the sequence table, wherein, 1-547 or 3-547 position are the aminoacid sequence of recombination tyrosine kinase Src, the 548-552 position is the aminoacid sequence of EK restriction enzyme site, the 553-554 position is the EcoRI site, and the 555-777 position is GST-tag; Encode the cDNA nucleotide sequence of this derivative fusion albumen shown in the whole or 7-2331 bit base sequence of SEQ ID No.18 in the sequence table.

A further object of the present invention provides a kind of recombinant expression vector that contains the above-mentioned purpose protein gene sequence.

This recombinant expression vector can comprise one of following nucleotide sequences:

1) above-mentioned recombination tyrosine kinase, as the cDNA nucleotide sequence of the KDR that recombinates, for example pairing base sequence of protein that the base sequence shown in SEQ ID No.4, the SEQ ID No.5 and other codings are made up of 261-629 amino acids in the aminoacid sequence shown in the sequence table SEQ ID No.7 in the sequence table; Or the cDNA nucleotide sequence of reorganization Src, for example whole the or 7-1641 bit base sequence shown in the SEQ ID No.17 and other are encoded by the pairing base sequence of protein whole or that the 3-547 amino acids is formed shown in the sequence table SEQ ID No.19 in the sequence table;

2) the cDNA nucleotide sequence of the fusion rotein of above-mentioned fluorescin and Tyrosylprotein kinase (as GFP-KDR), the 43-1887 bit base sequence shown in SEQ ID No.6 in the sequence table;

3) the above-mentioned cDNA nucleotide sequence that contains the derivative fusion albumen of poly Histidine, the whole or 7-1887 bit base sequence shown in SEQ ID No.6 in the sequence table; Or contain the cDNA nucleotide sequence of the derivative fusion albumen of GST-tag, the whole or 7-2331 bit base sequence shown in SEQ ID No.18 in the sequence table.

Those skilled in the art know, and recombinant expression vector can be any carrier that can carry out the recombinant DNA operation easily and can cause the target protein sequence to be expressed.The selection of carrier is generally depended on carrier and is waited to introduce consistency between the host cell of carrier.Carrier can be the self-replicating carrier, and promptly as the carrier of the outer entity existence of a kind of karyomit(e), it duplicates and does not rely on THE REPLICATION OF CHROMOSOME.Carrier can contain any element of guaranteed self-replicating.In addition, carrier also can be a kind of like this carrier, after introducing host cell, can be incorporated in the genome and with the karyomit(e) of being integrated and duplicate.

Expression vector of the present invention preferably contains one or more makes transformant can obtain the selected marker of convenient screening.Selected marker is a kind of gene, and its product provides antibiotics resistance, biocide or virus resistance, heavy metal resistance etc.As provide the mark of penbritin, kantlex, paraxin or the tetracyclin resistance of antibiotics resistance.Target protein to be expressed and selected expression host cell are depended in the selection of suitable expression.Expression host cell of the present invention is a pichia spp, so the expression vector of selecting for use is the existing any carrier that is applicable to pichia spp, includes but not limited to pPIC derive plasmid pPIC3.5K, pPIC9K or their derivative.

Another purpose of the present invention provides the host cell that contains goal gene of the present invention and recombinant expression vector, and it is used for the recombinant production of target Tyrosylprotein kinase.The recombinant expression vector that will contain goal gene of the present invention is introduced in the host cell, and carrier is remained in wherein as the chromosomal integration body.Term " host cell " also comprises any filial generation of the parental cell different with parental cell owing to undergo mutation between replicative phase.

Used host cell is the eukaryotic expression host among the present invention---pichia spp cell, described pichia spp include but not limited to existing GS115, KM71 bacterial strain etc.

Another object of the present invention provides the preparation method of above-mentioned recombination tyrosine kinase.

Preparation method's of the present invention key is Tyrosylprotein kinase is positioned in the pichia yeast organelle peroxysome and expresses, it is included in to connect on any gene order of coding Tyrosylprotein kinase and makes the albumen orientation be transported to the gene order of the signal for locating PTS (as PTS1 or PTS2) of pichia yeast organelle peroxysome, thereby be formed in the cDNA nucleotide sequence of the recombination tyrosine kinase of expressing in the pichia yeast organelle, then preparation contains the recombinant expression vector of this cDNA nucleotide sequence, with described recombinant expression vector transformed eukaryotic nuclear expression host pichia spp, cultivate transformant, with the step of culture separation and purification.

Described expression vector such as the above-mentioned pPIC plasmid of deriving, the eukaryotic expression host is pichia spp GS 115, KM71 bacterial strain etc.Preparation recombinant expression vector and transformant can adopt existing genetic engineering technique.As prepare above-mentionedly contain the poly Histidine, when expressing the recombinant vectors of GFP-KDR derivative fusion albumen (His-GFP-KDR), can introduce EcoRI and NotI restriction enzyme site at the two ends of KDR gene respectively, PstI and EcoRI restriction enzyme site are introduced in GFP gene two ends, and XbaI-SnaBI and PstI restriction enzyme site are introduced in His-tag gene two ends; Respectively His-tag is linked to each other with the PstI restriction enzyme site with GFP, equal pPIC3.5K after the EcoRI/NotI enzyme is cut processing is connected with KDR, again with above-mentioned both cut through the SnaBI/EcoRI enzyme and handle back connections, obtain final expression vector pPIC3.5K-plus.And for example prepare the above-mentioned GST-tag of containing, when expressing the recombinant expression vector of Src derivative fusion albumen (GST-Src), can introduce SnaBI and EcoRI restriction enzyme site at the two ends of Src gene respectively, EcoRI and AvrII restriction enzyme site are introduced in GST-tag gene two ends; With equal pPIC3.5K after the SnaBI/EcoRI enzyme is cut processing be connected with Src plasmid Src-pPIC3.5K, all the Src-pPIC3.5K after the EcoRI/AvrII enzyme is cut processing is connected with GST-tag again, obtains final expression vector Src-GST-pPIC3.5K.And the method for introducing recombinant expression vector in the pichia spp cell can be protoplast transformation, electroporation, PEG method and LiCl method etc.Cultivate transformant and the method for culture separation and purification also all can be adopted prior art (" the molecular cloning experiment guide " compiled referring to the female Brooker of J. Sa etc.).

Effect of the present invention is: the present invention is positioned at Tyrosylprotein kinase in the organoid of this pichia spp of peroxysome, has reduced the murder by poisoning of kinases to host's Pichi strain, has realized the great expression preparation of Tyrosylprotein kinase in yeast first.The present invention also by optimizing the codon of Tyrosylprotein kinase cDNA, makes it be adapted at expressing in the pichia spp.Simultaneously with tyrosine kinase gene and fluorescin amalgamation and expression, so that kinase whose monitoring.Last the present invention has added the aminoacid sequence of being convenient to affinity purification at the N of fusion rotein end or C end, can simplify purifying process, reduces the cost of purifying.The Tyrosylprotein kinase of Pichia anomala expression can not form inclusion body simultaneously, has better advantage than escherichia coli expression.By above The Application of Technology, the present invention has realized low-cost in pichia spp, a large amount of preparation of the Tyrosylprotein kinase of high biological activity.

Description of drawings

Fig. 1 for existing Tyrosylprotein kinase KDR gene order (up), the present invention is directed to the KDR gene order (middle row, wherein identical with protogene sequence base is unlisted) that the pichia spp codon-bias optimizes and the KDR aminoacid sequence (descending) of their codings.

Fig. 2 is that the recombinant expression vector that has His-tag, GFP and KDR gene makes up synoptic diagram.

Fig. 3 is pcr amplification GFP and KDR collection of illustrative plates, and wherein control is contrast.

Fig. 4 is the collection of illustrative plates of PCR checking recombinant expression vector plasmid pPIC3.5K-plus.

Fig. 5 is Ni post affinity purification derivative fusion albumen His-GFP-KDR result of the present invention.

Fig. 6 is that the recombinant expression vector that has Src and GST-tag gene makes up synoptic diagram.

Fig. 7 is GST-Agarose affinity column affinity purification derivative fusion albumen GST-Src result of the present invention.

Embodiment

Further specify the present invention with embodiment below, but the present invention is not limited.

Materials and methods in the following example is:

The molecule clone technology that is adopted is referring to " the molecular cloning experiment guide " of volumes such as the female Brooker of J. Sa.

All available from TaKaRa biotech firm (Dalian, China), the concrete reaction conditions and the method for use are all with reference to catalogue for employed toolenzyme.

Following commercialization plasmid and e. coli strains are used for gene clone:

PBlueScript (+) and pUC19 are available from TIANGEN Biotech (Beijing) Co., Ltd.;

PDEST15 is available from Invitrogen company;

PPIC3.5K, intestinal bacteria Top10, pichia spp GS115, KM71 bacterial strain are available from Invitrogen.

λ-DNA HindIII Marker (Takala, the precious biotech firm in Dalian),

Ni affinity column (Ni Sepharose 6Fast Flow, GE company),

GST-Agarose affinity column (Amersham Pharmacia Biotech company).

Preparation and the activity test of embodiment 1 recombination tyrosine kinase KDR

Embodiment 1.1 has the preparation of the recombinant plasmid of His-tag sequence

The His-tag gene order is seen sequence table SEQ ID NO:8 by 63 based compositions, and this sequence is by commercialization synthetic [Sangon Biotech (Shanghai) Co., Ltd.].The Kozak sequence A TGGCT (5 ' end i9-24 bit base) that 5 ' end of this sequence contains XbaI-SnaBI restriction enzyme site (5 ' end 4-15 bit base) and includes initiator codon, 3 ' end contains PstI restriction enzyme site (3 ' end 4-9 bit base).

This sequence is cut through restriction enzyme XbaI and PstI enzyme, connect with the T4 ligase enzyme, be cloned into XbaI and the PstI site of the commercial pBlueScript (+) that cuts through XbaI and PstI enzyme, obtain to have the recombinant plasmid His-pBlueScript (+) of His-tag sequence.

Embodiment 1.2 has the preparation of the recombinant plasmid of His-tag sequence and green fluorescent protein GFP gene order

The GFP gene order is made up of 717 bases (sequence table SEQ ID NO:9), and PCR primer P 1 and P2 have been synthesized in design, and wherein P1 has introduced DNA restriction enzyme site PstI, and P2 has introduced DNA restriction enzyme site EcoRI.

P 1.5’-AAA CTGCAGATGTCTAAAGGTGAAGAATTATTC-3’

PstI (SEQ ID NO：11)

P2：5’-CCG GAATTCTTTGTACAATTCATCCATAC-3’

EcoRI (SEQ ID NO：12)

Utilize above-mentioned primer to P1 and P2, with the pUC19 recombinant plasmid that contains this GFP gene is that template is (with reference to Microbiology, 1997,143:303-311), obtain the dna fragmentation of a 732bp by following PCR reaction amplification: carry out the PCR reaction with cumulative volume 50ul, 95 ℃ of sex change 7 minutes, by 94 ℃ of sex change 1 minute, annealed 1 minute for 46 ℃, 72 ℃ are extended 1.5 minutes circulating reactions 5 times, and then 94 ℃ of sex change 1 minute, 52 ℃ of annealing 1 minute, 72 ℃ are extended 1.5 minutes circulating reactions 25 times, at last again 72 ℃ extended 10 minutes.Agarose gel electrophoresis reclaims gained PCR fragment reaction (seeing shown in Figure 3), cut through restriction enzyme PstI and EcoRI enzyme, connect with the T4 ligase enzyme, be cloned into PstI and the EcoRI site of the His-pBlueScript (+) of the embodiment 1.1 that cuts through PstI and EcoRI enzyme, obtain to have the recombinant plasmid His-GFP-pBlueScript (+) of His-tag sequence and GFP sequence.

The introducing of the optimization preparation of embodiment 1.3KDR gene order and the signal for locating of peroxysome

The KDR gene order is not being changed under the amino acid whose prerequisite by 1098 based compositions, and the codon of KDR gene is optimized.The KDR aminoacid sequence is shown in SEQ ID NO:2; The sequence of former nucleotide sequence shown in SEQ ID NO:1, after optimizing is shown in SEQ ID NO:3, and two groups of nucleotide sequences contrasts are referring to Fig. 1.Sequence after the optimization is complete synthesis by company [Sangon Biotech (Shanghai) Co., Ltd.] commercialization, and is cloned on commercial pBlueScript (+) carrier.

With the KDR gene of optimizing on pBlueScript (+) carrier is template, PCR primer P3 and P4 have been synthesized in design, wherein P3 has introduced DNA restriction enzyme site EcoRI and zymoplasm restriction enzyme site (two wavy lines has been represented, corresponding amino acid sequence is LVPRGS), P4 has introduced the signal for locating SKL (double underline mark) of DNA restriction enzyme site AvrII-NotI and peroxysome.

P3：

5’-CCG GAATTCCTGGTCCCCAGAGGCTCTATGGACCCTGATGAGTTG-3’

EcoRI (SEQ ID NO：13)

P4：

5’-CATTA GCGGCCGCCCTAGGCTACTA

GTCCTGCTGAGCG

TT-3’ AvrII-NotI (SEQ ID NO：14)

Utilize above-mentioned primer to P3 and P4, with pBlueScript (+) carrier that contains this KDR gene is template, obtain the dna fragmentation of a 1159bp by following PCR reaction amplification: carry out the PCR reaction with cumulative volume 50ul, 95 ℃ of sex change 7 minutes, by 94 ℃ of sex change 1 minute, 60 ℃ of annealing 1 minute, 72 ℃ are extended 1.5 minutes circulating reactions 30 times, at last again 72 ℃ extended 10 minutes.Agarose gel electrophoresis reclaims gained PCR fragment reaction (see figure 3).

Embodiment 1.4 has the construction of recombinant plasmid of KDR sequence

Embodiment 1.3 gained PCR fragment reactions are cut through restriction enzyme EcoRI and NotI enzyme, connect with the T4 ligase enzyme, be cloned into EcoRI and the NotI site of the commercial pPIC3.5K that cuts through EcoRI and NotI enzyme, obtain to have the recombinant plasmid KDR-pPIC3.5K of KDR sequence.

Embodiment 1.5 contains the structure of His-tag fragment and the segmental expression vector of GFP-KDR

Cut the recombinant plasmid His-GFP-pBlueScript (+) of gained among the embodiment 1.2 with restriction enzyme XbaI and EcoRI enzyme, and agarose gel electrophoresis reclaims the His-GFP fragment, connect with the T4 ligase enzyme, be cloned into XbaI and the EcoRI site of the KDR-pPIC3.5K of embodiment 1.4 gained of cutting through XbaI and EcoRI enzyme, obtain final purpose expression vector pPIC3.5K-plus (as Fig. 2).Screen recon behind the transformed into escherichia coli Top10, P1 and P4 are carried out PCR, identify and insert segmental size and Orientation in the recombinant plasmid with primer.The PCR checking size of positive colony should be about 2kb, obtain 6 positive colonies (seeing 3-4,6-9 swimming lane among Fig. 4), get No. 8 bacterium and measure this fragment sequence through dna sequencing instrument (instrument model 3730), its nucleotide sequence is shown in SEQ ID NO:6, aminoacid sequence shows that extension increasing sequence conforms to fully with the set objective sequence shown in SEQ ID NO:7.Wherein, remove the 43-1887 position of cDNA nucleotide sequence sequence shown in SEQ ID NO:6 of the GFP-KDR fusion rotein (containing the zymoplasm restriction enzyme site) behind the His-tag, the 15-629 position of aminoacid sequence sequence shown in SEQID NO:7; And the cDNA nucleotide sequence of recombination tyrosine kinase KDR of the present invention of removing GFP and zymoplasm restriction enzyme site is shown in SEQ ID NO:4, be the 781-1887 position of sequence shown in the SEQ IDNO:6, the 261-629 position of aminoacid sequence sequence shown in SEQ ID NO:7.

Embodiment 1.6 contains the structure of the recombinant host bacterium of KDR sequence

With the recombinant plasmid pPIC3.5K-plus linearizing of restriction enzyme SacI with gained among the embodiment 1.5, electricity is transformed into pichia spp host bacterium GS115 competent cell, with histidine defect type MGY flat board (Invitrogen company) screening positive clone, positive colony is changeed the G418 flat board that is coated with different concns, concentration is respectively 1,2,3,4mg/ml, the high copy of screening recombinant bacterial strain.The bacterial strain that grows on the flat board is shaken bottle expresses, every sampling in 24 hours, with the flow cytometer fluorescence intensity to judge the expression of each bacterial strain, the result shows that the fluorescence intensity geometrical mean is 1618.31 to No. 1 bacterium (called after Pichia KDR No.1) in the time of 24 hours, is that expression amount is the highest in each bacterial strain.

The fermentation culture of the genetic engineering bacterium of embodiment 1.7 generation GFP-KDR and the separation and purification of GFP-KDR

1. the fermentation culture of genetic engineering bacterium (pichia spp)

With the genetic engineering bacterium Pichia KDR No.1 inoculation of gained among the embodiment 1.6 in the BSM substratum (with reference to Sreekrishna K, Kropp KE (1996) Pichia pastoris.In:Wolf K, eds., Non-Conventional Yeast in Biotechnology:AHandbook.Berlin:Springer-Verlag, pp.203-253), 28 ℃ of shaking culture 30 hours, be inoculated in the fresh substratum of the same race with 10% inoculum size again, continue to cultivate about 60 hours in 28 ℃.

2.GFP-KDR separation, purifying

By in the above-mentioned condition culturing engineering bacterium process, every 6 hours sampling flow cytometer fluorescence intensity.When descending appears in fluorescence intensity, stop fermentation culture.After measured, the maximum expression amount of tyrosine-kinase enzyme fusion proteins is 260mg/L.

With centrifugal 30 minutes of fermented liquid 3000g, abandon supernatant and keep thalline.Use the granulated glass sphere broken wall, Ni affinity chromatography column separating purification carries out wash-out with 50mM phosphate solution (containing the 250mM imidazoles).Elution curve is seen Fig. 5.Sample is to the Ni post on the sample, with the balance that contains the 20mM imidazoles, uses 250mM imidazoles wash-out more earlier, and 250mM imidazoles elution peak is the target protein peak, then do not have albumen to wash with the imidazoles wash-out of 1M more afterwards.

The GFP-KDR kinases of purifying is measured activity with Tyrosylprotein kinase assay kit (NO.PTK101, Sigma company), and the result is as follows:

Sample	Negative control	Positive control	Purification of samples of the present invention
				Enzyme is lived	0.117	1.093	2.032

The positive wherein and negative control are test kit and provide.Tyrosylprotein kinase KDR behind the above presentation of results purifying has high activity.

In order further to estimate the biological activity of the reorganization KDR of purifying, adopt commercial KDR specific inhibitor to carry out KDR and suppress experiment.The result shows that the concentration as inhibitor PTK789, SU11248, SU5416 is 10 ^-5During mol/L, the three is respectively 78.6%, 60.4%, 77.2% to the inhibiting rate of KDR, all is higher than 50%, and this recombination tyrosine kinase KDR that further specifies purifying of the present invention has good biological activity.

Preparation and the determination of activity of embodiment 2 recombination tyrosine kinase Src

The introducing of the preparation of embodiment 2.1Src gene order and the signal for locating of peroxysome

The Src gene order is made up of 1608 bases (sequence table SEQ ID NO:15), PCR primer P5 and P6 have been synthesized in design, wherein P5 has introduced the signal for locating RLNNLATQL (double underline mark) of DNA restriction enzyme site SnaBI and peroxysome, introduce the Kozak sequence A TGGCT that includes initiator codon between SnaBI restriction enzyme site and the signal for locating, DNA restriction enzyme site EcoRI and enteropeptidase restriction enzyme site (two wavy lines represent that corresponding amino acid sequence is DDDDK) have been introduced at P6.

P5：5’-CTG TACGTAATGGCT

SnaBI

ATGGGTAGCAACAAGAGC-3’ (SEQ ID NO：22)

P6：5’-CGA GAATTCCTTGTCGTCGTCATCGAGGTTCTCCCCGGGCT

GGTA-3’ EcoRI (SEQ ID NO：23)

Utilize above-mentioned primer to P5 and P6, to contain the plasmid pBA3CS (BMCBiochemistry of this Src gene, 2002,3:32) be template, obtain the dna fragmentation of a 1674bp by following PCR reaction amplification: carry out the PCR reaction with cumulative volume 50ul, 95 ℃ of sex change 7 minutes, by 94 ℃ of sex change 1 minute, 65 ℃ of annealing 1 minute, 72 ℃ are extended 2 minutes circulating reactions 30 times, at last again 72 ℃ extended 10 minutes.Agarose gel electrophoresis reclaims gained PCR fragment reaction.

Embodiment 2.2 has the preparation of the recombinant plasmid of GST-tag sequence

The GST-tag gene order is by 669 based compositions, see sequence table SEQ ID NO:20, PCR primer P7 and P8 have been synthesized in design, obtain the GST-tag gene order from commercialization plasmid pDEST15 (Invitrogen company) amplification, wherein P7 has introduced DNA restriction enzyme site EcoRI, and P8 has introduced DNA restriction enzyme site AvrII.

P7：5’-CCG GAATTCTCCCCTATACTAGGTTATTGG-3’

EcoRI (SEQ ID NO：24)

P8：5’-CAA CCTAGGCTACTAACGCGGAACCAGATCCGATTT-3’

AvrII (SEQ ID NO：25)

Utilize above-mentioned primer to P7 and P8, with the pDEST15 carrier that contains this GST-tag gene is template, obtain the dna fragmentation of a 693bp by following PCR reaction amplification: carry out the PCR reaction with cumulative volume 50ul, 95 ℃ of sex change 7 minutes, by 94 ℃ of sex change 1 minute, 54 ℃ of annealing 1 minute, 72 ℃ are extended 1 minute circulating reaction 30 times, at last again 72 ℃ extended 10 minutes.Agarose gel electrophoresis reclaims gained PCR fragment reaction, cut through restriction enzyme EcoRI and AvrII enzyme, connect with the T4 ligase enzyme, be cloned into EcoRI and the AvrII site of the commercial pPIC3.5K that cuts through EcoRI and AvrII enzyme, obtain to have the recombinant plasmid GST-pPIC3.5K of GST-tag sequence.

Embodiment 2.3 contains the structure of GST-tag fragment and the segmental expression vector of Src

Embodiment 2.1 gained PCR fragment reactions are cut through restriction enzyme SnaBI and EcoRI enzyme, connect with the T4 ligase enzyme, be cloned into SnaBI and the EcoRI site of the GST-pPIC3.5K of the embodiment 2.2 that cuts through SnaBI and EcoRI enzyme, obtain to have the final purpose expression vector Src-GST-pPIC3.5K of Src sequence.Screen recon behind the transformed into escherichia coli Top10, P5 and P8 are carried out PCR, identify and insert segmental size and Orientation in the recombinant plasmid with primer.The PCR checking size of positive colony should be 2355bp, obtain 8 positive colonies, get No. 1 bacterium and measure this fragment sequence through dna sequencing instrument (instrument model 3730), its 10-2346 position nucleotide sequence is shown in SEQ ID NO:18, aminoacid sequence shows that extension increasing sequence conforms to fully with the set objective sequence shown in SEQ ID NO:19.Wherein, remove the 1-1641 position (the 1-6 position is to comprise the Kozak sequence that starts codon) of the monomeric cDNA nucleotide sequence of the Src recombinant protein sequence shown in SEQ ID NO:18 behind GST-tag and the enteropeptidase restriction enzyme site, the 1-547 position of aminoacid sequence sequence shown in SEQ ID NO:19 (correspondingly the 1-2 position is two amino acid of Kozak sequence encoding).

Embodiment 2.4 contains the structure of the recombinant host bacterium of Src sequence

With the recombinant plasmid Src-GST-pPIC3.5K linearizing of restriction enzyme SacI with gained among the embodiment 2.3, electricity is transformed into pichia spp host bacterium KM71 competent cell, with histidine defect type MGY flat board (Invitrogen company) screening positive clone, positive colony is changeed the G418 flat board that is coated with different concns, concentration is respectively 1,2,3,4mg/ml, the high copy of screening recombinant bacterial strain.The bacterial strain that grows on the flat board is shaken bottle expresses, every sampling in 24 hours, after the granulated glass sphere broken wall, with Tyrosylprotein kinase assay kit (NO.PTK101, Sigma company) measure activity to judge the expression of each bacterial strain, the result shows that No. 5 bacterium (called after Pichia Src No.5) enzyme work in the time of 24 hours is the highest in each bacterial strain.

The fermentation culture of the genetic engineering bacterium of embodiment 2.5 generation Src and the separation and purification of Src

1. the fermentation culture of genetic engineering bacterium (pichia spp)

Genetic engineering bacterium Pichia Src No.5 inoculation (method reference example 1.7) in the BSM substratum with gained among the embodiment 2.4,28 ℃ of shaking culture 30 hours, be inoculated in the fresh substratum of the same race with 10% inoculum size again, continue to cultivate about 60 hours in 28 ℃.

2.Src separation, purifying

By in the above-mentioned condition culturing engineering bacterium process, measure active with Tyrosylprotein kinase assay kit (NO.PTK101, Sigma company) every sampling in 6 hours.When descending appears in activity, stop fermentation culture.

With centrifugal 30 minutes of fermented liquid 3000g, abandon supernatant and keep thalline.Use the granulated glass sphere broken wall, GST-Agarose affinity column (Amersham Pharmacia Biotech) separation and purification (contains 50mmol/L Tris with the 50mM phosphate solution, 0.15mol/L NaCl, 2.5mmol/L CaCl2 pH7.5) carries out wash-out, collects target protein.Elution curve is seen Fig. 7.

The Src kinases of purifying is measured activity with Tyrosylprotein kinase assay kit (NO.PTK101, Sigma company), and the result is as follows:

Sample	Negative control	Positive control	Purification of samples of the present invention
				Enzyme is lived	0.103	1.032	1.857

The positive wherein and negative control are test kit and provide.Tyrosylprotein kinase Src behind the above presentation of results purifying has high activity.

Sequence table

＜110〉East China University of Science; Shanghai Pharmaceutical Inst., Chinese Academy of Sciences

Recombination tyrosine kinase of＜120〉in pichia yeast organelle, expressing and gene thereof, derivative fusion albumen and preparation

Method

<130>061709C

<160>25

<170>PatentIn version 3.3

<210>1

<211>1098

<212>DNA

＜213〉people (human)

<220>

<221>CDS

<222>(1)..(1098)

<400>1

atg gat cca gat gaa ctc cca ttg gat gaa cat tgt gaa cga ctg cct 48

Met Asp Pro Asp Glu Leu Pro Leu Asp Glu His Cys Glu Arg Leu Pro

1 5 10 15

tat gat gcc agc aaa tgg gaa ttc ccc aga gac cgg ctg aag cta ggt 96

Tyr Asp Ala Ser Lys Trp Glu Phe Pro Arg Asp Arg Leu Lys Leu Gly

20 25 30

aag cct ctt ggc cgt ggt gcc ttt ggc caa gtg att gaa gca gat gcc 144

Lys Pro Leu Gly Arg Gly Ala Phe Gly Gln Val Ile Glu Ala Asp Ala

35 40 45

ttt gga att gac aag aca gca act tgc agg aca gta gca gtc aaa atg 192

Phe Gly Ile Asp Lys Thr Ala Thr Cys Arg Thr Val Ala Val Lys Met

50 55 60

ttg aaa gaa gga gca aca cac agt gag cat cga gct ctc atg tct gaa 240

Leu Lys Glu Gly Ala Thr His Ser Glu His Arg Ala Leu Met Ser Glu

65 70 75 80

ctc aag atc ctc att cat att ggt cac cat ctc aat gtg gtc aac ctt 288

Leu Lys Ile Leu Ile His Ile Gly His His Leu Asn Val Val Asn Leu

85 90 95

cta ggt gcc tgt acc aag cca gga ggg cca ctc atg gtg att gtg gaa 336

Leu Gly Ala Cys Thr Lys Pro Gly Gly Pro Leu Met Val Ile Val Glu

100 105 110

ttc tgc aaa ttt gga aac ctg tcc act tac ctg agg agc aag aga aat 384

Phe Cys Lys Phe Gly Asn Leu Ser Thr Tyr Leu Arg Ser Lys Arg Asn

115 120 125

gaa ttt gtc ccc tac aag acc aaa ggg gca cga ttc cgt caa ggg aaa 432

Glu Phe Val Pro Tyr Lys Thr Lys Gly Ala Arg Phe Arg Gln Gly Lys

130 135 140

gac tac gtt gga gca atc cct gtg gat ctg aaa cgg cgc ttg gac agc 480

Asp Tyr Val Gly Ala Ile Pro Val Asp Leu Lys Arg Arg Leu Asp Ser

145 150 155 160

atc acc agt agc cag agc tca gcc agc tct gga ttt gtg gag gag aag 528

Ile Thr Ser Ser Gln Ser Ser Ala Ser Ser Gly Phe Val Glu Glu Lys

165 170 175

tcc ctc agt gat gta gaa gaa gag gaa gct cct gaa gat ctg tat aag 576

Ser Leu Ser Asp Val Glu Glu Glu Glu Ala Pro Glu Asp Leu Tyr Lys

180 185 190

gac ttc ctg acc ttg gag cat ctc atc tgt tac agc ttc caa gtg gct 624

Asp Phe Leu Thr Leu Glu His Leu Ile Cys Tyr Ser Phe Gln Val Ala

195 200 205

aag ggc atg gag ttc ttg gca tcg cga aag tgt atc cac agg gac ctg 672

Lys Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His Arg Asp Leu

210 215 220

gcg gca cga aat atc ctc tta tcg gag aag aac gtg gtt aaa atc tgt 720

Ala Ala Arg Asn Ile Leu Leu Ser Glu Lys Asn Val Val Lys Ile Cys

225 230 235 240

gac ttt ggc ttg gcc cgg gat att tat aaa gat cca gat tat gtc aga 768

Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp Tyr Val Arg

245 250 255

aaa gga gat gct cgc ctc cct ttg aaa tgg atg gcc cca gaa aca att 816

Lys Gly Asp Ala Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Thr Ile

260 265 270

ttt gac aga gtg tac aca atc cag agt gac gtc tgg tct ttt ggt gtt 864

Phe Asp Arg Val Tyr Thr Ile Gln Ser Asp Val Trp Ser Phe Gly Val

275 280 285

ttg ctg tgg gaa ata ttt tcc tta ggt gct tct cca tat cct ggg gta 912

Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr Pro Gly Val

290 295 300

aag att gat gaa gaa ttt tgt agg cga ttg aaa gaa gga act aga atg 960

Lys Ile Asp Glu Glu Phe Cys Arg Arg Leu Lys Glu Gly Thr Arg Met

305 310 315 320

agg gcc cct gat tat act aca cca gaa atg tac cag acc atg ctg gac 1008

Arg Ala Pro Asp Tyr Thr Thr Pro Glu Met Tyr Gln Thr Met Leu Asp

325 330 335

tgc tgg cac ggg gag ccc agt cag aga ccc acg ttt tca gag ttg gtg 1056

Cys Trp His Gly Glu Pro Ser Gln Arg Pro Thr Phe Ser Glu Leu Val

340 345 350

gaa cat ttg gga aat ctc ttg caa gct aat gct cag cag gat 1098

Glu His Leu Gly Asn Leu Leu Gln Ala Asn Ala Gln Gln Asp

355 360 365

<210>2

<211>366

<212>PRT

＜213〉people (human)

<400>2

Met Asp Pro Asp Glu Leu Pro Leu Asp Glu His Cys Glu Arg Leu Pro

1 5 10 15

Tyr Asp Ala Ser Lys Trp Glu Phe Pro Arg Asp Arg Leu Lys Leu Gly

20 25 30

Lys Pro Leu Gly Arg Gly Ala Phe Gly Gln Val Ile Glu Ala Asp Ala

35 40 45

Phe Gly Ile Asp Lys Thr Ala Thr Cys Arg Thr Val Ala Val Lys Met

50 55 60

Leu Lys Glu Gly Ala Thr His Ser Glu His Arg Ala Leu Met Ser Glu

65 70 75 80

Leu Lys Ile Leu Ile His Ile Gly His His Leu Asn Val Val Asn Leu

85 90 95

Leu Gly Ala Cys Thr Lys Pro Gly Gly Pro Leu Met Val Ile Val Glu

100 105 110

Phe Cys Lys Phe Gly Asn Leu Ser Thr Tyr Leu Arg Ser Lys Arg Asn

115 120 125

Glu Phe Val Pro Tyr Lys Thr Lys Gly Ala Arg Phe Arg Gln Gly Lys

130 135 140

Asp Tyr Val Gly Ala Ile Pro Val Asp Leu Lys Arg Arg Leu Asp Ser

145 150 155 160

Ile Thr Ser Ser Gln Ser Ser Ala Ser Ser Gly Phe Val Glu Glu Lys

165 170 175

Ser Leu Ser Asp Val Glu Glu Glu Glu Ala Pro Glu Asp Leu Tyr Lys

180 185 190

Asp Phe Leu Thr Leu Glu His Leu Ile Cys Tyr Ser Phe Gln Val Ala

195 200 205

Lys Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His Arg Asp Leu

210 215 220

Ala Ala Arg Asn Ile Leu Leu Ser Glu Lys Asn Val Val Lys Ile Cys

225 230 235 240

Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp Tyr Val Arg

245 250 255

Lys Gly Asp Ala Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Thr Ile

260 265 270

Phe Asp Arg Val Tyr Thr Ile Gln Ser Asp Val Trp Ser Phe Gly Val

275 280 285

Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr Pro Gly Val

290 295 300

Lys Ile Asp Glu Glu Phe Cys Arg Arg Leu Lys Glu Gly Thr Arg Met

305 310 315 320

Arg Ala Pro Asp Tyr Thr Thr Pro Glu Met Tyr Gln Thr Met Leu Asp

325 330 335

Cys Trp His Gly Glu Pro Ser Gln Arg Pro Thr Phe Ser Glu Leu Val

340 345 350

Glu His Leu Gly Asn Leu Leu Gln Ala Asn Ala Gln Gln Asp

355 360 365

<210>3

<211>1098

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉nucleotide sequence of the Tyrosylprotein kinase KDR that optimizes at the pichia spp codon-bias

<400>3

atggaccctg atgagttgcc attggatgaa cactgcgagc gtttgcctta cgacgcctct 60

aagtgggagt tccctagaga tagattgaag ttgggaaagc cacttggtag aggagccttt 120

ggtcaagtca ttgaggctga cgccttcgga atcgacaaga ccgctacctg ccgtaccgtt 180

gctgtcaaaa tgttgaaaga gggagctacc cactctgaac atagagcctt gatgtccgag 240

ttgaagatcc ttatccacat tggtcatcac ttgaatgttg tcaacttgtt gggtgcttgt 300

actaagccag gtggaccatt gatggtcatt gtcgagtttt gcaagtttgg taacctttcc 360

acctacctta gatccaagcg taacgagttc gtcccataca agactaaggg tgctagattc 420

cgtcaaggaa aggactatgt tggtgctatc ccagttgatt tgaagcgtag attggattct 480

atcacttctt ctcaatcctc cgcttcttcc ggattcgttg aggagaagtc tctttctgat 540

gtcgaggaag aggaagcccc agaggacctt tacaaagact ttcttacttt ggaacacttg 600

atctgttact ccttccaggt cgccaaaggt atggagtttc ttgcctctag aaagtgcatc 660

catcgtgacc ttgctgctcg taacatcttg ttgtctgaaa agaatgtcgt caagatctgc 720

gacttcggac ttgctcgtga catctacaag gacccagact acgttagaaa gggagacgcc 780

agattgcctt tgaagtggat ggctccagaa actatcttcg atagagtcta caccatccag 840

tccgatgtct ggtcctttgg agttcttttg tgggagatct tctctcttgg agcctctcct 900

taccctggag ttaagattga tgaagagttc tgtagacgtt tgaaggaagg aactagaatg 960

cgtgctcctg actacactac tcctgagatg tatcagacca tgcttgactg ttggcatgga 1020

gaaccatctc aacgtccaac tttctccgag cttgttgagc accttggaaa ccttcttcaa 1080

gctaacgctc agcaggac 1098

<210>4

<211>1107

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉contain the nucleosides of pichia spp peroxysome signal for locating SKL and codon optimized Tyrosylprotein kinase KDR

Acid sequence

<220>

<221>transit_peptide

<222>(1099)..(1107)

<400>4

atggaccctg atgagttgcc attggatgaa cactgcgagc gtttgcctta cgacgcctct 60

aagtgggagt tccctagaga tagattgaag ttgggaaagc cacttggtag aggagccttt 120

ggtcaagtca ttgaggctga cgccttcgga atcgacaaga ccgctacctg ccgtaccgtt 180

gctgtcaaaa tgttgaaaga gggagctacc cactctgaac atagagcctt gatgtccgag 240

ttgaagatcc ttatccacat tggtcatcac ttgaatgttg tcaacttgtt gggtgcttgt 300

actaagccag gtggaccatt gatggtcatt gtcgagtttt gcaagtttgg taacctttcc 360

acctacctta gatccaagcg taacgagttc gtcccataca agactaaggg tgctagattc 420

cgtcaaggaa aggactatgt tggtgctatc ccagttgatt tgaagcgtag attggattct 480

atcacttctt ctcaatcctc cgcttcttcc ggattcgttg aggagaagtc tctttctgat 540

gtcgaggaag aggaagcccc agaggacctt tacaaagact ttcttacttt ggaacacttg 600

atctgttact ccttccaggt cgccaaaggt atggagtttc ttgcctctag aaagtgcatc 660

catcgtgacc ttgctgctcg taacatcttg ttgtctgaaa agaatgtcgt caagatctgc 720

gacttcggac ttgctcgtga catctacaag gacccagact acgttagaaa gggagacgcc 780

agattgcctt tgaagtggat ggctccagaa actatcttcg atagagtcta caccatccag 840

tccgatgtct ggtcctttgg agttcttttg tgggagatct tctctcttgg agcctctcct 900

taccctggag ttaagattga tgaagagttc tgtagacgtt tgaaggaagg aactagaatg 960

cgtgctcctg actacactac tcctgagatg tatcagacca tgcttgactg ttggcatgga 1020

gaaccatctc aacgtccaac tttctccgag cttgttgagc accttggaaa ccttcttcaa 1080

gctaacgctc agcaggactc caagttg 1107

<210>5

<211>1107

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉contain the nucleotide sequence of the Tyrosylprotein kinase KDR of pichia spp peroxysome signal for locating SKL

<220>

<221>transit_peptide

<222>(1099)..(1107)

<400>5

atggatccag atgaactccc attggatgaa cattgtgaac gactgcctta tgatgccagc 60

aaatgggaat tccccagaga ccggctgaag ctaggtaagc ctcttggccg tggtgccttt 120

ggccaagtga ttgaagcaga tgcctttgga attgacaaga cagcaacttg caggacagta 180

gcagtcaaaa tgttgaaaga aggagcaaca cacagtgagc atcgagctct catgtctgaa 240

ctcaagatcc tcattcatat tggtcaccat ctcaatgtgg tcaaccttct aggtgcctgt 300

accaagccag gagggccact catggtgatt gtggaattct gcaaatttgg aaacctgtcc 360

acttacctga ggagcaagag aaatgaattt gtcccctaca agaccaaagg ggcacgattc 420

cgtcaaggga aagactacgt tggagcaatc cctgtggatc tgaaacggcg cttggacagc 480

atcaccagta gccagagctc agccagctct ggatttgtgg aggagaagtc cctcagtgat 540

gtagaagaag aggaagctcc tgaagatctg tataaggact tcctgacctt ggagcatctc 600

atctgttaca gcttccaagt ggctaagggc atggagttct tggcatcgcg aaagtgtatc 660

cacagggacc tggcggcacg aaatatcctc ttatcggaga agaacgtggt taaaatctgt 720

gactttggct tggcccggga tatttataaa gatccagatt atgtcagaaa aggagatgct 780

cgcctccctt tgaaatggat ggccccagaa acaatttttg acagagtgta cacaatccag 840

agtgacgtct ggtcttttgg tgttttgctg tgggaaatat tttccttagg tgcttctcca 900

tatcctgggg taaagattga tgaagaattt tgtaggcgat tgaaagaagg aactagaatg 960

agggcccctg attatactac accagaaatg taccagacca tgctggactg ctggcacggg 1020

gagcccagtc agagacccac gttttcagag ttggtggaac atttgggaaa tctcttgcaa 1080

gctaatgctc agcaggattc caagttg 1107

<210>6

<211>1887

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉contain the nucleotide sequence of the fusion rotein of His-tag, GFP, zymoplasm restriction enzyme site, KDR, SKL

<220>

<221>CDS

<222>(1)..(1887)

<400>6

atg gct cat cac cac cat cat cat cat cat cat cat ctg cag atg tct 48

Met Ala His His His His His His His His His His Leu Gln Met Ser

1 5 10 15

aaa ggt gaa gaa tta ttc act ggt gtt gtc cca att ttg gtt gaa tta 96

Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu

20 25 30

gat ggt gat gtt aat ggt cac aaa ttt tct gtc tcc ggt gaa ggt gaa 144

Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu

35 40 45

ggt gat gct act tac ggt aaa ttg acc tta aaa ttt att tgt act act 192

Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr

50 55 60

ggt aaa ttg cca gtt cca tgg cca acc tta gtc act act ttc ggt tat 240

Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe Gly Tyr

65 70 75 80

ggt gtt caa tgt ttt gct aga tac cca gat cat atg aaa caa cat gac 288

Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Gln His Asp

85 90 95

ttt ttc aag tct gcc atg cca gaa ggt tat gtt caa gaa aga act att 336

Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile

100 105 110

ttt ttc aaa gat gac ggt aac tac aag acc aga gct gaa gtc aag ttt 384

Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe

115 120 125

gaa ggt gat acc tta gtt aat aga atc gaa tta aaa ggt att gat ttt 432

Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe

130 135 140

aaa gaa gat ggt aac att tta ggt cac aaa ttg gaa tac aac tat aac 480

Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn

145 150 155 160

tct cac aat gtt tac atc atg gct gac aaa caa aag aat ggt atc aaa 528

Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys

165 170 175

gtt aac ttc aaa att aga cac aac att gaa gat ggt tct gtt caa tta 576

Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu

180 185 190

gct gac cat tat caa caa aat act cca att ggt gat ggt cca gtc ttg 624

Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu

195 200 205

tta cca gac aac cat tac tta tcc act caa tct gcc tta tcc aaa gat 672

Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp

210 215 220

eca aac gaa aag aga gac cac atg gtc ttg tta gaa ttt gtt act gct 720

Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala

225 230 235 240

gct ggt att acc cat ggt atg gat gaa ttg tac aaa gaa ttc ctg gtc 768

Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Glu Phe Leu Val

245 250 255

ccc aga ggc tct atg gac cct gat gag ttg cca ttg gat gaa cac tgc 816

Pro Arg Gly Ser Met Asp Pro Asp Glu Leu Pro Leu Asp Glu His Cys

260 265 270

gag cgt ttg cct tac gac gcc tct aag tgg gag ttc cct aga gat aga 864

Glu Arg Leu Pro Tyr Asp Ala Ser Lys Trp Glu Phe Pro Arg Asp Arg

275 280 285

ttg aag ttg gga aag cca ctt ggt aga gga gcc ttt ggt caa gtc att 912

Leu Lys Leu Gly Lys Pro Leu Gly Arg Gly Ala Phe Gly Gln Val Ile

290 295 300

gag gct gac gcc ttc gga atc gac aag acc gct acc tgc cgt acc gtt 960

Glu Ala Asp Ala Phe Gly Ile Asp Lys Thr Ala Thr Cys Arg Thr Val

305 310 315 320

gct gtc aaa atg ttg aaa gag gga gct acc cac tct gaa cat aga gcc 1008

Ala Val Lys Met Leu Lys Glu Gly Ala Thr His Ser Glu His Arg Ala

325 330 335

ttg atg tcc gag ttg aag atc ctt atc cac att ggt cat cac ttg aat 1056

Leu Met Ser Glu Leu Lys Ile Leu Ile His Ile Gly His His Leu Asn

340 345 350

gtt gtc aac ttg ttg ggt gct tgt act aag cca ggt gga cca ttg atg 1104

Val Val Asn Leu Leu Gly Ala Cys Thr Lys Pro Gly Gly Pro Leu Met

355 360 365

gtc att gtc gag ttt tgc aag ttt ggt aac ctt tcc acc tac ctt aga 1152

Val Ile Val Glu Phe Cys Lys Phe Gly Asn Leu Ser Thr Tyr Leu Arg

370 375 380

tcc aag cgt aac gag ttc gtc cca tac aag act aag ggt gct aga ttc 1200

Ser Lys Arg Asn Glu Phe Val Pro Tyr Lys Thr Lys Gly Ala Arg Phe

385 390 395 400

cgt caa gga aag gac tat gtt ggt gct atc cca gtt gat ttg aag cgt 1248

Arg Gln Gly Lys Asp Tyr Val Gly Ala Ile Pro Val Asp Leu Lys Arg

405 410 415

aga ttg gat tct atc act tct tct caa tcc tcc gct tct tcc gga ttc 1296

Arg Leu Asp Ser Ile Thr Ser Ser Gln Ser Ser Ala Ser Ser Gly Phe

420 425 430

gtt gag gag aag tct ctt tct gat gtc gag gaa gag gaa gcc cca gag 1344

Val Glu Glu Lys Ser Leu Ser Asp Val Glu Glu Glu Glu Ala Pro Glu

435 440 445

gac ctt tac aaa gac ttt ctt act ttg gaa cac ttg atc tgt tac tcc 1392

Asp Leu Tyr Lys Asp Phe Leu Thr Leu Glu His Leu Ile Cys Tyr Ser

450 455 460

ttc cag gtc gcc aaa ggt atg gag ttt ctt gcc tct aga aag tgc atc 1440

Phe Gln Val Ala Lys Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile

465 470 475 480

cat cgt gac ctt gct gct cgt aac atc ttg ttg tct gaa aag aat gtc 1488

His Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Lys Asn Val

485 490 495

gtc aag atc tgc gac ttc gga ctt gct cgt gac atc tac aag gac cca 1536

Val Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro

500 505 510

gac tac gtt aga aag gga gac gcc aga ttg cct ttg aag tgg atg gct 1584

Asp Tyr Val Arg Lys Gly Asp Ala Arg Leu Pro Leu Lys Trp Met Ala

515 520 525

cca gaa act atc ttc gat aga gtc tac acc atc cag tcc gat gtc tgg 1632

Pro Glu Thr Ile Phe Asp Arg Val Tyr Thr Ile Gln Ser Asp Val Trp

530 535 540

tcc ttt gga gtt ctt ttg tgg gag atc ttc tct ctt gga gcc tct cct 1680

Ser Phe Gly Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro

545 550 555 560

tac cct gga gtt aag att gat gaa gag ttc tgt aga cgt ttg aag gaa 1728

Tyr Pro Gly Val Lys Ile Asp Glu Glu Phe Cys Arg Arg Leu Lys Glu

565 570 575

gga act aga atg cgt gct cct gac tac act act cct gag atg tat cag 1776

Gly Thr Arg Met Arg Ala Pro Asp Tyr Thr Thr Pro Glu Met Tyr Gln

580 585 590

acc atg ctt gac tgt tgg cat gga gaa cca tct caa cgt cca act ttc 1824

Thr Met Leu Asp Cys Trp His Gly Glu Pro Ser Gln Arg Pro Thr Phe

595 600 605

tcc gag ctt gtt gag cac ctt gga aac ctt ctt caa gct aac gct cag 1872

Ser Glu Leu Val Glu His Leu Gly Asn Leu Leu Gln Ala Asn Ala Gln

610 615 620

cag gac tcc aag ttg 1887

Gln Asp Ser Lys Leu

625

<210>7

<211>629

<212>PRT

＜213〉artificial sequence (Artificial)

<220>

<223>Synthetic Construct

<400>7

Met Ala His His His His His His His His His His Leu Gln Met Ser

1 5 10 15

Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu

20 25 30

Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu

35 40 45

Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr

50 55 60

Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe Gly Tyr

65 70 75 80

Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Gln His Asp

85 90 95

Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile

100 105 110

Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe

115 120 125

Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe

130 135 140

Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn

145 150 155 160

Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys

165 170 175

Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu

180 185 190

Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu

195 200 205

Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp

210 215 220

Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala

225 230 235 240

Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Glu Phe Leu Val

245 250 255

Pro Arg Gly Ser Met Asp Pro Asp Glu Leu Pro Leu Asp Glu His Cys

260 265 270

Glu Arg Leu Pro Tyr Asp Ala Ser Lys Trp Glu Phe Pro Arg Asp Arg

275 280 285

Leu Lys Leu Gly Lys Pro Leu Gly Arg Gly Ala Phe Gly Gln Val Ile

290 295 300

Glu Ala Asp Ala Phe Gly Ile Asp Lys Thr Ala Thr Cys Arg Thr Val

305 310 315 320

Ala Val Lys Met Leu Lys Glu Gly Ala Thr His Ser Glu His Arg Ala

325 330 335

Leu Met Ser Glu Leu Lys Ile LeuIle His Ile Gly Hi s His Leu Asn

340 345 350

Val Val Asn Leu Leu Gly Ala Cys Thr Lys Pro Gly Gly Pro Leu Met

355 360 365

Val Ile Val Glu Phe Cys Lys Phe Gly Asn Leu Ser Thr Tyr Leu Arg

370 375 380

Ser Lys Arg Asn Glu Phe Val Pro Tyr Lys Thr Lys Gly Ala Arg Phe

385 390 395 400

Arg Gln Gly Lys Asp Tyr Val Gly Ala Ile Pro Val Asp Leu Lys Arg

405 410 415

Arg Leu Asp Ser Ile Thr Ser Ser Gln Ser Ser Ala Ser Ser Gly Phe

420 425 430

Val Glu Glu Lys Ser Leu Ser Asp Val Glu Glu Glu Glu Ala Pro Glu

435 440 445

Asp Leu Tyr Lys Asp Phe Leu Thr Leu Glu His Leu Ile Cys Tyr Ser

450 455 460

Phe Gln Val Ala Lys Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile

465 470 475 480

His Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Lys Asn Val

485 490 495

Val Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro

500 505 510

Asp Tyr Val Arg Lys Gly Asp Ala Arg Leu Pro Leu Lys Trp Met Ala

515 520 525

Pro Glu Thr Ile Phe Asp Arg Val Tyr Thr Ile Gln Ser Asp Val Trp

530 535 540

Ser Phe Gly Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro

545 550 555 560

Tyr Pro Gly Val Lys Ile Asp Glu Glu Phe Cys Arg Arg Leu Lys Glu

565 570 575

Gly Thr Arg Met Arg Ala Pro Asp Tyr Thr Thr Pro Glu Met Tyr Gln

580 585 590

Thr Met Leu Asp Cys Trp His Gly Glu Pro Ser Gln Arg Pro Thr Phe

595 600 605

Ser Glu Leu Val Glu His Leu Gly Asn Leu Leu Gln Ala Asn Ala Gln

610 615 620

Gln Asp Ser Lys Leu

625

<210>8

<211>63

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉nucleotide sequence of coding His-tag

<400>8

gactctagat acgtaaccat ggctcatcac caccatcatc atcatcatca tcatctgcag 60

tag 63

<210>9

<211>717

<212>DNA

＜213〉jellyfish (Aequorea victoria)

<220>

<221>CDS

<222>(1)..(717)

<400>9

atg tct aaa ggt gaa gaa tta ttc act ggt gtt gtc cca att ttg gtt 48

Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val ProIle Leu Val

1 5 10 15

gaa tta gat ggt gat gtt aat ggt cac aaa ttt tct gtc tcc ggt gaa 96

Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu

20 25 30

ggt gaa ggt gat gct act tac ggt aaa ttg acc tta aaa ttt att tgt 144

Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys

35 40 45

act act ggt aaa ttg cca gtt cca tgg cca acc tta gtc act act ttc 192

Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe

50 55 60

ggt tat ggt gtt caa tgt ttt gct aga tac cca gat cat atg aaa caa 240

Gly Tyr Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Gln

65 70 75 80

cat gac ttt ttc aag tct gcc atg cca gaa ggt tat gtt caa gaa aga 288

His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg

85 90 95

act att ttt ttc aaa gat gac ggt aac tac aag acc aga gct gaa gtc 336

Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val

100 105 110

aag ttt gaa ggt gat acc tta gtt aat aga atc gaa tta aaa ggt att 384

Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile

115 120 125

gat ttt aaa gaa gat ggt aac att tta ggt cac aaa ttg gaa tac aac 432

Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn

130 135 140

tat aac tct cac aat gtt tac atc atg gct gac aaa caa aag aat ggt 480

Tyr AsnSer Hi s Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly

145 150 155 160

atc aaa gtt aac ttc aaa att aga cac aac att gaa gat ggt tct gtt 528

Ile Lys Val Asn Phe Lys Ile Arg Hi s AsnIle Glu Asp Gly Ser Val

165 170 175

caa tta gct gac cat tat caa caa aat act cca att ggt gat ggt cca 576

Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro

180 185 190

gtc ttg tta cca gac aac cat tac tta tcc act caa tct gcc tta tcc 624

Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser

195 200 205

aaa gat cca aac gaa aag aga gac cac atg gtc ttg tta gaa ttt gtt 672

Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val

210 215 220

act gct gct ggt att acc cat ggt atg gat gaa ttg tac aaa taa 717

Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210>10

<211>238

<212>PRT

＜213〉jellyfish (Aequorea victoria)

<400>10

Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val

1 5 10 15

Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu

20 25 30

Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys

35 40 45

Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe

50 55 60

Gly Tyr Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Gln

65 70 75 80

His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg

85 90 95

Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val

100 105 110

Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile

115 120 125

Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn

130 135 140

Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly

145 150 155 160

Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val

165 170 175

Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro

180 185 190

Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser

195 200 205

Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val

210 215 220

Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210>11

<211>33

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P1

<400>11

aaactgcaga tgtctaaagg tgaagaatta ttc 33

<210>12

<211>29

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P2

<400>12

ccggaattct ttgtacaatt catccatac 29

<210>13

<211>45

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P3

<400>13

ccggaattcc tggtccccag aggctctatg gaccctgatg agttg 45

<210>14

<211>49

<212>DNA

＜213〉artificial sequence (Artficial)

<220>

＜223〉primer P4

<400>14

cattagcggc cgccctaggc tactacaact tggagtcctg ctgagcgtt 49

<210>15

<211>1608

<212>DNA

＜213〉people (human)

<220>

<221>CDS

<222>(1)..(1608)

<400>15

atg ggt agc aac aag agc aag ccc aag gat gcc agc cag cgg cgc cgc 48

Met Gly Ser Asn Lys Ser Lys Pro Lys Asp Ala Ser Gln Arg Arg Arg

l 5 10 15

agc ctg gag ccc gcc gag aac gtg cac ggc gct ggc ggg ggc gct ttc 96

Ser Leu Glu Pro Ala Glu Asn Val His Gly Ala Gly Gly Gly Ala Phe

20 25 30

ccc gcc tcg cag acc ccc agc aag cca gcc tcg gcc gac ggc cac cgc 144

Pro Ala Ser Gln Thr Pro Ser Lys Pro Ala Ser Ala Asp Gly His Arg

35 40 45

ggc ccc agc gcg gcc ttc gcc ccc gcg gcc gcc gag ccc aag ctg ttc 192

Gly Pro Ser Ala Ala Phe Ala Pro Ala Ala Ala Glu Pro Lys Leu Phe

50 55 60

gga ggc ttc aac tcc tcg gac acc gtc acc tcc ccg cag agg gcg ggc 240

Gly Gly Phe Asn Ser Ser Asp Thr Val Thr Ser Pro Gln Arg Ala Gly

65 70 75 80

ccg ctg gcc ggt gga gtg acc acc ttt gtg gcc ctc tat gac tat gag 288

Pro Leu Ala Gly Gly Val Thr Thr Phe Val Ala Leu Tyr Asp Tyr Glu

85 90 95

tct agg acg gag aca gac ctg tcc ttc aag aaa ggc gag cgg ctc cag 336

Ser Arg Thr Glu Thr Asp Leu Ser Phe Lys Lys Gly Glu Arg Leu Gln

100 105 110

att gtc aac aac aca gag gga gac tgg tgg ctg gcc cac tcg ctc agc 384

Ile Val Asn Asn Thr Glu Gly Asp Trp Trp Leu Ala His Ser Leu Ser

115 120 125

aca gga cag aca ggc tac atc ccc agc aac tac gtg gcg ccc tcc gac 432

Thr Gly Gln Thr Gly Tyr Ile Pro Ser Asn Tyr Val Ala Pro Ser Asp

130 135 140

tcc atc cag gct gag gag tgg tat ttt ggc aag atc acc aga cgg gag 480

Ser Ile Gln Ala Glu Glu Trp Tyr Phe Gly Lys Ile Thr Arg Arg Glu

145 150 155 160

tca gag cgg tta ctg ctc aat gca gag aac ccg aga ggg acc ttc ctc 528

Ser Glu Arg Leu Leu Leu Asn Ala Glu Asn Pro Arg Gly Thr Phe Leu

165 170 175

gtg cga gaa agt gag acc acg aaa ggt gcc tac tgc ctc tca gtg tct 576

Val Arg Glu Ser Glu Thr Thr Lys Gly Ala Tyr Cys Leu Ser Val Ser

180 185 190

gac ttc gac aac gcc aag ggc ctc aac gtg aag cac tac aag atc cgc 624

Asp Phe Asp Asn Ala Lys Gly Leu Asn Val Lys His Tyr Lys Ile Arg

195 200 205

aag ctg gac agc ggc ggc ttc tac atc acc tcc cgc acc cag ttc aac 672

Lys Leu Asp Ser Gly Gly Phe Tyr Ile Thr Ser Arg Thr Gln Phe Asn

210 215 220

agc ctg cag cag ctg gtg gcc tac tac tcc aaa cac gcc gat ggc ctg 720

Ser Leu Gln Gln Leu Val Ala Tyr Tyr Ser Lys His Ala Asp Gly Leu

225 230 235 240

tgc cac cgc ctc acc acc gtg tgc ccc acg tcc aag ccg cag act cag 768

Cys His Arg Leu Thr Thr Val Cys Pro Thr Ser Lys Pro Gln Thr Gln

245 250 255

ggc ctg gcc aag gat gcc tgg gag atc cct cgg gag tcg ctg cgg ctg 816

Gly Leu Ala Lys Asp Ala Trp Glu Ile Pro Arg Glu Ser Leu Arg Leu

260 265 270

gag gtc aag ctg ggc cag ggc tgc ttt ggc gag gtg tgg atg ggg acc 864

Glu Val Lys Leu Gly Gln Gly Cys Phe Gly Glu Val Trp Met Gly Thr

275 280 285

tgg aac ggt acc acc agg gtg gcc atc aaa acc ctg aag cct ggc acg 912

Trp Asn Gly Thr Thr Arg Val Ala Ile Lys Thr Leu Lys Pro Gly Thr

290 295 300

atg tct cca gag gcc ttc ctg cag gag gcc cag gtc atg aag aag ctg 960

Met Ser Pro Glu Ala Phe Leu Gln Glu Ala Gln Val Met Lys Lys Leu

305 310 315 320

agg cat gag aag ctg gtg cag ttg tat gct gtg gtt tca gag gag ccc 1008

Arg His Glu Lys Leu Val Gln Leu Tyr Ala Val Val Ser Glu Glu Pro

325 330 335

att tac atc gtc acg gag tac atg agc aag ggg agt ttg ctg gac ttt 1056

Ile Tyr Ile Val Thr Glu Tyr Met Ser Lys Gly Ser Leu Leu Asp Phe

340 345 350

ctc aag ggg gag aca ggc aag tac ctg cgg ctg cct cag ctg gtg gac 1104

Leu Lys Gly Glu Thr Gly Lys Tyr Leu Arg Leu Pro Gln Leu Val Asp

355 360 365

atg gct gct cag atc gcc tca ggc atg gcg tac gtg gag cgg atg aac 1152

Met Ala Ala Gln Ile Ala Ser Gly Met Ala Tyr Val Glu Arg Met Asn

370 375 380

tac gtc cac cgg gac ctt cgt gca gcc aac atc ctg gtg gga gag aac 1200

Tyr Val His Arg Asp Leu Arg Ala Ala Asn Ile Leu Val Gly Glu Asn

385 390 395 400

ctg gtg tgc aaa gtg gcc gac ttt ggg ctg gct cgg ctc att gaa gac 1248

Leu Val Cys Lys Val Ala Asp Phe Gly Leu Ala Arg Leu Ile Glu Asp

405 410 415

aat gag tac acg gcg cgg caa ggt gcc aaa ttc ccc atc aag tgg acg 1296

Asn Glu Tyr Thr Ala Arg Gln Gly Ala Lys Phe Pro Ile Lys Trp Thr

420 425 430

gct cca gaa gct gcc ctc tat ggc cgc ttc acc atc aag tcg gac gtg 1344

Ala Pro Glu Ala Ala Leu Tyr Gly Arg Phe Thr Ile Lys Ser Asp Val

435 440 445

tgg tcc ttc ggg atc ctg ctg act gag ctc acc aca aag gga cgg gtg 1392

Trp Ser Phe Gly Ile Leu Leu Thr Glu Leu Thr Thr Lys Gly Arg Val

450 455 460

ccc tac cct ggg atg gtg aac cgc gag gtg ctg gac cag gtg gag cgg 1440

Pro Tyr Pro Gly Met Val Asn Arg Glu Val Leu Asp Gln Val Glu Arg

465 470 475 480

ggc tac cgg atg ccc tgc ccg ccg gag tgt ccc gag tcc ctg cac gac 1488

Gly Tyr Arg Met Pro Cys Pro Pro Glu Cys Pro Glu Ser Leu His Asp

485 490 495

ctc atg tgc cag tgc tgg cgg aag gag cct gag gag cgg ccc acc ttc 1536

Leu Met Cys Gln Cys Trp Arg Lys Glu Pro Glu Glu Arg Pro Thr Phe

500 505 510

gag tac ctg cag gcc ttc ctg gag gac tac ttc acg tcc acc gag ccc 1584

Glu Tyr Leu Gln Ala Phe Leu Glu Asp Tyr Phe Thr Ser Thr Glu Pro

515 520 525

cag tac cag ccc ggg gag aac ctc 1608

Gln Tyr Gln Pro Gly Glu Asn Leu

530 535

<210>16

<211>536

<212>PRT

＜213〉people (human)

<400>16

Met Gly Ser Asn Lys Ser Lys Pro Lys Asp Ala Ser Gln Arg Arg Arg

1 5 10 15

Ser Leu Glu Pro Ala Glu Asn Val His Gly Ala Gly Gly Gly Ala Phe

20 25 30

Pro Ala Ser Gln Thr Pro Ser Lys Pro Ala Ser Ala Asp Gly His Arg

35 40 45

Gly Pro Ser Ala Ala Phe Ala Pro Ala Ala Ala Glu Pro Lys Leu Phe

50 55 60

Gly Gly Phe Asn Ser Ser Asp Thr Val Thr Ser Pro Gln Arg Ala Gly

65 70 75 80

Pro Leu Ala Gly Gly Val Thr Thr Phe Val Ala Leu Tyr Asp Tyr Glu

85 90 95

Ser Arg Thr Glu Thr Asp Leu Ser Phe Lys Lys Gly Glu Arg Leu Gln

100 105 110

Ile Val Asn Asn Thr Glu Gly Asp Trp Trp Leu Ala His Ser Leu Ser

115 120 125

Thr Gly Gln Thr Gly Tyr Ile Pro Ser Asn Tyr Val Ala Pro Ser Asp

130 135 140

Ser Ile Gln Ala Glu Glu Trp Tyr Phe Gly Lys Ile Thr Arg Arg Glu

145 150 155 160

Ser Glu Arg Leu Leu Leu Asn Ala Glu Asn Pro Arg Gly Thr Phe Leu

165 170 175

Val Arg Glu Ser Glu Thr Thr Lys Gly Ala Tyr Cys Leu Ser Val Ser

180 185 190

Asp Phe Asp Asn Ala Lys Gly Leu Asn Val Lys His Tyr Lys Ile Arg

195 200 205

Lys Leu Asp Ser Gly Gly Phe Tyr Ile Thr Ser Arg Thr Gln Phe Asn

210 215 220

Ser Leu Gln Gln Leu Val Ala Tyr Tyr Ser Lys His Ala Asp Gly Leu

225 230 235 240

Cys His Arg Leu Thr Thr Val Cys Pro Thr Ser Lys Pro Gln Thr Gln

245 250 255

Gly Leu Ala Lys Asp Ala Trp Glu Ile Pro Arg Glu Ser Leu Arg Leu

260 265 270

Glu Val Lys Leu Gly Gln Gly Cys Phe Gly Glu Val Trp Met Gly Thr

275 280 285

Trp Asn Gly Thr Thr Arg Val Ala Ile Lys Thr Leu Lys Pro Gly Thr

290 295 300

Met Ser Pro Glu Ala Phe Leu Gln Glu Ala Gln Val Met Lys Lys Leu

305 310 315 320

Arg His Glu Lys Leu Val Gln Leu Tyr Ala Val Val Ser Glu Glu Pro

325 330 335

Ile Tyr Ile Val Thr Glu Tyr Met Ser Lys Gly Ser Leu Leu Asp Phe

340 345 350

Leu Lys Gly Glu Thr Gly Lys Tyr Leu Arg Leu Pro Gln Leu Val Asp

355 360 365

Met Ala Ala Gln Ile Ala Ser Gly Met Ala Tyr Val Glu Arg Met Asn

370 375 380

Tyr Val His Arg Asp Leu Arg Ala Ala Asn Ile Leu Val Gly Glu Asn

385 390 395 400

Leu Val Cys Lys Val Ala Asp Phe Gly Leu Ala Arg Leu Ile Glu Asp

405 410 415

Asn Glu Tyr Thr Ala Arg Gln Gly Ala Lys Phe Pro Ile Lys Trp Thr

420 425 430

Ala Pro Glu Ala Ala Leu Tyr Gly Arg Phe Thr Ile Lys Ser Asp Val

435 440 445

Trp Ser Phe Gly Ile Leu Leu Thr Glu Leu Thr Thr Lys Gly Arg Val

450 455 460

Pro Tyr Pro Gly Met Val Asn Arg Glu Val Leu Asp Gln Val Glu Arg

465 470 475 480

Gly Tyr Arg Met Pro Cys Pro Pro Glu Cys Pro Glu Ser Leu His Asp

485 490 495

Leu Met Cys Gln Cys Trp Arg Lys Glu Pro Glu Glu Arg Pro Thr Phe

500 505 510

Glu Tyr Leu Gln Ala Phe Leu Glu Asp Tyr Phe Thr Ser Thr Glu Pro

515 520 525

Gln Tyr Gln Pro Gly Glu Asn Leu

530 535

<210>17

<211>1641

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉contain the nucleotides sequence of the Tyrosylprotein kinase Src of pichia spp peroxysome signal for locating RLNNLATQL

Row

<220>

<221>transit_peptide

<222>(7)..(33)

<400>17

atggctagat tgaacaactt ggctactcaa ttgatgggta gcaacaagag caagcccaag 60

gatgccagcc agcggcgccg cagcctggag cccgccgaga acgtgcacgg cgctggcggg 120

ggcgctttcc ccgcctcgca gacccccagc aagccagcct cggccgacgg ccaccgcggc 180

cccagcgcgg ccttcgcccc cgcggccgcc gagcccaagc tgttcggagg cttcaactcc 240

tcggacaccg tcacctcccc gcagagggcg ggcccgctgg ccggtggagt gaccaccttt 300

gtggccctct atgactatga gtctaggacg gagacagacc tgtccttcaa gaaaggcgag 360

cggctccaga ttgtcaacaa cacagaggga gactggtggc tggcccactc gctcagcaca 420

ggacagacag gctacatccc cagcaactac gtggcgccct ccgactccat ccaggctgag 480

gagtggtatt ttggcaagat caccagacgg gagtcagagc ggttactgct caatgcagag 540

aacccgagag ggaccttcct cgtgcgagaa agtgagacca cgaaaggtgc ctactgcctc 600

tcagtgtctg acttcgacaa cgccaagggc ctcaacgtga agcactacaa gatccgcaag 660

ctggacagcg gcggcttcta catcacctcc cgcacccagt tcaacagcct gcagcagctg 720

gtggcctact actccaaaca cgccgatggc ctgtgccacc gcctcaccac cgtgtgcccc 780

acgtccaagc cgcagactca gggcctggcc aaggatgcct gggagatccc tcgggagtcg 840

ctgcggctgg aggtcaagct gggccagggc tgctttggcg aggtgtggat ggggacctgg 900

aacggtacca ccagggtggc catcaaaacc ctgaagcctg gcacgatgtc tccagaggcc 960

ttcctgcagg aggcccaggt catgaagaag ctgaggcatg agaagctggt gcagttgtat 1020

gctgtggttt cagaggagcc catttacatc gtcacggagt acatgagcaa ggggagtttg 1080

ctggactttc tcaaggggga gacaggcaag tacctgcggc tgcctcagct ggtggacatg 1140

gctgctcaga tcgcctcagg catggcgtac gtggagcgga tgaactacgt ccaccgggac 1200

cttcgtgcag ccaacatcct ggtgggagag aacctggtgt gcaaagtggc cgactttggg 1260

ctggctcggc tcattgaaga caatgagtac acggcgcggc aaggtgccaa attccccatc 1320

aagtggacgg ctccagaagc tgccctctat ggccgcttca ccatcaagtc ggacgtgtgg 1380

tccttcggga tcctgctgac tgagctcacc acaaagggac gggtgcccta ccctgggatg 1440

gtgaaccgcg aggtgctgga ccaggtggag cggggctacc ggatgccctg cccgccggag 1500

tgtcccgagt ccctgcacga cctcatgtgc cagtgctggc ggaaggagcc tgaggagcgg 1560

cccaccttcg agtacctgca ggccttcctg gaggactact tcacgtccac cgagccccag 1620

taccagcccg gggagaacct c 1641

<210>18

<211>2337

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉contain the nucleotide sequence of the fusion rotein of RLNNLATQL, Src, enteropeptidase restriction enzyme site, GST-tag

<220>

<221>CDS

<222>(1)..(2337)

<400>18

atg gct aga ttg aac aac ttg gct act caa ttg atg ggt agc aac aag 48

Met Ala Arg Leu Asn Asn Leu Ala Thr Gln Leu Met Gly Ser Asn Lys

1 5 10 15

agc aag ccc aag gat gcc agc cag cgg cgc cgc agc ctg gag ccc gcc 96

Ser Lys Pro Lys Asp Ala Ser Gln Arg Arg Arg Ser Leu Glu Pro Ala

20 25 30

gag aac gtg cac ggc gct ggc ggg ggc gct ttc ccc gcc tcg cag acc 144

Glu Asn Val His Gly Ala Gly Gly Gly Ala Phe Pro Ala Ser Gln Thr

35 40 45

ccc agc aag cca gcc tcg gcc gac ggc cac cgc ggc ccc agc gcg gcc 192

Pro Ser Lys Pro Ala Ser Ala Asp Gly His Arg Gly Pro Ser Ala Ala

50 55 60

ttc gcc ccc gcg gcc gcc gag ccc aag ctg ttc gga ggc ttc aac tcc 240

Phe Ala Pro Ala Ala Ala Glu Pro Lys Leu Phe Gly Gly Phe Asn Ser

65 70 75 80

tcg gac acc gtc acc tcc ccg cag agg gcg ggc ccg ctg gcc ggt gga 288

Ser Asp Thr Val Thr Ser Pro Gln Arg Ala Gly Pro Leu Ala Gly Gly

85 90 95

gtg acc acc ttt gtg gcc ctc tat gac tat gag tct agg acg gag aca 336

Val Thr Thr Phe Val Ala Leu Tyr Asp Tyr Glu Ser Arg Thr Glu Thr

100 105 110

gac ctg tcc ttc aag aaa ggc gag cgg ctc cag att gtc aac aac aca 384

Asp Leu Ser Phe Lys Lys Gly Glu Arg Leu Gln Ile Val Asn Asn Thr

115 120 125

gag gga gac tgg tgg ctg gcc cac tcg ctc agc aca gga cag aca ggc 432

Glu Gly Asp Trp Trp Leu Ala His Ser Leu Ser Thr Gly Gln Thr Gly

130 135 140

tac atc ccc agc aac tac gtg gcg ccc tcc gac tcc atc cag gct gag 480

Tyr Ile Pro Ser Asn Tyr Val Ala Pro Ser Asp Ser Ile Gln Ala Glu

145 150 155 160

gag tgg tat ttt ggc aag atc acc aga cgg gag tca gag cgg tta ctg 528

Glu Trp Tyr Phe Gly Lys Ile Thr Arg Arg Glu Ser Glu Arg Leu Leu

165 170 175

ctc aat gca gag aac ccg aga ggg acc ttc ctc gtg cga gaa agt gag 576

Leu Asn Ala Glu Asn Pro Arg Gly Thr Phe Leu Val Arg Glu Ser Glu

180 185 190

acc acg aaa ggt gcc tac tgc ctc tca gtg tct gac ttc gac aac gcc 624

Thr Thr Lys Gly Ala Tyr Cys Leu Ser Val Ser Asp Phe Asp Asn Ala

195 200 205

aag ggc ctc aac gtg aag cac tac aag atc cgc aag ctg gac agc ggc 672

Lys Gly Leu Asn Val Lys His Tyr Lys Ile Arg Lys Leu Asp Ser Gly

210 215 220

ggc ttc tac atc acc tcc cgc acc cag ttc aac agc ctg cag cag ctg 720

Gly Phe Tyr Ile Thr Ser Arg Thr Gln Phe Asn Ser Leu Gln Gln Leu

225 230 235 240

gtg gcc tac tac tcc aaa cac gcc gat ggc ctg tgc cac cgc ctc acc 768

Val Ala Tyr Tyr Ser Lys His Ala Asp Gly Leu Cys His Arg Leu Thr

245 250 255

acc gtg tgc ccc acg tcc aag ccg cag act cag ggc ctg gcc aag gat 816

Thr Val Cys Pro Thr Ser Lys Pro Gln Thr Gln Gly Leu Ala Lys Asp

260 265 270

gcc tgg gag atc cct cgg gag tcg ctg cgg ctg gag gtc aag ctg ggc 864

Ala Trp Glu Ile Pro Arg Glu Ser Leu Arg Leu Glu Val Lys Leu Gly

275 280 285

cag ggc tgc ttt ggc gag gtg tgg atg ggg acc tgg aac ggt acc acc 912

Gln Gly Cys Phe Gly Glu Val Trp Met Gly Thr Trp Asn Gly Thr Thr

290 295 300

agg gtg gcc atc aaa acc ctg aag cct ggc acg atg tct cca gag gcc 960

Arg Val Ala Ile Lys Thr Leu Lys Pro Gly Thr Met Ser Pro Glu Ala

305 310 315 320

ttc ctg cag gag gcc cag gtc atg aag aag ctg agg cat gag aag ctg 1008

Phe Leu Gln Glu Ala Gln Val Met Lys Lys Leu Arg His Glu Lys Leu

325 330 335

gtg cag ttg tat gct gtg gtt tca gag gag ccc att tac atc gtc acg 1056

Val Gln Leu Tyr Ala Val Val Ser Glu Glu Pro Ile Tyr Ile Val Thr

340 345 350

gag tac atg agc aag ggg agt ttg ctg gac ttt ctc aag ggg gag aca 1104

Glu Tyr Met Ser Lys Gly Ser Leu Leu Asp Phe Leu Lys Gly Glu Thr

355 360 365

ggc aag tac ctg cgg ctg cct cag ctg gtg gac atg gct gct cag atc 1152

Gly Lys Tyr Leu Arg Leu Pro Gln Leu Val Asp Met Ala Ala Gln Ile

370 375 380

gcc tca ggc atg gcg tac gtg gag cgg atg aac tac gtc cac cgg gac 1200

Ala Ser Gly Met Ala Tyr Val Glu Arg Met Asn Tyr Val His Arg Asp

385 390 395 400

ctt cgt gca gcc aac atc ctg gtg gga gag aac ctg gtg tgc aaa gtg 1248

Leu Arg Ala Ala Asn Ile Leu Val Gly Glu Asn Leu Val Cys Lys Val

405 410 415

gcc gac ttt ggg ctg gct cgg ctc att gaa gac aat gag tac acg gcg 1296

Ala Asp Phe Gly Leu Ala Arg Leu Ile Glu Asp Asn Glu Tyr Thr Ala

420 425 430

cgg caa ggt gcc aaa ttc ccc atc aag tgg acg gct cca gaa gct gcc 1344

Arg Gln Gly Ala Lys Phe Pro Ile Lys Trp Thr Ala Pro Glu Ala Ala

435 440 445

ctc tat ggc cgc ttc acc atc aag tcg gac gtg tgg tcc ttc ggg atc 1392

Leu Tyr Gly Arg Phe Thr Ile Lys Ser Asp Val Trp Ser Phe Gly Ile

450 455 460

ctg ctg act gag ctc acc aca aag gga cgg gtg ccc tac cct ggg atg 1440

Leu Leu Thr Glu Leu Thr Thr Lys Gly Arg Val Pro Tyr Pro Gly Met

465 470 475 480

gtg aac cgc gag gtg ctg gac cag gtg gag cgg ggc tac cgg atg ccc 1488

Val Asn Arg Glu Val Leu Asp Gln Val Glu Arg Gly Tyr Arg Met Pro

485 490 495

tgc ccg ccg gag tgt ccc gag tcc ctg cac gac ctc atg tgc cag tgc 1536

Cys Pro Pro Glu Cys Pro Glu Ser Leu His Asp Leu Met Cys Gln Cys

500 505 510

tgg cgg aag gag cct gag gag cgg ccc acc ttc gag tac ctg cag gcc 1584

Trp Arg Lys Glu Pro Glu Glu Arg Pro Thr Phe Glu Tyr Leu Gln Ala

515 520 525

ttc ctg gag gac tac ttc acg tcc acc gag ccc cag tac cag ccc ggg 1632

Phe Leu Glu Asp Tyr Phe Thr Ser Thr Glu Pro Gln Tyr Gln Pro Gly

530 535 540

gag aac ctc gat gac gac gac aag gaa ttc tcc cct ata cta ggt tat 1680

Glu Asn Leu Asp Asp Asp Asp Lys Glu Phe Ser ProIle Leu Gly Tyr

545 550 555 560

tgg aaa att aag ggc ctt gtg caa ccc act cga ctt ctt ttg gaa tat 1728

Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr

565 570 575

ctt gaa gaa aaa tat gaa gag cat ttg tat gag cgc gat gaa ggt gat 1776

Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp

580 585 590

aaa tgg cga aac aaa aag ttt gaa ttg ggt ttg gag ttt ccc aat ctt 1824

Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu

595 600 605

cct tat tat att gat ggt gat gtt aaa tta aca cag tct atg gcc atc 1872

Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile

610 615 620

ata cgt tat ata gct gac aag cac aac atg ttg ggt ggt tgt cca aaa 1920

Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys

625 630 635 640

gag cgt gca gag att tca atg ctt gaa gga gcg gtt ttg gat att aga 1968

Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg

645 650 655

tac ggt gtt tcg aga att gca tat agt aaa gac ttt gaa act ctc aaa 2016

Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys

660 665 670

gtt gat ttt ctt agc aag cta cct gaa atg ctg aaa atg ttc gaa gat 2064

Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp

675 680 685

cgt tta tgt cat aaa aca tat tta aat ggt gat cat gta acc cat cct 2112

Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro

690 695 700

gac ttc atg ttg tat gac gct ctt gat gtt gtt tta tac atg gac cca 2160

Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro

705 710 715 720

atg tgc ctg gat gcg ttc cca aaa tta gtt tgt ttt aaa aaa cgt att 2208

Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile

725 730 735

gaa gct atc cca caa att gat aag tac ttg aaa tcc agc aag tat ata 2256

Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile

740 745 750

gca tgg cct ttg cag ggc tgg caa gcc acg ttt ggt ggt ggc gac cat 2304

Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His

755 760 765

cct cca aaa tcg gat ctg gtt ccg cgt tag tag 2337

Pro Pro Lys Ser Asp Leu Val Pro Arg

770 775

<210>19

<211>777

<212>PRT

＜213〉artificial sequence (Artificial)

<220>

<223>Synthetic Construct

<400>19

Met Ala Arg Leu Asn Asn Leu Ala Thr Gln Leu Met Gly Ser Asn Lys

1 5 10 15

Ser Lys Pro Lys Asp Ala Ser Gln Arg Arg Arg Ser Leu Glu Pro Ala

20 25 30

Glu Asn Val His Gly Ala Gly Gly Gly Ala Phe Pro Ala Ser Gln Thr

35 40 45

Pro Ser Lys Pro Ala Ser Ala Asp Gly His Arg Gly Pro Ser Ala Ala

50 55 60

Phe Ala Pro Ala Ala Ala Glu Pro Lys Leu Phe Gly Gly Phe Asn Ser

65 70 75 80

Ser Asp Thr Val Thr Ser Pro Gln Arg Ala Gly Pro Leu Ala Gly Gly

85 90 95

Val Thr Thr Phe Val Ala Leu Tyr Asp Tyr Glu Ser Arg Thr Glu Thr

100 105 110

Asp Leu Ser Phe Lys Lys Gly Glu Arg Leu Gln Ile Val Asn Asn Thr

115 120 125

Glu Gly Asp Trp Trp Leu Ala His Ser Leu Ser Thr Gly Gln Thr Gly

130 135 140

Tyr Ile Pro Ser Asn Tyr Val Ala Pro Ser Asp Ser Ile Gln Ala Glu

145 150 155 160

Glu Trp Tyr Phe Gly Lys Ile Thr Arg Arg Glu Ser Glu Arg Leu Leu

165 170 175

Leu Asn Ala Glu Asn Pro Arg Gly Thr Phe Leu Val Arg Glu Ser Glu

180 185 190

Thr Thr Lys Gly Ala Tyr Cys Leu Ser Val Ser Asp Phe Asp Asn Ala

195 200 205

Lys Gly Leu Asn Val Lys His Tyr Lys Ile Arg Lys Leu Asp Ser Gly

210 215 220

Gly Phe Tyr Ile Thr Ser Arg Thr Gln Phe Asn Ser Leu Gln Gln Leu

225 230 235 240

Val Ala Tyr Tyr Ser Lys His Ala Asp Gly Leu Cys His Arg Leu Thr

245 250 255

Thr Val Cys Pro Thr Ser Lys Pro Gln Thr Gln Gly Leu Ala Lys Asp

260 265 270

Ala Trp Glu Ile Pro Arg Glu Ser Leu Arg Leu Glu Val Lys Leu Gly

275 280 285

Gln Gly Cys Phe Gly Glu Val Trp Met Gly Thr Trp Asn Gly Thr Thr

290 295 300

Arg Val Ala Ile Lys Thr Leu Lys Pro Gly Thr Met Ser Pro Glu Ala

305 310 315 320

Phe Leu Gln Glu Ala Gln Val Met Lys Lys Leu Arg His Glu Lys Leu

325 330 335

Val Gln Leu Tyr Ala Val Val Ser Glu Glu Pro Ile Tyr Ile Val Thr

340 345 350

Glu Tyr Met Ser Lys Gly Ser Leu Leu Asp Phe Leu Lys Gly Glu Thr

355 360 365

Gly Lys Tyr Leu Arg Leu Pro Gln Leu Val Asp Met Ala Ala Gln Ile

370 375 380

Ala Ser Gly Met Ala Tyr Val Glu Arg Met Asn Tyr Val His Arg Asp

385 390 395 400

Leu Arg Ala Ala Asn Ile Leu Val Gly Glu Asn Leu Val Cys Lys Val

405 410 415

Ala Asp Phe Gly Leu Ala Arg Leu Ile Glu Asp Asn Glu Tyr Thr Ala

420 425 430

Arg Gln Gly Ala Lys Phe Pro Ile Lys Trp Thr Ala Pro Glu Ala Ala

435 440 445

Leu Tyr Gly Arg Phe Thr Ile Lys Ser Asp Val Trp Ser Phe Gly Ile

450 455 460

Leu Leu Thr Glu Leu Thr Thr Lys Gly Arg Val Pro Tyr Pro Gly Met

465 470 475 480

Val Asn Arg Glu Val Leu Asp Gln Val Glu Arg Gly Tyr Arg Met Pro

485 490 495

Cys Pro Pro Glu Cys Pro Glu Ser Leu His Asp Leu Met Cys Gln Cys

500 505 510

Trp Arg Lys Glu Pro Glu Glu Arg Pro Thr Phe Glu Tyr Leu Gln Ala

515 520 525

Phe Leu Glu Asp Tyr Phe Thr Ser Thr Glu Pro Gln Tyr Gln Pro Gly

530 535 540

Glu Asn Leu Asp Asp Asp Asp Lys Glu Phe Ser Pro Ile Leu Gly Tyr

545 550 555 560

Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr

565 570 575

Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp

580 585 590

Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu

595 600 605

Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile

610 815 620

Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys

625 630 635 640

Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg

645 650 655

Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys

660 665 670

Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp

675 680 685

Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro

690 695 700

Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro

705 710 715 720

Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile

725 730 735

Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile

740 745 750

Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His

755 760 765

Pro Pro Lys Ser Asp Leu Val Pro Arg

770 775

<210>20

<211>669

<212>DNA

＜213〉people (human)

<220>

<221>CDS

<222>(1)..(669)

<400>20

tcc cct ata cta ggt tat tgg aaa att aag ggc ctt gtg caa ccc act 48

Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr

1 5 10 15

cga ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg tat 96

Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr

20 25 30

gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg ggt 144

Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly

35 40 45

ttg gag ttt ccc aat ctt cct tat tat att gat ggt gat gtt aaa tta 192

Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu

50 55 60

aca cag tct atg gcc atc ata cgt tat ata gct gac aag cac aac atg 240

Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met

65 70 75 80

ttg ggt ggt tgt cca aaa gag cgt gca gag att tca atg ctt gaa gga 288

Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly

85 90 95

gcg gtt ttg gat att aga tac ggt gtt tcg aga att gca tat agt aaa 336

Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys

100 105 110

gac ttt gaa act ctc aaa gtt gat ttt ctt agc aag cta cct gaa atg 384

Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met

115 120 125

ctg aaa atg ttc gaa gat cgt tta tgt cat aaa aca tat tta aat ggt 432

Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly

130 135 140

gat cat gta acc cat cct gac ttc atg ttg tat gac gct ctt gat gtt 480

Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val

145 150 155 160

gtt tta tac atg gac cca atg tgc ctg gat gcg ttc cca aaa tta gtt 528

Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val

165 170 175

tgt ttt aaa aaa cgt att gaa gct atc cca caa att gat aag tac ttg 576

Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu

180 185 190

aaa tcc agc aag tat ata gca tgg cct ttg cag ggc tgg caa gcc acg 624

Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr

195 200 205

ttt ggt ggt ggc gac cat cct cca aaa tcg gat ctg gtt ccg cgt 669

Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg

210 215 220

<210>21

<211>223

<212>PRT

＜213〉people (human)

<400>21

Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr

1 5 10 15

Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr

20 25 30

Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly

35 40 45

Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu

50 55 60

Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met

65 70 75 80

Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly

85 90 95

Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys

100 105 110

Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met

115 120 125

Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly

130 135 140

Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val

145 150 155 160

Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val

165 170 175

Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu

180 185 190

Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr

195 200 205

Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg

210 215 220

<210>22

<211>60

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P5

<400>22

ctgtacgtaa tggctagatt gaacaacttg gctactcaat tgatgggtag caacaagagc 60

<210>23

<211>45

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P6

<400>23

cgagaattcc ttgtcgtcgt catcgaggtt ctccccgggc tggta 45

<210>24

<211>30

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P7

<400>24

ccggaattct cccctatact aggttattgg 30

<210>25

<211>36

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

＜223〉primer P8

<400>25

caacctaggc tactaacgcg gaaccagatc cgattt 36

Claims (13)

1. the cDNA of a recombination tyrosine kinase of expressing in pichia spp (Pichia pastoris) organoid, it is the base sequence shown in the SEQ ID No.4 in the sequence table.

2. the cDNA nucleotide sequence of the derivative fusion albumen of a recombination tyrosine kinase, it is the nucleotide sequence that the cDNA of the cDNA of labelled protein and Tyrosylprotein kinase as claimed in claim 1 merges.

3. the cDNA nucleotide sequence of derivative fusion albumen as claimed in claim 2 is characterized in that described labelled protein is selected from green, yellow and red fluorescent protein.

4. the cDNA nucleotide sequence of derivative fusion albumen as claimed in claim 2, it is characterized in that containing between labelled protein and the Tyrosylprotein kinase proteolytic enzyme restriction enzyme site, described proteolytic enzyme restriction enzyme site is selected from zymoplasm site, enteropeptidase site, Xa factor site and HRV 3C site.

5. the cDNA nucleotide sequence of derivative fusion albumen as claimed in claim 4, it is characterized in that this labelled protein is that green fluorescent protein, this restriction enzyme site are the zymoplasm site, this derivative fusion albumen has the 15-629 amino acids sequence shown in the SEQ ID No.7, and the cDNA nucleotide sequence of described this derivative fusion albumen of coding is shown in the 43-1887 position nucleotide sequence among the SEQ ID No.6 in the sequence table.

6. the cDNA nucleotide sequence of derivative fusion albumen as claimed in claim 2, the cDNA nucleotide sequence that it is characterized in that this fusion rotein also comprises the cDNA nucleotide sequence of coding purification tag albumen or peptide, and this purification tag albumen or peptide are selected from His-tag, GST Tag, S Tag, T7Tag and CBD Tag.

7. the cDNA nucleotide sequence of derivative fusion albumen as claimed in claim 6, it is characterized in that this purification tag albumen or peptide are His-tag, described derivative fusion albumen has the whole or 3-629 amino acids sequence shown in the SEQ ID No.7, and the cDNA nucleotide sequence of described this derivative fusion albumen of coding is shown in the whole or 7-1887 bit base sequence of SEQ ID No.6 in the sequence table.

8. recombination tyrosine kinase of expressing in pichia spp (Pichia pastoris) organoid, the aminoacid sequence that it is characterized in that this recombination tyrosine kinase is shown in 261-629 amino acids sequence among the SEQ ID No.7 in the sequence table.

9. recombinant expression vector, it comprises one of following nucleotide sequences:

1) the cDNA nucleotide sequence of recombination tyrosine kinase as claimed in claim 1;

2) as the cDNA nucleotide sequence of each described derivative fusion albumen of claim 2～7.

10. recombinant expression vector as claimed in claim 9 is characterized in that expression vector in this recombinant expression vector selects the pPIC that is suitable for pichia spp derive plasmid pPIC3.5K or pPIC9K for use.

11. a transformant that contains claim 9 or 10 described recombinant expression vectors, wherein the host is pichia spp (Pichia pastoris).

12. transformant as claimed in claim 11 is characterized in that described pichia spp is pichia spp (Pichiapastoris) GS115 or KM71 bacterial strain.

13. the preparation method of a recombination tyrosine kinase, it comprises the following steps: to cultivate transformant as claimed in claim 11, then with the culture separation and purification.

Images