CN1274727A - New human protein and its code sequence, preparation and application - Google Patents

New human protein and its code sequence, preparation and application Download PDF

Info

Publication number
CN1274727A
CN1274727A CN 99107070 CN99107070A CN1274727A CN 1274727 A CN1274727 A CN 1274727A CN 99107070 CN99107070 CN 99107070 CN 99107070 A CN99107070 A CN 99107070A CN 1274727 A CN1274727 A CN 1274727A
Authority
CN
China
Prior art keywords
sequence
polypeptide
seq
sar1
nucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 99107070
Other languages
Chinese (zh)
Inventor
余龙
张宏来
赵勇
傅强
赵寿元
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Original Assignee
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University filed Critical Fudan University
Priority to CN 99107070 priority Critical patent/CN1274727A/en
Publication of CN1274727A publication Critical patent/CN1274727A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides human SARI encoded cDNA sequence and the encoded product of the sequence is a homologue of Chinese hamster SARI protein. The present invention also relates to the polypeptide encoded by the nucleotide sequence and the application and production process of the polynucleotide and polypeptide.

Description

A kind of new people's albumen and encoding sequence thereof, and method for making and purposes
The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the cDNA sequence of the people SAR1 that the present invention relates to encode, this gene encoding production is the proteic homologue of Chinese hamster SAR1.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.
Secretory protein in the eukaryote is after synthesizing in endoplasmic reticulum, through golgi body transporte to cells surface, thereby to secrete to born of the same parents.And this transportation is finished by vesica participation mediation, thereby is also referred to as the vesica transportation.In the research to this transportation, an important discovery is that many GTP enzymes have participated in this process.These GTP enzymes comprise Rab/YPT/SEC4, Sar1, Arf, G α β γ(Goudand McCaffrey, Curr.Opin.Cell Biol.1991,3:626-633 such as gene family; Barr et al.1992, Trends CellBiol.2:91-94; Bomsel and Mostov, Mol.Biol.Cell.1992,1317-1328; Pfeffer, TrendsCell Biol.1992,2:41-46; Zerial and Stenmark, Curr.Biol.1993,5:613-620).They are considered to and may have participated in transport vesicle sprouted, locatees processes such as (targeting), fusion as regulatory molecule.
In Mammals, the Rab albumen of having found has 40 approximately, and different albumen may play a role in the different step of different film bubble transport pathway.For example, Rab8 is proved to be and has mediated the transportation of film bubble (J.Cell.Biol.1993,123 (1): 35-45) of being distinguished basad LHA in the polar mdck cell by trans-Golgi network (TGN); Rab1 relevant with vesica transportation from endoplasmic reticulum to golgi body cis face and subsequently from golgi body cis face to middle golgi body (J.Cell.Biol.1991,115,31-43); Rab4 and Rab5 have then participated in the fusion process of endosome, and have been considered to control restricted step (Cell, 1990,62, the 317-329 of endocytosis process; Proc.Natl.Acad.Sci.USA 1991,88,6313-6317; Cell, 1992,70,729-740; Cell, 1991,64,915-925; Cell, 1992,70,715-728).
ARF and ARL have constituted a big subfamily equally, and mammiferous ARF family has six members at least, and promptly ARF1-6 has then found three members at least in yeast.ARF family has also comprised highly homology of some and ARF in addition, but lacks the active albumen of Toxins,exo-, cholera cofactor, and they are collectively referred to as ARL (ARF sample albumen, ARF-like protein).The function of ARF may relate to the protein transportation (J.Biol.Chem.1992 from endoplasmic reticulum to golgi body cis face, 267,13053-13061), golgi body cis face in-plant transportation (Cell, 1992,70,69-79), the exocytosis of vesica (FEBS Lett, 1993,121-124) with the transportation of nuclear intracellular vesicle (Nature, 1992,358, aspect such as 512-514).
SAR1 family then is the relevant gene of another kind of and vesica transportation.The product S arlp of SAR1 is to yeast (Oka, T., et al.J.Cell.Biol.1991,114:671-679; Oka, T., et al J.Cell.Biol.1994,124:425-434), mammalian cell (Kuge, et al.J.Cell.Biol.125:51-65) and vegetable cell (Takeuchi, M. O.,, et al.1998,39 (6): 590-599) formation of transport vesicle plays an important role in the endoplasmic reticulum.
SAR1 (d ' Enfert, C.et al.EMBO J.1992,11,4205-4211; Kuge, O., J.Cell.Biol.1992 125:51-65) is found in yeast at first, and it is the gtp binding protein of a 21Kd.In recent years, along with going deep into of research, in many species of microorganism, animal, plant, fungi, all found the SAR1 gene, particularly some famous model animalss, as all having found the SAR1 gene in yeast saccharomyces cerevisiae (sp|P20606), Arabidopis thaliana (sp|O04834), nematode (sp|Q23445) and the mouse (sp|P36536).
SAR1 is usually classified in the RAS supergene family, yet its member and other RAS family protein only have slight homology, and in addition, it also lacks general RAS albumen at serine residue that carboxyl terminal had.These all point out SAR1 is the comparatively special RAS family member of a class.
Though the research to SAR1 in multiple species is very extensive, yet this gene in the people is not seen in report as yet.
An object of the present invention is to provide a kind of new polynucleotide, a newcomer of this polynucleotide encoding SAR1 family, SAR1 family member of the present invention is named as people SAR1.
Another object of the present invention provides a kind of new people's SAR1 family member, and this albumen is named as the SAR-1.
A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new people's SAR1 polypeptide.
The present invention also provides this people's the SAR1 nucleotide sequence and the application of polypeptide.
In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the active polypeptide of SAR-1, shows at least 70% homology from the nucleotides sequence of Nucleotide 41-637 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 41-637 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 41-637 position.
In another aspect of this invention, provide a kind of isolating SAR-1's polypeptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.
In another aspect of this invention, provide a kind of described carrier transformed host cells.
In another aspect of this invention, the method that provides a kind of generation to have the active polypeptide of SAR-1, this method comprises:
(a) nucleotide sequence that coding is had an active polypeptide of SAR-1 operationally is connected in expression regulation sequence, form SAR-1's expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 41-637 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form SAR-1's reconstitution cell;
(c) under the condition that is fit to expressing human SAR1 protein polypeptide, the reconstitution cell in the culturing step (b);
(d) isolate and have the active polypeptide of SAR-1.
In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 683 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 41-637 position Nucleotide.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, refer to encode has the nucleotide sequence of the active polypeptide of SAR-1 to term " SAR-1's (or polypeptide) encoding sequence ", as 41-637 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 41-637 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 41-637 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with among the SEQ ID NO.3 from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 41-637 position.Also term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 41-637 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises encoding to have variant form with proteic, the SEQ ID NO.4 sequence of people SAR1 identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.
In the present invention, term " SAR-1's polypeptide " refers to have the active SEQ IDNO.4 of SAR-1 polypeptide of sequence.This term also comprises having and variant form people SAR1 identical function, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises SAR-1's active fragments and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people SAR1 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people SAR1 polypeptide to obtain.The present invention also provides other polypeptide, as comprises people SAR1 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people SAR1 polypeptide.Usually, this fragment have people SAR1 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of SAR-1 or polypeptide.The difference of these analogues and natural human SAR1 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people SAR1 conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID No.4, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
Initial residue Representational replacement The preferred replacement
Ala(A) Val;Leu;Ile Val
Arg(R) Lys;Gln;Asn Lys
Asn(N) Gln;His;Lys;Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro;Ala Ala
His(H) Asn;Gln;Lys;Arg Arg
Ile(I) Leu;Val;Met;Ala;Phe Leu
Leu(L) Ile;Val;Met;Ala;Phe Ile
Lys(K) Arg;Gln;Asn Arg
Met(M) Leu;Phe;Ile Leu
Phe(F) Leu;Val;Ile;Ala;Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr;Phe Tyr
Tyr(Y) Trp;Phe;Thr;Ser Phe
Val(V) Ile;Leu;Met;Phe;Ala Leu
The present invention also comprises people SAR1 polypeptid coding sequence and segmental antisense sequences thereof.This antisense sequences can be used for suppressing the expression of people SAR1 in the cell.
The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people SAR1 polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people SAR1.
The present invention also comprises the method that detects people SAR1 nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of people SAR1 polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.
In the present invention, can select various carrier known in the art for use, as commercially available carrier.Such as, select commercially available carrier for use, the nucleotide sequence with code book invention polypeptide operationally is connected in expression regulation sequence then, can form protein expression vector.
As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
On the other hand, the present invention also comprises people SAR1 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people SAR1 gene product or fragment.Preferably, refer to that those can combine with people SAR1 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress SAR-1's molecule, comprise that also those do not influence the antibody of SAR-1's function.The present invention also comprise those can with modify or without the people SAR1 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) 2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people SAR1 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human SAR1 or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people SAR1 function and the antibody that does not influence people SAR1 function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people SAR1 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people SAR1 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
People SAR1 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
Among the embodiment in the present invention, the cDNA nucleotide sequence of people SAR1 is so to obtain, with people's kidney λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer--A:5 '-GATTGCGTTCCCTCCAGTCGCAG-3 ' is a forward primer, oligonucleotide B:5 '-CTGAGTAAGCCTGAACGTTGAGACC-3 ' is a reverse primer, carries out PCR.Obtain the full length cDNA sequence of SEQ ID NO.3 after the order-checking.
Because SAR1 of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.
In the accompanying drawings,
Fig. 1 is the homology comparison diagram of the aminoacid sequence of people SAR1 of the present invention and hamster SAR1.Wherein, identical amino acid marks with the amino acid monocase between two sequences, and similar amino acid marks with "+".Similar amino acid is: A, S, T; D, E; N, Q; R, K; I, L, M, V; F, Y, W.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone and the mensuration of the cDNA sequence of people SAR1
1. primer amplification
With people's kidney λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer--A:5 '-GATTGCGTTCCCTCCAGTCGCAG-3 ' (SEQ ID NO:1) is a forward primer, oligonucleotide B:5 '-CTGAGTAAGCCTGAACGTTGAGACC-3 ' (SEQ ID NO:2) is a reverse primer, carries out PCR.The PCR condition of A/B be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 1 minute, 66 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.Electrophoresis detection obtains the purpose fragment of about 700bp.
2.PCR the order-checking of product
Above-mentioned pcr amplification product AB is connected with pGEM-T carrier (Promega), and transformed into escherichia coli JM103 extracts plasmid with QIAprep Plasmid test kit (QIAGEN), and universal primer F1, R1 on the plasmid are used respectively 32Behind the P mark, with the order-checking of PCR method, with computer software splicing order, obtain full length cDNA sequence at last, be total to 683bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 41-637 position Nucleotide.
Derive the aminoacid sequence of people SAR1 according to the full length cDNA sequence that obtains, totally 198 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.
Embodiment 2
Homology relatively reaches structural analysis
Full length sequence and proteins encoded thereof with cDNA of the present invention, in Non-redundant GenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDS translations+PDB+SwissProt+Spupdate+PIR database, carry out nucleic acid and albumen homology retrieval with blast program.Found that the SAR1 and the proteins encoded thereof of they and multiple species (as mouse etc.) have homology widely, particularly the amino acid consistence with the SAR1 of China grey mouse has reached 98% (Fig. 1).With SMART (SimpleModular Arhitecture Rsearch Tool) cDNA encoded protein matter sequence of the present invention is carried out domain analyses, found that it has a SAR structural domain.Simultaneously sequential analysis of protein is shown the characteristic motif that has a SAR1 family in proteinic 171-198 position with Prosite software again.In known all SAR1 family members, all have the sequence that meets following feature:
RX (L/I/V/M) EVFMCS (L/I/V/M) 2(F/I) in XW (L/I/V/M) the XQY formula, X represents arbitrary amino acid to X (K/R/Q) XGYXE (A/G); Any one amino acid among expression L, I, V, the M such as (L/I/V/M), subscript 2 expressions repeat 2 times.
In protein sequence of the present invention, the sequence that meets above-mentioned pattern is 171RPLEVFMCSVLKRQGYGEGFRWMAQY 196In addition, in protein sequence of the present invention, also found the motif of an ATP-GTP binding site, promptly 32GLDNAGKT 39, it meets general formula (A/G) X of this motif 4GK (S/T).More than analyzing all supports cDNA sequence of the present invention and encoded protein thereof should belong to SAR1 family.According to the structures shape function, the Biological Principles that the structural similitude function is relevant can be inferred biological function of the present invention from known SAR1 family member's function.
Studies show that of past 10 years, SAR1 albumen has been brought into play keying action in the formation of the transport vesicle of endoplasmic reticulum origin, and to gorky's intravital vesicle transportation possibility unimportant (Nakano and Muramatsu, J.Cell Biol.1989,2677-2691; Oka and Nakano, J.Cell Biol.1994,124:425-434; Kuge, J.Cell Biol.1994,125 (1): 51-65).After Sar1p becomes activated form in conjunction with GTP, with coat protein (coat protein) (COPII:Sec23p/Sec24p and Sec13p/Sec31p mixture; Barlowe, C., et al.Cell 77:895-907) is gathered in the endoplasmic reticulum surface jointly and promotes sprouting of vesica.After the vesica of COPII bag quilt generated, Sarlp brought into play its GTP enzymic activity, becomes GDP bonded inactive form, and discharges from the film surface with other coating protein.This makes other membranins expose, thereby makes vesica become possibility to the location and the fusion of golgi body from the result of the dispose procedure on film surface.In the GTP of Sarlp enzyme circulation, Sec12p and Sec23p are as guanine nucleotide exchange factor and gtpase activating protein play an important role (Nakato, et al., J.Cell.Biol.1988,107:851-803; Barlowe and Schekman, Nature, 365:347-349; Yoshihisa, et al., Science, 259:1466-1468).
Utilize the Sar1 mutant to the also existing certain progress of its functional study.Nakano etc. (Nakano, A., etal., J.Biochem.1994,116 (2): 243-247) reported the temperature sensitive defective type of two routine yeast Sar1, and four routine cytostatic mutants.The said mutation gene is loaded on the growth-inhibiting that plasmid transfered cell overexpression can cause cell.(Yamanushi such as Yamanushi, T., et al, J.Biochem.1996,120:452-458) reported the temperature sensitive mutant of three routine yeast Sar1 equally, these mutants have all shown from the defective of endoplasmic reticulum to the vesicle transportation of golgi body, gathering with endoplasmic reticulum simultaneously at sensitive temperature.In the plant, Takeuchi etc. study the Sar1 in tobacco and the Arabidopis thaliana, find that they can complementary zymic Sar1 defective type, and the expression of the mutant of the two (NtSAR1H74L and AtSAR1N129I) in yeast cell has dominant negative effect.
People SAR1 of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor SAR1 can also merge with other members of this family or exchange fragment, to produce new albumen.For example the C end of the C of inventor SAR1 end with the SAR1 of other species exchanged, to produce the albumen that new activity is higher or have new features.
At the antibody of inventor SAR1, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).
In addition, inventor SAR1 nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people SAR1 or the overexpression that suppresses people SAR1.SAR-1 of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people SAR1 disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.
Embodiment 3
The expression of people SAR1 in intestinal bacteria
In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people SAR1 use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.5 and 6) of 3 ' end increase, obtain people SAR1 cDNA as inserting fragment.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5 '-TCAGGGATCCATGTCCTTCA TATTTGATT-3 ' (SEQ ID NO.5), this primer contains the restriction enzyme site of BamHI restriction enzyme, is 19 Nucleotide of the people SAR1 encoding sequence that begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5 '-TTGGAAGCTTTTAATCAATGTACTGTGCC-3 ' (SEQ ID NO.6), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the people SAR1 of HindIII restriction enzyme.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.
With BamHI and HindIII digestion pQE-9 carrier and insertion fragment, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kan r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid, the cDNA fragment of sequence verification people SAR1 has correctly been inserted carrier.
Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD@600) when the 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved people SAR1 from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out people SAR1 from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein from nickel-chelate column.Protein behind the purifying is incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 22KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.
Embodiment 4
The expression of people SAR1 in eukaryotic cell (Chinese hamster ovary celI strain)
In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people SAR1 use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.5 and 6) of 3 ' end increase, obtain people SAR1 cDNA as inserting fragment.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5′-TCAGAAGCTTATGTCCTTCA?TATTTGATT-3′(SEQ?ID?NO.7)
This primer contains the restriction enzyme site of HindIII restriction enzyme, is 19 Nucleotide of the people SAR1 encoding sequence that begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5’-TTGGGGATCCTTAATCAATGTACTGTGCC-3’(SEQ?ID?NO.8)
This primer contains the part encoding sequence of the restriction enzyme site of BamHI restriction enzyme, translation termination and people SAR1.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp rAnd Neo r), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.
With HindIII and BamHI digestion pcDNA3 carrier and insertion fragment, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid, the cDNA fragment of sequence verification people SAR1 has correctly been inserted carrier.
The plasmid transfection Chinese hamster ovary celI is to adopt lipofection, carries out with Lipofectin (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mMTris HCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mMTris á HCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTris á HCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 22KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.
Embodiment 5
Preparation antibody
The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people SAR1 gene translation product with it.Found that antibody can precipitate with albumen of the present invention specifically.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table (1) general information: (i) applicant: Fudan University is denomination of invention (ii): a kind of new people's albumen and encoding sequence thereof, and (iii) sequence number of method for making and purposes: information (i) sequence signature of 8 (2) SEQ ID NO.1
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.1:GATTGCGTTCCCTCCAGTCGCAG 23 (2) SEQ ID NO.2
(A) length: 25 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:2:CTGAGTAAGCCTGAACGTTGAGACC 25 (2) SEQ ID NO.3: (i) sequence signature:
(A) length: 683bp
(B) type: nucleic acid
(C) chain: strand
( D ) : ( ii ) :cDNA ( xi ) :SEQ ID NO.3:GATTGCGTTC CCTCCAGTCG CAGCCCTATC AGATTTGGAT ATGTCCTTCA TATTTGATTG 60GATTTACAGT GGTTTCAGCA GTGTGCTACA GTTTTTAGGA TTATATAAGA AAACTGGTAA 120ACTGGTATTT CTTGGATTGG ATAATGCAGG AAAAACAACA TTGCTACACA TGCTAAAAGA 180TGACAGACTT GGACAACATG TCCCAACATT ACATCCCACT TCCGAAGAAC TGACCATTGC 240TGGCATGACG TTTACAACTT TTGATCTGGG TGGACATGTT CAAGCTCGAA GAGTGTGGAA 300AAACTACCTT CCTGCTATCA ATGGCATTGT ATTTCTGGTG GATTGTGCAG ACCACGAAAG 360GCTGTTAGAG TCAAAAGAAG AACTTGATTC ACTAATGACA GATGAAACCA TTGCTAATGT 420GCCTATACTG ATTCTTGGGA ATAAGATCGA CAGACCTGAA GCCATCAGTG AAGAGAGGTT 480GCGAGAGATG TTTGGTTTAT ATGGTCAGAC AACAGGAAAG GGGAGTATAT CTCTGAAAGA 540ACTGAATGCC CGACCCTTAG AAGTTTTCAT GTGTAGTGTG CTCAAAAGAC AAGGTTACGG 600AGAAGGCTTC CGCTGGATGG CACAGTACAT TGATTAACAC AAACTCACAT TGGTTCCAGG 660TCTCAACGTT CAGGCTTACT CAG 683 ( 2 ) SEQ ID NO.4: ( i ) :
(A) length: 198 amino acid
(B) type: amino acid
( D ) : ( ii ) : ( xi ) :SEQ ID NO.4:Met Ser Phe Ile Phe Asp Trp Ile Tyr Ser Gly Phe Ser Ser Val 15Leu Gln Phe Leu Gly Leu Tyr Lys Lys Thr Gly Lys Leu Val Phe 30Leu Gly Leu Asp Asn Ala Gly Lys Thr Thr Leu Leu His Met Leu 45Lys Asp Asp Arg Leu Gly Gln His Val Pro Thr Leu His Pro Thr 60Ser Glu Glu Leu Thr Ile Ala Gly Met Thr Phe Thr Thr Phe Asp 75Leu Gly Gly His Val Gln Ala Arg Arg Val Trp Lys Asn Tyr Leu 90Pro Ala Ile Asn Gly Ile Val Phe Leu Val Asp Cys Ala Asp His 105Glu Arg Leu Leu Glu Ser Lys Glu Glu Leu Asp Ser Leu Met Thr 120Asp Glu Thr Ile Ala Asn Val Pro Ile Leu Ile Leu Gly Asn Lys 135Ile Asp Arg Pro Glu Ala Ile Ser Glu Glu Arg Leu Arg Glu Met 150Phe Gly Leu Tyr Gly Gln Thr Thr Gly Lys Gly Ser Ile Ser Leu 165Lys Glu Leu Asn Ala Arg Pro Leu Glu Val Phe Met Cys Ser Val 180Leu Lys Arg Gln Gly Tyr Gly Glu Gly Phe Arg Trp Met Ala Gln 195Tyr Ile Asp 198 ( 2 ) SEQ ID NO.5 ( i )
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.5:TCAGGGATCCATGTCCTTCATATTTGATT 29 (2) SEQ ID NO.6
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.6:TTGGAAGCTTTTAATCAATGTACTGTGCC 29 (2) SEQ ID NO.7
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.7:TCAGAAGCTTATGTCCTTCATATTTGATT 29 (2) SEQ ID NO.8
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO.8:TTGGGGATCCTTAATCAATGTACTGTGCC 29

Claims (10)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the active polypeptide of SAR-1,
Show at least 70% homology from the nucleotides sequence of Nucleotide 41-637 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps
Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 41-637 position.
2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.
3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 41-637 position.
4. isolating SAR-1's polypeptide is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.
5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
6. a carrier is characterized in that, it contains the described DNA of claim 1.
7. one kind with the described carrier transformed host cells of claim 6.
8. a generation has the method for the active polypeptide of SAR-1, it is characterized in that this method comprises:
(a) nucleotide sequence that coding is had an active polypeptide of SAR-1 operationally is connected in expression regulation sequence, form SAR-1's expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 41-637 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form SAR-1's reconstitution cell;
(c) under the condition that is fit to expressing human SAR1 protein polypeptide, the reconstitution cell in the culturing step (b);
(d) isolate and have the active polypeptide of SAR-1.
9. energy and the described SAR-1's polypeptid specificity of claim 4 bonded antibody.
10. a probe molecule is characterized in that, it contains 8-100 continuous nucleotide in the described dna molecular of claim 1.
CN 99107070 1999-05-25 1999-05-25 New human protein and its code sequence, preparation and application Pending CN1274727A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 99107070 CN1274727A (en) 1999-05-25 1999-05-25 New human protein and its code sequence, preparation and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 99107070 CN1274727A (en) 1999-05-25 1999-05-25 New human protein and its code sequence, preparation and application

Publications (1)

Publication Number Publication Date
CN1274727A true CN1274727A (en) 2000-11-29

Family

ID=5272616

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 99107070 Pending CN1274727A (en) 1999-05-25 1999-05-25 New human protein and its code sequence, preparation and application

Country Status (1)

Country Link
CN (1) CN1274727A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022170694A1 (en) * 2021-02-09 2022-08-18 佛山汉腾生物科技有限公司 Method for improving expression quantity of recombinant protein

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022170694A1 (en) * 2021-02-09 2022-08-18 佛山汉腾生物科技有限公司 Method for improving expression quantity of recombinant protein

Similar Documents

Publication Publication Date Title
CN1128878C (en) Coding sequence of human methionine sulfoxide reductase, its encoded polypeptide and its preparing process
CN1274727A (en) New human protein and its code sequence, preparation and application
CN1132939C (en) Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process
CN1277259A (en) Homologous protein of late embryo ample-protein and its code sequence
CN1125177C (en) Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process
CN1125178C (en) Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process
CN1249347A (en) Human calcineurin regulatory subunit, its coding sequence and its preparing process
CN1261104A (en) Human oxido-reductase subunit and its coding sequence, preparing process and application
CN1277260A (en) Human actin related protein subunit and its code sequence
CN1257927A (en) Human protein and its coding sequence, preparing process and usage
CN1249345A (en) Human gene coding sequence, its encoded polypeptide and its preparing process
CN1287169A (en) New human G protein protomer and its code sequence
CN1274755A (en) Human protein kinase inhibitor II and its code sequence, preparation process and application
CN1249342A (en) Human phosphatidyl ethanolamine-N-methyltransferase, its coding sequence and its preparing process
CN1274728A (en) New human protein and its code sequence, preparation and application
CN1246532A (en) Coding sequence of human heat shock associated protein, its encoded polypeptide and its preparing process
CN1261102A (en) Human spindle protein and its coding sequence, preparing process and application
CN1264739A (en) Human protein and its coding sequence, preparing process and application
CN1253180A (en) Specific protein of human neuroendocrine, coding sequence and its preparating process and application
CN1275621A (en) Human lambda crystallin and its coding sequence, preparation process and use
CN1251860A (en) Human gene sequence and its coded polypeptide, preparing process and application
CN1431306A (en) Derivatization growth factors 5 of human liver cancer, its coding sequence, preparing method and usage
CN1249341A (en) Human protein kinase C arrestin coding sequence, its encoded polypeptide and its preparing process
CN1252448A (en) Human actin related protein gene and encoded polypeptide and preparation and application
CN1278557A (en) Human protein kinase inhibitor gamma and its code sequence, preparation and use

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication