CN1132939C - Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process - Google Patents
Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process Download PDFInfo
- Publication number
- CN1132939C CN1132939C CN 98111038 CN98111038A CN1132939C CN 1132939 C CN1132939 C CN 1132939C CN 98111038 CN98111038 CN 98111038 CN 98111038 A CN98111038 A CN 98111038A CN 1132939 C CN1132939 C CN 1132939C
- Authority
- CN
- China
- Prior art keywords
- ggpps
- sequence
- polypeptide
- seq
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a new human polynucleotide, more specifically a coding sequence of human GGPPS (geranyl geranyl disphosphate synthase. A polypeptide of the present invention is the homolog of a fruit fly GGPPS gene. The present invention also relates to the polypeptide coded by the polynucleotides, the application of the polynucleotides and the polypeptide and a method for producing the polynucleotides and the polypeptide.
Description
The present invention relates to a kind of new people's polynucleotide, by the polypeptide of this polynucleotide encoding, the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.More particularly, the present invention relates to a newcomer in geranyl geranyl pyrophosphate synthetase (Geranylgeranyl diphosphate synthase the abbreviates GGPPS as) family.Polypeptide of the present invention is the homologue of fruit bat GGPPS gene.
GGPPS is a gene of finding in the capsicum, and it is studied more in plant.Then, it is found that not only has the GGPPS gene in plant, have the GGPPS gene in the animal too, and it is high expression level in the brain of higher animal, and relevant with proteic isoprenylation effect in the brain.This expression of gene is not normal, may cause diseases such as degenerative brain disorder.People such as Kuntz at first cloned from the capsicum cell cdna library in 1992 and obtain a GGPPS gene (Plant J 2:25-34,1992).The same year, people such as Math also from erwinia belongs to, separate obtained the GGPPS gene (Proc Natl Acad Sci USA 1992,89:6761-6764).Subsequently, people separate from the ox brain again and have obtained the GGPPS gene (J.Nurochem 1995, and 2299-2306), the GGPPS in this gene and capsicum and the erwinia genus has higher homology.These three genes are considered to relevant with proteic isoprenylation process.Recently, fruit bat GGPPS gene is also delivered.But before the present invention, do not find or deliver remarkable GGPPS gene.
An object of the present invention is to provide a kind of new polynucleotide sequence, the people's of this polynucleotide sequence coding and fruit bat GGPPS dna homolog gene, people of the present invention is named as GGPPS with fruit bat GGPPS homologous gene.
Another object of the present invention provides a kind of new and albumen fruit bat GGPPS homologous people, names the GGPPS into the people.
A further object of the present invention provides a kind of recombinant technology that utilizes and produces the proteic method of described GGPPS.
The invention still further relates to the application of this people GGPPS encoding sequence and polypeptide.
In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people GGPPS protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 54-953 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 54-953 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has the sequence of Nucleotide 54-953 position among the SEQ ID NO.3.
In another aspect of this invention, provide a kind of isolating GGPPS protein polypeptide, it comprises: have polypeptide or its active fragments of SEQID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.
In another aspect of this invention, provide a kind of described carrier transformed host cells.
In another aspect of this invention, the method that provides a kind of generation to have the polypeptide of GGPPS protein-active, this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of GGPPS protein-active operationally is connected in expression regulation sequence, form the GGPPS protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 54-953 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of GGPPS;
(c) be fit to express under the condition of GGPPS protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with GGPPS protein-active.
In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 1218 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 54-953 position Nucleotide.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, term " GGPPS albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with GGPPS protein-active is as 54-953 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 54-953 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 54-953 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprise can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 54-953 position.More preferably, be included under the highly tight condition can with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 54-953 position.In addition this term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 54-953 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises encoding to have variant form with proteic, the SEQ ID NO.3 sequence of people GGPPS identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.
In the present invention, term " GGPPS protein polypeptide " refers to have the SEQ ID NO.4 polypeptide of sequence of GGPPS protein-active.This term also comprises having and the variant form GGPPS identical function, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of GGPPS and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of GGPPS DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-GGPPS polypeptide to obtain.The present invention also provides other polypeptide, as comprises GGPPS polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention also comprises the soluble fragments of GGPPS polypeptide.Usually, this fragment have the GGPPS peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of GGPPS albumen or polypeptide.The difference of these analogues and natural GGPPS polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
The present invention also comprises the antisense sequences of GGPPS polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of GGPPS in the cell.
The present invention also comprises a kind of probe molecule, and this molecule has 8-100 of GGPPS polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the GGPPS that encodes.
The present invention also comprises the method that detects the GGPPS nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of GGPPS polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 20-50 Nucleotide.
In the present invention, can select various carrier known in the art for use, as commercially available carrier.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
On the other hand, the present invention also comprises GGPPSDNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into GGPPS gene product or fragment.Preferably, refer to that those can combine with GGPPS gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of GGPPS, comprise that also those do not influence the antibody of GGPPS protein function.The present invention also comprise those can with modify or without the GGPPS gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the GGPPS gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing GGPPS or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block the GGPPS function and the antibody that does not influence the GGPPS function.Each antibody-like of the present invention can utilize the fragment or the functional zone of GGPPS gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of GGPPS gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
In one embodiment of the invention, polynucleotide total length of the present invention is 1218 Nucleotide, and its detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 54-953 position Nucleotide.These polynucleotide are so to obtain, with human brain λ gt11cDNA library (available from Clontech company) is template, synthetic forward primer A1:5 '-GCGTGAAAAGTCGTGATATCATCG-3 ' and reverse primer A2:5 '-TTGGTGGCAATGTCCTGTCACTGC-3 ', carry out PCR, obtain the purpose fragment of 1218bp (A1A2).Obtain the full length cDNA sequence of SEQ ID NO:3 after the order-checking.
By the GGPPS dna homolog of homology retrieval discovery cDNA sequence of the present invention, belong to albumen isoprenylation enzyme family, thereby be identified GGPPS gene into the people with the fruit bat of having delivered.It is relevant with proteic isoprenylation process that the GGPPS encoded protein has been proved, and this is a kind of means of bioprotein regulation and control.Especially in higher organism, proteinic post-translational control plays a part very important for heavy organism intracellular metabolite regulate process.Experiment is found, this homologous gene high expression level in cerebral tissue.It is considered to may be relevant with the albumen isoprenylation effect in the brain.The effect of GGPPS catalytic protein isoprenylation may be relevant with the eubolism regulation and control of brain.If this gene in the brain goes wrong, cause brain can't normally command the works better of human body possibly, have data prove its may be relevant with the generation of disease such as senile dementia (Runquist.M1995, J.Neurochem 65 (5)
2299-2306).
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone and the mensuration of the cDNA sequence of GGPPS
1. primer amplification
With human brain λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A1:5 '-GCGTGAAAGTCGTGATATCATCG-3 ' (SEQ ID NO:1) is a forward primer, oligonucleotide A2:5 '-TTGGTGGCAATGTCCTGTCACTGC-3 ' (SEQ ID NO:2) is a reverse primer, carries out PCR.A1, the right PCR condition of A2 primer be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 68 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.Electrophoresis detection is carried out the product that pcr amplification obtains with A1, A2, and the length of amplified fragments is 1603bp's.
2.PCR the order-checking of product
Above-mentioned steps is obtained pcr amplification product and pGEM-T
TMCarrier (Promega) connects, transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then with double-stranded nested type disappearance test kit (Pharmacia).Use SequiTherm EXCEL
TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 1218bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 54-953 position Nucleotide.
Derive the aminoacid sequence of GGPPS according to the full length cDNA sequence that obtains, totally 300 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.
Embodiment 2
Homology relatively
Full length cDNA sequence and proteins encoded thereof with GGPPS carry out the homology retrieval with BLAST in Non-redundant GenBank+EMBL+DDBJ+PDB database.Found that they and fruit bat GGPPS gene and proteins encoded thereof have high homology, homogeny has reached 72% on nucleic acid level; Homogeny on protein level has reached 58%, and similarity has reached 75%.
It is in plant that GGPPS is studied more, and it is considered to plant carotenoid synthetic precursor, and carotenoid plays in photosynthesis of plant and absorbs and the vital role of transmission photosynthesis institute energy requirement.There is experiment to find that GGPPS is a vitamin A synthetic precursor simultaneously.It also may play an important role in the bio-metabolic process of certain plants, and (FASEB.J 1996,10 (2), 228-237).
Though GGPPS is a kind of albumen of finding in plant, nearest discovers, has this albumen in animal too.People at first separate in the ox brain and have obtained GGPPS, and find this gene high expression level in cerebral tissue.In the ox brain, the content of GGPPS is very high, and the content of the different zones GGPPS of brain has nothing in common with each other, and content is the highest in white matter.(Runquist.M?1995，J.Neurochem?65(5)
2299-2306)。
The research of GGPPS in animal is also at the early-stage, and it is considered to may be relevant with proteic isoprenylation process.Proteic isoprenylation process is a ubiquitous phenomenon in the eukaryote, is a kind of means of bioprotein regulation and control.Especially in higher organism, proteic post-translational control plays a part for heavy organism intracellular metabolite regulate process that very important (Runquist.M 1995, and J.Neurochem 65 (5)
2299-2306).
Characteristic sequence---(L/I/V/M/F/Y) GX that particularly in the aminoacid sequence of GGPPS, has two polyisoprene synthetic enzyme of forming by 15 and 13 amino acid respectively
2(F/Y/L) Q (L/I/V/M) XDD (L/I/V/M/F/Y) X (D/N/G); (L/I/V/M)
2XDDX
(2,4)DX
4RR (G/H) [annotate: X is an arbitrary amino acid in this sequence, and numerals such as " 2 " is an amino acid number, and an amino acid is selected in " (L/I/V/M/F/Y) " expression arbitrarily from these 6 amino acid].The sequence fragment that meets above-mentioned pattern in albumen of the present invention is: LGLFFQIRDDYAN (179-192 position among the SEQ ID NO.4), LLIDDIEDNSKLRRG (61-75 position among the SEQ ID NO.4).This has confirmed that more the people's of the present invention GGPPS and the GGPPS of ox and other species belong to a family, and has the correlation function of GGPPS family equally.The effect of its catalytic protein isoprenylation may play an important role with the eubolism regulation and control to brain.If this gene in the brain goes wrong, cause brain can't normally command the works better of human body possibly, thereby cause diseases such as degenerative brain disorder, this will have a strong impact on our orthobiosis (Runquist.M1995, J.Neurochem 65 (5) 2299-2306).In brain, influence the generation and the mechanism of action thereof of degenerative brain disorder and other possible diseases about GGPPS, for we treat direction and the means that these diseases provide research effectively.
Embodiment 3
The expression of GGPPS in intestinal bacteria
In this embodiment, the PCR Oligonucleolide primers of the cDNA sequence of coding GGPPS corresponding to 5 of this dna sequence dna ' and 3 ' end, with human brain λ gt11cDNA library (available from Clontech company) for template increases, to synthesize the insertion fragment.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5′-GGCCGGATCCATGGAGAAGACTCAAGAAA-3′(SEQ?ID?NO.5)，
This primer contains the restriction enzyme site of the restricted restriction enzyme of BamH1, and what connect is 19 Nucleotide of the GGPPS encoding sequence that begun by initiator codon;
3 ' end primer sequence is
5’-ACACGGATCCTTATTCATTTTCTTCTTTG-3’(SEQ?ID?NO.6)
This primer contains the encoding sequence of the restriction enzyme site of the restricted restriction enzyme of BamH1, translation termination and GGPPS.
The restriction enzyme site of restriction enzyme is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp
r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.
With BamHI digestion pQE-9 carrier, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kan
r).Screen transformant containing on the LB culture dish of Amp and Kan, incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).The extracting plasmid is cut with the PstI enzyme and identify to be inserted clip size and direction, and sequence verification result shows that the cDNA of GGPPS inserts the fragment carrier of correctly packing into.
Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD
600) when reaching 0.4-0.6, add IPTG (" sec.-propyl-sulfo--B-D-galactoside ") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved GGPPS from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out GGPPS from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps from nickel-chelate column, isolate purifying protein.Albumen can be incorporated in second post behind the purifying, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 35KDa.
In addition, the amino acid of expressing proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO:4 with ordinary method.
Embodiment 4
The expression of GGPPS in eukaryotic cell (Chinese hamster ovary celI strain)
In this embodiment, the cDNA sequence of coding GGPPS is used PCR Oligonucleolide primers corresponding to 5 of this dna sequence dna ' and 3 ' end, with human brain λ gt11cDNA library (available from Clontech company) for template increases, to synthesize the insertion fragment.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5′-GGCCGGATCCATGGAGAAGACTCAAGAAA-3′(SEQ?ID?NO.7)，
This primer contains the restriction enzyme site of the restricted restriction enzyme of BamHI, and what connect is 19 Nucleotide of the GGPPS encoding sequence that begun by initiator codon;
3 ' end primer sequence is:
5’-ACACGGATCCTTATTCATTTTCTTCTTTG-3’(SEQ?ID?NO.8)，
This primer contains the restriction enzyme site of the restricted restriction enzyme of BamHI, the encoding sequence of translation termination and GGPPS.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp
rAnd Neo
r), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.
With BamHI digestion pcDNA3 carrier, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid is cut with the EcoRV enzyme and identify to be inserted clip size and direction, and sequence verification result shows that the cDNA of GGPPS inserts the fragment carrier of correctly packing into.
The plasmid transfection Chinese hamster ovary celI is to carry out with lipofection with Lipofectin test kit (GiBcolife).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mM TrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 35KDa.
In addition, the amino acid of expressing proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO:4 with ordinary method.
Embodiment 5
Preparation antibody
The recombinant protein that obtains in embodiment 3 or 4 is used for immune animal to produce antibody, specific as follows.Recombinant molecule separates standby with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation GGPPS gene translation product with it.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Information (i) sequence signature of sequence table (2) SEQ ID NO:1
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:1:GCGTGAAAGT CGTGATATCA TCG 23 (2) SEQ ID NO:2
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:2TTGGTGGCAA TGTCCTGTCA CTGC 24 (2) SEQ ID NO:3: (i) sequence signature:
(A) length: 1218bp
(B) type: nucleic acid
(C) chain: strand
( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO：31 GCGTGAAAGTCGTGATATCATCGTTGAACTATTAGCTTTGAAGTTTAAATCCAATGGAGA 61 AGACTCAAGAAACAGTCCAAAGAATTCTTCTAGAACCCTATAAATACTTACTTCAGTTAC 121 CAGGTAAACAAGTGAGAACCAAACTTTCACAGGCATTTAATCATTGGCTGAAAGTTCCAG 181 AGGACAAGCTACAGATTATTATTGAAGTGACAGAAATGTTGCATAATGCCAGTTTACTCA 241 TCGATGATATTGAAGACAACTCAAAACTCCGACGTGGCTTTCCAGTGGCCCACAGCATCT 301 ATGGAATCCCATCTGTCATCAATTCTGCCAATTACGTGTATTTCCTTGGCTTGGAGAAAG 361 TCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCGCCAGCTTTTGGAACTCC 421 ATCAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACTGAAGAAG 481 AATATAAAGCTATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGTCTCA 541 TGCAGTTGTTCTCTGATTACAAAGAAGATTTAAAACCGCTACTTAATACACTTGGGCTCT 601 TTTTCCAAATTAGGGATGATTATGCTAATCTACACTCCAAAGAATATAGTGAAACCAAAA 661 GTTTTTGTGAAGATCTGACAGAGGGAAAGTTCTCATTTCCTACTATTCATGCTATTTGGT 721 CAAGGCCTGAAAGCACCCAGGTGAAGAATATCTTGCGCCAGAGAACAGAAAACATAGATA 781 TAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTTTGAATACACTCGTAATA 841 CCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGGAACCCTG 901 AGCTAGTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAATAATGTT 961 AAGCCATTCTTGATTGGACCTCATAGCTTATTTTAGTTAATCTTTTTTTTGTCTTTTAGC1021 CTTACCACCTTTTAAAAAATTTGTTATTCTCCAGAAACAGTAAATAGGTGAGTAGGGGTG1081 GTGCCAGTGAATTCGTTTTCATTTAGAAGCCCCTCTGTACAGATAATCAAAATTCAAAGT1141 TGAAAGAATCAAAAGCAGCCACAGTTATGTAGGTCTGATTTGAATGTCATAATTGCAGTG1201 ACAGGACATTGCCACCAA
(2) information of SEQ ID NO:4:
(i) sequence signature:
(A) length: 300 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ii) molecule type: polypeptide
(xi) sequence description: SEQ ID NO:4
1?Met?Glu?Lys?Thr?Gln?Glu?Thr?Val?Gln?Arg?Ile?Leu?Leu?Glu?Pro
16?Tyr?Lys?Tyr?Leu?Leu?Gln?Leu?Pro?Gly?Lys?Gln?Val?Arg?Thr?Lys
31?Leu?Ser?Gln?Ala?Phe?Asn?His?Trp?Leu?Lys?Val?Pro?Glu?Asp?Lys
46?Leu?Gln?Ile?Ile?Ile?Glu?Val?Thr?Glu?Met?Leu?His?Asn?Ala?Ser
61?Leu?Leu?Ile?Asp?Asp?Ile?Glu?Asp?Asn?Ser?Lys?Leu?Arg?Arg?Gly
76?Phe?Pro?Val?Ala?His?Ser?Ile?Tyr?Gly?Ile?Pro?Ser?Val?Ile?Asn
91?Ser?Ala?Asn?Tyr?Val?Tyr?phe?Leu?Gly?Leu?Glu?Lys?Val?Leu?Thr
106?Leu?Asp?His?Pro?Asp?Ala?Val?Lys?Leu?Phe?Thr?Arg?Gln?Leu?Leu
121?Glu?Leu?His?Gln?Gly?Gln?Gly?Leu?Asp?Ile?Tyr?Trp?Arg?Asp?Asn
136?Tyr?Thr?Cys?Pro?Thr?Glu?Glu?Glu?Tyr?Lys?Ala?Met?Val?Leu?Gln
151?Lys?Thr?Gly?Gly?Leu?Phe?Gly?Leu?Ala?Val?Gly?Leu?Met?Gln?Leu
166?Phe?Ser?Asp?Tyr?Lys?Glu?Asp?Leu?Lys?Pro?Leu?Leu?Asn?Thr?Leu
181?Gly?Leu?Phe?Phe?Gln?Ile?Arg?Asp?Asp?Tyr?Ala?Asn?Leu?His?Ser
196?Lys?Glu?Tyr?Ser?Glu?Thr?Lys?Ser?Phe?Cys?Glu?Asp?Leu?Thr?Glu
211?Gly?Lys?Phe?Ser?Phe?Pro?Thr?Ile?His?Ala?Ile?Trp?Ser?Arg?Pro
226?Glu?Ser?Thr?Gln?Val?Lys?Asn?Ile?Leu?Arg?Gln?Arg?Thr?Glu?Asn
241?Ile?Asp?Ile?Lys?Lys?Tyr?Cys?Val?His?Tyr?Leu?Glu?Asp?Val?Gly
256?Ser?Phe?Glu?Tyr?Thr?Arg?Asn?Thr?Leu?Lys?Glu?Leu?Glu?Ala?Lys
271?Ala?Tyr?Lys?Gln?Ile?Asp?Ala?Arg?Gly?Gly?Asn?Pro?Glu?Leu?Val
Information (i) sequence signature of 286 Ala Leu Val Lys His Leu Ser Lys Met Phe Lys Glu Glu Asn Glu (2) SEQ ID NO:5
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:5:GGCCGGATCC ATGGAGAAGA CTCAAGAAA 29 (2) SEQ ID NO:6 information (i) sequence signatures
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:6:ACACGGATCC TTATTCATTT TCTTCTTTG 29 (2) SEQ ID NO:7 information (i) sequence signatures
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:7:GGCCGGATCC ATGGAGAAGA CTCAAGAAA 29 (2) SEQ ID NO:8 information (i) sequence signatures
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:8:ACACGGATCC TTATTCATTT TCTTCTTTG 29
Claims (11)
1. an isolated dna molecular is characterized in that, described dna molecule encode one polypeptide, and this polypeptide contains the sequence shown in the SEQ ID NO.4.
2. dna molecular as claimed in claim 1 is characterized in that, described dna molecule encode one polypeptide, and the sequence of this polypeptide is shown in SEQ ID NO.4.
3. dna molecular as claimed in claim 1 is characterized in that, described dna molecular contains the sequence of Nucleotide 54-953 position among the SEQ IDNO.3.
4. an isolating GGPPS protein polypeptide is characterized in that, it contains SEQ ID NO.4 aminoacid sequence.
5. polypeptide as claimed in claim 4 is characterized in that, this amino acid sequence of polypeptide is shown in SEQ ID NO.4.
6. a carrier is characterized in that, it contains the described DNA of claim 1.
7. one kind with the described carrier transformed host cells of claim 6.
8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.
9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.
10. one kind produces the proteic method of GGPPS, it is characterized in that this method comprises:
(a) the proteic nucleotide sequence of GGPPS of will encoding operationally is connected in expression regulation sequence, forms the GGPPS protein expression vector, a described nucleotide sequence coded polypeptide, and this polypeptide contains the sequence shown in the SEQ ID NO.4;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of GGPPS;
(c) be fit to express under the condition of GGPPS protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate GGPPS albumen.
11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 54-953 position among the SEQ ID NO.3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 98111038 CN1132939C (en) | 1998-08-31 | 1998-08-31 | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 98111038 CN1132939C (en) | 1998-08-31 | 1998-08-31 | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1246536A CN1246536A (en) | 2000-03-08 |
| CN1132939C true CN1132939C (en) | 2003-12-31 |
Family
ID=5221047
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 98111038 Expired - Fee Related CN1132939C (en) | 1998-08-31 | 1998-08-31 | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1132939C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102526763A (en) * | 2012-03-22 | 2012-07-04 | 南京大学 | Application of geranylgeranyl diphosphate synthase (GGPPS) antagonist in preparation of medicament for treating II-type diabetes mellitus |
| JP2019532655A (en) | 2016-10-27 | 2019-11-14 | ディーエスエム アイピー アセッツ ビー．ブイ．Ｄｓｍ Ｉｐ Ａｓｓｅｔｓ Ｂ．Ｖ． | Geranylgeranyl pyrophosphate synthase |
-
1998
- 1998-08-31 CN CN 98111038 patent/CN1132939C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1246536A (en) | 2000-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1128878C (en) | Coding sequence of human methionine sulfoxide reductase, its encoded polypeptide and its preparing process | |
| CN1132939C (en) | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process | |
| CN1125178C (en) | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process | |
| CN1125177C (en) | Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process | |
| CN1249347A (en) | Human calcineurin regulatory subunit, its coding sequence and its preparing process | |
| CN1277259A (en) | Homologous protein of late embryo ample-protein and its code sequence | |
| CN1237173C (en) | Hemolytic peptide precursor gene of Asian-African wasp aptoxin, polypeptide coded by it and its preparing process | |
| CN1246529A (en) | Coding sequence of human translation initiation factor subunit, its encoded polypeptide and its preparing process | |
| CN1233830C (en) | China bee and hornet hemolysis peptide precursor gene and coded polypeptide and preparing method | |
| CN1259574A (en) | New human phosphatide transferase, its code sequence, prepn. and use thereof | |
| CN1248624A (en) | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process | |
| CN1250096A (en) | New human protein phosphatase subunit and its coding series and preparation | |
| CN1246532A (en) | Coding sequence of human heat shock associated protein, its encoded polypeptide and its preparing process | |
| CN1261102A (en) | Human spindle protein and its coding sequence, preparing process and application | |
| CN1249342A (en) | Human phosphatidyl ethanolamine-N-methyltransferase, its coding sequence and its preparing process | |
| CN1253180A (en) | Specific protein of human neuroendocrine, coding sequence and its preparating process and application | |
| CN1264739A (en) | Human protein and its coding sequence, preparing process and application | |
| CN1287169A (en) | New human G protein protomer and its code sequence | |
| CN1251860A (en) | Human gene sequence and its coded polypeptide, preparing process and application | |
| CN1277260A (en) | Human actin related protein subunit and its code sequence | |
| CN1259572A (en) | New human protein and its code sequence, prepn. method and use thereof | |
| CN1257921A (en) | Human melanoma growth correlation factor and its coding sequence, preparing process and usage | |
| CN1264740A (en) | Human UMP-CMP kinase and its coding sequence, preparing process and application | |
| CN1250097A (en) | New human gene coding series and the polypeptide therewith and its preparation | |
| CN1249344A (en) | Growth factor genes of human liver cancer cell derivation, its encoded polypeptide and its preparing process |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1066575 Country of ref document: HK |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20031231 Termination date: 20160831 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |