CN1248624A - Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process - Google Patents
Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process Download PDFInfo
- Publication number
- CN1248624A CN1248624A CN98119744A CN98119744A CN1248624A CN 1248624 A CN1248624 A CN 1248624A CN 98119744 A CN98119744 A CN 98119744A CN 98119744 A CN98119744 A CN 98119744A CN 1248624 A CN1248624 A CN 1248624A
- Authority
- CN
- China
- Prior art keywords
- sequence
- polypeptide
- cop
- people
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a new human gene nucleotide sequence. In particular, the said invention relates to a human capsid protein zeta subunit, i. e. cDNA sequence of human zeta-COP. Said protein is the homologue of zeta-COP. Said invention also relates to polypeptide coded by said nucleotide sequence, these polynucleotide and polypeptide application and production method of the described polynucleotide and described polypeptide.
Description
The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence that human capside protein ζ subunit is people ζ-COP, this albumen is the homologue of ζ-COP.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.
In the eukaryotic cells, the transportation of protein between each organoid is sprouting and merging and realize by transport vesicle.Discover, exist two kinds of different albumen to form having of shell in the cell and betransported vesicle: a kind of is the vesicle of clathrin (clathin) bag quilt, during endocytosis from the cytolemma formation of sprouting, or sprout from the golgi body mature face and to be transported to other endogenous cell device (Cell 79:1199-1207,1994); Another kind is the vesicle of capside protein (COP) bag quilt, is positioned the Special Areas (Nature362:648-652,1993) of Golgi membrane and transition endoplasmic reticulum (transitional ER).These two kinds of albumen are all formed (Annu.Rev.Biochem.59:415-438,1990 by a plurality of subunits; Nature 355:409-415,1992), and certain homology is arranged between both subunits.The vesicle of finding COPII bag quilt in addition in yeast saccharomyces cerevisiae produces (Cell 77:895-908,1994) from endoplasmic reticulum.
The COP albumen composition was obtained by people's separation and purification such as Orci in 1986.Experiment shows that it does not contain clathrin, and bears the albumen transportation function (Cell 46:171-184,1986) between gorky's somatocyst.At the beginning of the nineties, people such as Serafini and Stenbeck have cloned part subunit (as α, β ', γ) (Nature349:215-220,1991 of this mixture; FEBS Lett.314:195-198,1992).People such as Kuge in 1993 separate from the liver cell of ox and have obtained proteic another subunit of COP ζ (Zeta)-COP albumen, and have cloned its cDNA sequence (J.Cell.Biol.123 (6): 1727-1734,1993).1996, people such as Cosson utilized genetic mutation research to obtain zymic ζ (Zeta)-COP homologue (EMBO is (8) J.15: 1792-1798,1996).
Before the present invention announced, still nobody disclosed human ζ (Zeta)-COP albumen and the cDNA sequence that relates among the application.
An object of the present invention is to provide a kind of new polynucleotide sequence, this polynucleotide sequence coding human capside protein ζ subunit is people ζ-COP albumen, and gene of the present invention is named as people ζ-COP.
Another object of the present invention provides a kind of new albumen, and this albumen is named as people ζ-COP.
A further object of the present invention provides a kind of recombinant technology that utilizes and produces the described new proteic method of people ζ-COP.
The present invention also provides the application of this people ζ-COP encoding sequence and polypeptide.
In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people ζ-COP protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 18-551 position among described nucleotide sequence and the SEQ IDNO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 18-551 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 18-551 position.
In another aspect of this invention, provide a kind of isolating people ζ-COP protein polypeptide, it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.
In another aspect of this invention, provide a kind of described carrier transformed host cells.
In another aspect of this invention, provide a kind of generation to have the method for the polypeptide of people ζ-COP protein-active, this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of people ζ-COP protein-active operationally is connected in expression regulation sequence, form people ζ-COP protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 18-551 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people ζ-COP;
(c) under the condition that is fit to expressing human ζ-COP protein polypeptide, the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with people ζ-COP protein-active.
In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 652 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 18-551 position Nucleotide.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, term " people ζ-COP albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people ζ-COP protein-active is as 18-551 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 18-551 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 18-551 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably, under the height stringent condition with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 18-551 position.In addition, this term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 18-551 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO.3 with people's identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.
In the present invention, term " people ζ-COP protein polypeptide " refers to have the SEQ IDNO.4 polypeptide of sequence of people ζ-COP protein-active.This term also comprises having and variant form people ζ-COP identical function, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people ζ-COP and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of people ζ-COP DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people ζ-COP polypeptide to obtain.The present invention also provides other polypeptide, as comprises people ζ-COP polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people ζ-COP polypeptide.Usually, this fragment have people ζ-COP peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of people ζ-COP albumen or polypeptide.The difference of these analogues and natural human ζ-COP polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
The present invention also comprises the antisense sequences of people ζ-COP polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of people ζ-COP in the cell.
The present invention also comprises a kind of probe molecule, and this molecule has 8-100 of people ζ-COP polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people ζ-COP.
The present invention also comprises the method that detects people ζ-COP nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of people ζ-COP polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 20-50 Nucleotide.
In the present invention, can select various carrier known in the art for use, as commercially available carrier.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
On the other hand, the present invention also comprises people ζ-COP DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people ζ-COP gene product or fragment.Preferably, refer to that those can combine with people ζ-COP gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people ζ-COP, comprise that also those do not influence the antibody of people ζ-COP protein function.The present invention also comprise those can with modify or without the people ζ-COP gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people of purifying ζ-COP gene product or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human ζ-COP or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people ζ-COP function and the antibody that does not influence people ζ-COP function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people ζ-COP gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of ζ-COP gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
In the accompanying drawings,
Fig. 1 is the homology comparison diagram of the nucleotide sequence of people ζ-COP of the present invention and ox ζ-COP.Wherein, identical Nucleotide marks with " | ".
Fig. 2 is the homology comparison diagram of the aminoacid sequence of people ζ-COP of the present invention and ox ζ-COP.Wherein, identical amino acid marks with " | " between two sequences.
In the present invention, the cDNA nucleotide sequence of people ζ-COP is so to obtain, with human brain λ Gt11cDNA library (available from Clontech company) is template, synthetic forward primer A1:5 '-ACCAGCTGCGGGGCAAGATGGAG-3 ' and reverse primer A2:5 '-CCGAGATGACCCTGAGAGCATCG-3 ' carries out PCR, obtains the purpose fragment of 652bp. After the order-checking Obtain the full length cDNA sequence of SEQ ID NO.3.
The outer albumen composition of clothing transport vesicle (COP-coated vesicles) mainly by ADP ribosylation because of Son (ARF) and capside protein (coatomer) form (FEBS Lett..369:89-92,1995). Work as Golgi membrane When forming vesicle, at first in conjunction with ARF in the cytosol, when they combine GTP and after the film surface reaches capacity, Capside protein begins to be incorporated into the vesicle surface, and promotes the final formation (Curr.Opin.Cell.Biol. of clothing vesicle 5:621-627,1993). After ARF had been hydrolyzed GTP, the capside protein of coated vesicl began to disintegrate, vesicle with Target film merges (J.Cell.Biol.122:1365-1371,1993). Studies show that capside protein is by seven Asias A compound (Nature 349:248-251,1991) of base, ζ-COP are wherein minimum subunits, and Directly and the capside protein binding site effect on the Golgi membrane (J.Cell.Biol.123:1727-1734, 1993). It in compound and γ-COP interaction is arranged, can be in the experiment of external co-immunoprecipitation by altogether With precipitating (J.Bio.Chem.270 (52): 31364-31371,1995). ζ-COP in cytosol can be Soluble and monomeric also can combine with capside protein. Be combined with capside protein as ζ-COP, it has just been opened The function of capside protein, on the contrary capside protein just is in the non-activity state. This characteristic of ζ-COP shows its tool Function (the J.Cell.Biol. that regulates the clothing assembling and then regulate the transporting rate of biosynthetic protein is arranged 123:1727-1734,1993). The clothing transport vesicle not only participates in the forward transportation of protein in golgiosome, Also it oppositely can be transported to endoplasmic reticulum (EMBO is (8) J.15: 1792-1798,1996) from golgiosome. In addition, When mitosis, the clothing vesicle also is the primary product of golgiosome degraded division, and COP is not only at egg in prompting White matter transportation aspect and all have very important effect (FEBS Lett.389:66-aspect the organelle formation 69,1996).
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone and the mensuration of the cDNA sequence of people ζ-COP
1. primer amplification
With human brain λ gt11cDNA library (available from Clontech company) is template, using Oligonucleolide primers---A1:5 '-ACCAGCTGCGGGGCAAGATGGAG-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide A2:5 '-CCGAGATGACCCTGAGAGCATCG-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 68 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR fragment that electrophoresis detection obtains, A1/A2 is the purpose fragment of 652bp.
2.PCR the order-checking of product
Pcr amplification product and pGEM-T with above-mentioned acquisition
TMCarrier (Promega) connects, transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then with double-stranded nested type disappearance test kit (Pharmacia).Use SequiTherm EXCEL
TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 652bp, detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 18-551 position Nucleotide.
Derive the aminoacid sequence of people ζ-COP according to the full length cDNA sequence that obtains, totally 177 amino-acid residues, its aminoacid sequence sees SEQ ID NO.4 for details.
Embodiment 2
Homology relatively
The full length cDNA sequence of personnel selection ζ-COP and proteins encoded thereof carry out nucleic acid and albumen homology retrieval with BLAST in Non-redundantGenBank+EMBL+DDBJ+PDB database and Non-redundantGenBankCDS translations+PDB+SwissProt+Spupdate+PIR database.Found that they and ox ζ-COP gene and proteins encoded thereof have high homology, find relatively that with PCGENE software their identity on nucleic acid level reaches 94.5% (Fig. 1), the identity on protein level reaches 98.9% (Fig. 2).Therefore, determine that they have constituted a family, and people ζ-COP of the present invention have with same family in the same or analogous function of other members.
The outer albumen composition of clothing transport vesicle (COP-coated vesicles) mainly is made up of ADP ribosylation factor (ARF) and capside protein (coatomer).The vital role of these protein ingredients has: 1) make flat film become bud; 2) prevent vesicle prematurity or fusion at random; 3) to loading the effect (FEBS Lett..369:89-92,1995) that albumen plays letter sorting and concentrates in steeping.When Golgi membrane forms vesicle, at first in conjunction with ARF in the cytosol, ARF is the small-sized gtp binding protein of a class, when they combine GTP and after the film surface reaches capacity, capside protein begins to be incorporated into the vesicle surface, and the final formation (Curr.Opin.Cell.Biol.5:621-627,1993) of promotion clothing vesicle.When the ARF hydrolysis behind the GTP, the capside protein of coated vesicl begins to disintegrate, vesicle and target film fusion (J.Cell.Biol.122:1365-1371,1993).Studies show that, capside protein is a mixture (Nature 349:248-251 by seven subunits, 1991), the space structure of mixture and the effect of each subunit are not still understood, known ζ-COP is a wherein minimum subunit, not directly and the capside protein binding site effect (J.Cell.Biol.123:1727-1734,1993) on the Golgi membrane.It in mixture and γ-COP interaction is arranged, can be by (J.Bio.Chem.270 (52): 31364-31371,1995) under the coprecipitation in the experiment of external co-immunoprecipitation.Be different from other subunit, it can be soluble and monomeric that ζ-COP is found in the cytosol.ζ-COP also can combine with capside protein, makes the average mark subnumber of ζ-COP in each capside protein mixture less than 1.When ζ-COP combines with capside protein, it has just opened the function of capside protein, otherwise when it disintegrates down, capside protein just is in the non-activity state.This characteristic of ζ-COP shows that it has the function (J.Cell.Biol.123:1727-1734,1993) of regulating the clothing assembling and then regulating biosynthetic proteinic transporting rate.Various experimental results show, the clothing transport vesicle not only participates in the forward transportation of protein in golgi body, its two Methionin sign on also can identification of protein oppositely is transported to endoplasmic reticulum (EMBO is (8) J.15: 1792-1798,1996) with it from golgi body.In addition, when mitotic division, the clothing vesicle also is a golgi body degraded splitted primary product, nearly 60% Golgi membrane fragment has been formed the clothing transport vesicle, make gorky's physical efficiency evenly distribute in two daughter cells, this has pointed out COP not only aspect the protein transportation but also all have very important effect (FEBS Lett.389:66-69,1996) aspect the organoid formation.
People ζ-COP of the present invention is used for further functional study except can be used as this family's subunit a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor ζ-COP can also merge with other members of this family or exchange fragment, to produce new albumen.For example the N end of inventor ζ-COP and the N end of ox ζ-COP are exchanged, to produce subunit and/or the albumen that new activity is higher or have new features.
At the antibody of inventor ζ-COP, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).
Embodiment 3
The expression of people ζ-COP in intestinal bacteria
In this embodiment, with the cDNA sequence of coding people ζ-COP use corresponding to this dna sequence dna 5 ' and the PCR Oligonucleolide primers of 3 ' end increase, obtain people ζ-COPcDNA as inserting fragment.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5 '-AGTTGTCGACATGGAGGCGCTGATTTTGG-3 ' (SEQ ID NO.5), this primer contains the restriction enzyme site of SalI restriction enzyme, is 19 Nucleotide of people ζ-COP encoding sequence of being begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5 '-AAGGAAGCTTTCACCGAAGGAGTGACCAC-3 ' (SEQ ID NO.6), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the people ζ-COP of HindIII restriction enzyme.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Ampr), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.
With SalI and HindIII digestion pQE-9 carrier and insertion fragment, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kan
r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid cuts with the BamHI enzyme and to identify and insert clip size and direction, and the cDNA fragment of sequence verification people ζ-COP has correctly been inserted carrier.
Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD
600) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved people ζ-COP from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out people ζ-COP from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps use the dialysis step to remove Guanidinium hydrochloride, perhaps isolate purifying protein from nickel-chelate column, the albumen behind the purifying can be incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed to containing PBS, then protein is kept in the stock solution that final concentration is l0% (w/v) glycerine.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 20KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.
Embodiment 4
The expression of people ζ-COP in eukaryotic cell (Chinese hamster ovary celI strain)
In this embodiment, with the cDNA sequence of coding people ζ-COP use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers of 3 ' end increase, obtain people ζ-COP cDNA as inserting fragment.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5’-CGTTAAGCTTATGGAGGCGCTGATTTTGG-3′(SEQ?ID?NO.7)
This primer contains the restriction enzyme site of HindIII restriction enzyme, is 19 Nucleotide of people ζ-COP encoding sequence of being begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5’-AAGTGAGCTCTCACCGAAGGAGTGACCAC-3’(SEQ?ID?NO.8)
This primer contains the part encoding sequence of the restriction enzyme site of SacI restriction enzyme, translation termination and people ζ-COP.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp
rAnd Neo
r), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.
Digest the pcDNA3 carrier respectively and insert fragment with HindIII and SacI, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coliDH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid cuts evaluation with the BamHI enzyme and insert clip size and direction, and the cDNA fragment of sequence verification people ζ-COP has correctly been inserted carrier.
The plasmid transfection Chinese hamster ovary celI is to use lipofection, and (GiBco Life) carries out with the Lipofectin test kit, and transfection is after 48 hours, and through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mMTrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mMTrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 20KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.
Embodiment 5
Preparation antibody
Embodiment 3 and 4 recombinant proteins that obtain are used for immune animal to produce antibody, specific as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people ζ-COP gene translation product with it.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table (1) general information: (i) applicant: Xinhuangpu-Fudan Gene Engineering Co., Ltd., Shanghai is denomination of invention (ii): new human capside protein subunit encoding sequence, its encoded polypeptides and preparation method be the sequence number (iii): information (i) sequence signature of 8 (2) SEQ ID NO.1
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: information (i) sequence signature of SEQ ID NO.1ACCAGCTGCGGGGCAAGATGGAG 23 (2) SEQ ID NO.2
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO.2CCGAGATGACCCTGAGAGCATCG 23 (2) SEQ ID NO.3: (i) sequence signature
(A) length: 652bp
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: cDNA
( xi ) :SEQ ID NO.31 ACCAGCTGCG GGGCAAGATG GAGGCGCTGA TTTTGGAACC TTCCCTGTAT ACTGTCAAAG61 CCATCCTGAT TCTGGACAAT GATGGAGATC GACTTTTTGC CAAGTACTAT GACGACACCT121 ACCCCAGTGT CAAGGAGCAA AAGGCCTTTG AGAAGAACAT TTTCAACAAG ACCCATCGGA181 CTGACAGTGA AATTGCCCTC TTGGAAGGCC TGACAGTGGT ATACAAAAGC AGTATAGATC241 TCTATTTCTA TGTGATTGGC AGCTCCTATG AAAATGAGCT GATGCTTATG GCTGTTCTGA301 ACTGTCTCTT CGACTCATTG AGCCAGATGC TGAGGAAAAA TGTAGAAAAG CGAGCACTGC361 TGGAGAACAT GGAGGGGCTG TTCTTGGCTG TGGATGAAAT TGTAGATGGA GGGGTGATCC421 TAGAGAGTGA TCCCCAGCAG GTGGTACACC GGGTGGCATT AAGGGGTGAA GATGTCCCCC481 TTACGGAGCA GACCGTGTCT CAGGTGCTGC AGTCAGCCAA AGAACAGATC AAGTGGTCAC541 TCCTTCGGTG AAGACCTCAC TGTTCCTGGC TCTTCATCCT CTTCAAAAAA TTTGCATGTC601 TGCTGTGAAT TTTCATCTAG TTCCCCAATC GATGCTCTCA GGGTCATCTC GG ( 2 ) SEQ ID NO.4: ( i )
(A) length: 177 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ii) molecule type: polypeptide
( xi ) :SEQ ID NO.41 Met Glu Ala Leu Ile Leu Glu Pro Ser Leu Tyr Thr Val Lys Ala16 Ile Leu Ile Leu Asp Asn Asp Gly Asp Arg Leu Phe Ala Lys Tyr31 Tyr Asp Asp Thr Tyr Pro Ser Val Lys Glu Gln Lys Ala Phe Glu46 Lys Asn Ile Phe Ash Lys Thr His Arg Thr Asp Ser Glu Ile Ala61 Leu Leu Glu Gly Leu Thr Val Val Tyr Lys Ser Ser Ile Asp Leu76 Tyr Phe Tyr Val Ile Gly Ser Ser Tyr Glu Asn Glu Leu Met Leu91 Met Ala Val Leu Asn Cys Leu Phe Asp Ser Leu Ser Gln Met Leu106 Arg Lys Asn Val Glu Lys Arg Ala Leu Leu Glu Asn Met Glu Gly121 Leu Phe Leu Ala Val Asp Glu Ile Val Asp Gly Gly Val Ile Leu136 Glu Ser Asp Pro Gln Gln Val Val His Arg Val Ala Leu Arg Gly151 Glu Asp Val Pro Leu Thr Glu Gln Thr Val Ser Gln Val Leu Gln166 Ser Ala Lys Glu Gln Ile Lys Trp Ser Leu Leu Arg
(2) information of SEQ ID NO.5
(i) sequence signature
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO.5AGTTGTCGACATGGAGGCGCTGATTTTGG 29
(2) information of SEQ ID NO.6
(i) sequence signature
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO.6AAGGAAGCTTTCACCGAAGGAGTGACCAC 29
(2) information of SEQ ID NO.7
(i) sequence signature
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: information (i) sequence signature of SEQ ID NO.7CGTTAAGCTTATGGAGGCGCTGATTTTGG 29 (2) SEQ ID NO.8
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO.8AAGTGAGCTCTCACCGAAGGAGTGACCAC 29
Claims (14)
1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people ζ-COP protein-active,
Show at least 70% homology from the nucleotides sequence of Nucleotide 18-551 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps
Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 18-551 position.
2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.
3. dna molecular as claimed in claim 1 is characterized in that, this sequence is the sequence of Nucleotide 18-551 position among the SEQ ID NO.3.
4. isolating people ζ-COP protein polypeptide is characterized in that it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.
5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
6. a carrier is characterized in that, it contains the described DNA of claim 1.
7. one kind with the described carrier transformed host cells of claim 6.
8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.
9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.
10. a generation has the method for the polypeptide of people ζ-COP protein-active, it is characterized in that this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of people ζ-COP protein-active operationally is connected in expression regulation sequence, form people ζ-COP protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 18-551 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people ζ-COP;
(c) under the condition that is fit to expressing human ζ-COP protein polypeptide, the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with people ζ-COP protein-active.
11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 18-551 position among the SEQ ID NO.3.
12. an energy and the described people ζ of claim 4-COP protein polypeptide specificity bonded antibody.
13. a nucleic acid molecule is characterized in that, it is the antisense sequences of the described dna molecular of claim 1.
14. a probe molecule is characterized in that, it contains about 8-100 continuous nucleotide in the described dna molecular of claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN98119744A CN1248624A (en) | 1998-09-22 | 1998-09-22 | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN98119744A CN1248624A (en) | 1998-09-22 | 1998-09-22 | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1248624A true CN1248624A (en) | 2000-03-29 |
Family
ID=5226453
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN98119744A Pending CN1248624A (en) | 1998-09-22 | 1998-09-22 | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1248624A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001070783A1 (en) * | 2000-03-07 | 2001-09-27 | Biowindow Gene Development Inc. Shanghai | A novel polypeptide-human gamma-cop protein 16 and the polynucleoide encoding said polypeptide |
-
1998
- 1998-09-22 CN CN98119744A patent/CN1248624A/en active Pending
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001070783A1 (en) * | 2000-03-07 | 2001-09-27 | Biowindow Gene Development Inc. Shanghai | A novel polypeptide-human gamma-cop protein 16 and the polynucleoide encoding said polypeptide |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1128878C (en) | Coding sequence of human methionine sulfoxide reductase, its encoded polypeptide and its preparing process | |
CN1248624A (en) | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process | |
CN1132939C (en) | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process | |
CN1125178C (en) | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process | |
CN1249347A (en) | Human calcineurin regulatory subunit, its coding sequence and its preparing process | |
CN1125177C (en) | Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process | |
CN1246532A (en) | Coding sequence of human heat shock associated protein, its encoded polypeptide and its preparing process | |
CN1246529A (en) | Coding sequence of human translation initiation factor subunit, its encoded polypeptide and its preparing process | |
CN1237173C (en) | Hemolytic peptide precursor gene of Asian-African wasp aptoxin, polypeptide coded by it and its preparing process | |
CN1233830C (en) | China bee and hornet hemolysis peptide precursor gene and coded polypeptide and preparing method | |
CN1259574A (en) | New human phosphatide transferase, its code sequence, prepn. and use thereof | |
CN1250097A (en) | New human gene coding series and the polypeptide therewith and its preparation | |
CN1277260A (en) | Human actin related protein subunit and its code sequence | |
CN1249346A (en) | Human gene sequence, its encoded polypeptide and its preparing process | |
CN1249342A (en) | Human phosphatidyl ethanolamine-N-methyltransferase, its coding sequence and its preparing process | |
CN1252446A (en) | New human gene sequence and encoded polypeptide and the preparation and application | |
CN1261102A (en) | Human spindle protein and its coding sequence, preparing process and application | |
CN1264739A (en) | Human protein and its coding sequence, preparing process and application | |
CN1252448A (en) | Human actin related protein gene and encoded polypeptide and preparation and application | |
CN1250098A (en) | Human P47 coding series and the polypeptide therewith and its preparation | |
CN1250096A (en) | New human protein phosphatase subunit and its coding series and preparation | |
CN1253180A (en) | Specific protein of human neuroendocrine, coding sequence and its preparating process and application | |
CN1259572A (en) | New human protein and its code sequence, prepn. method and use thereof | |
CN1257921A (en) | Human melanoma growth correlation factor and its coding sequence, preparing process and usage | |
CN1246530A (en) | Human gene coding sequence, its encoded polypeptide and its preparing process |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication |