CN1249342A - Human phosphatidyl ethanolamine-N-methyltransferase, its coding sequence and its preparing process - Google Patents

Abstract

The present invention discloses human phosphotidyl ethanolamin-N-methyltransferase homolog (PEMTH)and the cDNA sequence for coding it, and also relates to the preparing process and the application of said polynucleotide sequence and said polypeptide.

Description

Human phosphatidyl ethanolamine-N-methyltransferase, its encoding sequence and preparation method

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to people's the phosphatidyl ethanolamine-N-methyltransferase (phosphotidylethanolamine N-methyltransferase homolog abbreviates " PEMTH " as) and the cDNA sequence of this enzyme of encoding.The invention still further relates to the production method of described polynucleotide sequence and described polypeptide, and the application of these polynucleotide and polypeptide.

Phosphatidylcholine (claim Yelkin TTS again, be called for short PC) is a phospholipid the abundantest in the eukaryotic cell, and it is not only as the moiety of film but also be second messenger's a source.Yelkin TTS is to carry out synthetic through two approach in vivo.The firstth, the approach that grows out of nothing through methylating, wherein is that S-adenosylmethionine is as methyl donor from phosphatidylethanolamine (being called for short PE) promptly; The secondth, salvage pathway, promptly choline synthesizes Yelkin TTS through the CDP-choline.The main source of Yelkin TTS is the second approach in the organism, and article one approach major part all has been limited in liver inside, and wherein the effect of phosphatidyl ethanolamine-N-methyltransferase (PEMT) is exactly methylating of catalysis PE-PC.

In vivo, in most of existence of phosphatidyl ethanolamine-N-methyltransferase (phosphotidylethanolamine N-methyltransferase abbreviates " PEMT " as) and the liver, it exists with two kinds of forms.1:PEMT1 mainly is distributed in the endoplasmic reticulum, and the isomeric form PEMT2 of 2:PEMT1 only exists on the film that plastosome connects.Methylating of PE-PC changes the existence that requires these two kinds of enzymes at least in liver.Along with rat cdna, people's relevant PEMT gene, the clone in succession of little musculus cdna, advanced the further investigation of its important biomolecule being learned function in recent years.

It is now know that, PEMT is present in Rhodibacter sphacroides, yeast, chicken gizzard, the rodent liver, human liver, this statement of facts the PE approach of methylating be very important, and on evolving, be (the Cui that guards, Z.et al.Biochem.Biophys.Acta.1997,1346 (1997), 10-16.) 1993 years, the lipid of Canada Alberta university and the lipoprotein research department at first screens PEMT in rats'liver cDNA library cDNA, Northern result shows the long 1Kb of its mRNA (Zheng Cui et al.J.Biology.Chem.1993,268 (22), 16655-16663).This group is the cDNA clone that probe has found first human PEMT2 with the rat cdna afterwards.Find that simultaneously each cDNA clone has the non-translational region of 5 different ' ends, this zone may with the specificity relevant (Dennis E.Vance etc BBA 1348 (1997) 142-150) of tissue.1996, this research group be cloned into again mouse the PEMT2 gene (Christopher J.walkey etcJournal of lipid Research V37 1996,2341-2350).

As everyone knows, CDP-choline approach plays an important role in zooblast.It is studies have shown that of object that experiment in vitro reaches with the rat, phosphatidylcholine synthetic PE methylates to have closely between approach and the CDP-choline approach and gets in touch, as if exist negative relation of regulating between the two, yet, as if the PE approach that methylates can not replace CDP-choline approach (J.Biol.Chem.1995,270,16277-16282).So, what kind of role has PEMT played the part of in vivo actually?

Present result of study shows PEMT and hepatocellular hyperplasia, inhibition, and neurone wax sample lipofuscin precipitation disease all many-sides such as (neuronal ceroid lipofuscinosis are called BattenShi disease again) all have confidential relation.

Feed to lack the food of choline to rat.About Samsung after date PEMT2 begins to roll up, and is increased to be about previous 5 times after 12 week.This has hinted the effect of PEMT aspect the rat growth of keeping short-term choline shortage.Keep a sufficiently long time and can make rat responsive more when choline lacks cancer, this whether and get in touch to some extent between PEMT be still waiting research (Cui, Z.et al.J.Biol.Chem.1996,271,2839-2843).

Genetic knock-out experiment has very strong cogency for the function of understanding gene.The diet of implementing the shortage choline in the mouse that weanling PEMT rejects can cause the death of mouse, illustrates that PEMT plays a part to keep animal normal growth and liver normal function really in the animal that choline lacks.But pondered-over was, the mouse that lacks PEMT did not mostly have tangible pathologic phenotype up to 10 months, further research carry out (Proc.Natl.Acad.Sci.1997,94,12880-12885).

A series of research model has shown the vital role of PEMT2 aspect the control liver cell growth, these models comprise to enclose the research that changes of mouse liver of living phase (Cui, Z.et al.Biochem.Biophys.Acta.1997,1346,10-16.); Regeneration after the part excision of rats'liver (Biochem.Biophys.Acta.1997,1346,1-9); Inject lead nitrate and cause liver blood slurry too much (Biochem.Biophys.Acta.1997,1346 (1997), 10-16; Biochem.Biophys.Acta.1997,1348,142-150).These studies show that the expression of PEMT2 plays the liver cell splitted effect that suppresses.This makes the people recall the effect of PEMT in liver cancer very naturally.In fact really in fact showed PEMT2 unconventionality expression has been arranged in liver cancer tissue.Another interesting fact is, the PEMT2 gene of mouse is positioned at karyomit(e) No. 11, and this zone is corresponding to human chromosome 5q or 17p, and these two zones all are considered to the focus that suddenlys change, and they are all deleted in primary (primary) liver cancer.The problem that the relation of PEMT2 and liver cancer is interesting really (J.Lipid.Res.1996,37,2341-2350).

Yet, before the present invention, the human phospholipase acyl ethanolamine-N-methyltransferase that relates among the application was not disclosed.

An object of the present invention is to provide a kind of new polynucleotide, a newcomer of this polynucleotide encoding phosphatidyl ethanolamine-N-methyltransferase family, phosphatidyl ethanolamine-N-methyltransferase of the present invention is named as people PEMTH (GenBank Accession No.AF044214) (because of applying for secret for some time, so this sequence is not open to the public before the application).

Another object of the present invention provides a kind of new human phosphatidyl ethanolamine-N-methyltransferase family member, and this enzyme is named as people PEMTH albumen.

A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new human phosphatidyl ethanolamine-N-methyltransferase.

The present invention also provides the application of this people PEMTH gene order and polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people PEMTH protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 84-683 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 84-683 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 84-683 position.

In another aspect of this invention, provide a kind of isolating people PEMTH protein polypeptide, it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.

In another aspect of this invention, provide a kind of described carrier transformed host cells.

In another aspect of this invention, provide a kind of generation to have the method for the polypeptide of people PEMTH protein-active, this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people PEMTH protein-active operationally is connected in expression regulation sequence, form people PEMTH protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 84-683 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people PEMTH;

(c) under the condition that is fit to expressing human PEMTH protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people PEMTH protein-active.

In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 828 Nucleotide, and its detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 84-683 position Nucleotide.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people PEMTH albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people PEMTH protein-active is as 84-683 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO:3.This degenerate sequence is meant, is arranged in the encoder block 84-683 position Nucleotide of SEQ ID NO:3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO:3 in 84-683 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO:4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 84-683 position.In addition, this term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 84-683 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.

This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO:3 with people PEMTH identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people PEMTH protein polypeptide " refers to have the SEQ IDNO:4 polypeptide of sequence of people PEMTH protein-active.This term also comprises having and the variant form human efficient lymphocyte chemotactic factor identical function, SEQ ID NO:4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people PEMTH and reactive derivative.

The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of people PEMTH DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people PEMTH polypeptide to obtain.The present invention also provides other polypeptide, as comprises people PEMTH polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention also provides the soluble fragments of people PEMTH polypeptide.Usually, this fragment have people PEMTH peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of people PEMTH albumen or polypeptide.The difference of these analogues and natural human PEMTH polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue can also comprise having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

The present invention also comprises the antisense sequences of people PEMTH polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of people PEMTH in the cell.

The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people PEMTH polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people PEMTH.

The present invention also comprises the method that detects people PEMTH nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer can be positioned at the both sides or the centre of this encoding sequence corresponding to the encoding sequence of people PEMTH polypeptide.Primer length is generally 20-50 Nucleotide.

In the present invention, can select various carrier known in the art for use, as commercially available carrier.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

On the other hand, the present invention also comprises people PEMTH DNA or the polypeptide of its fragment coding has specific antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people PEMTH gene product or fragment.Preferably, refer to that those can combine with people PEMTH gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people PEMTH, comprise that also those do not influence the antibody of people PEMTH protein function.The present invention also comprise those can with modify or without the people PEMTH gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people PEMTH gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human PEMTH or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people PEMTH function and the antibody that does not influence people PEMTH function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people PEMTH gene product, obtains by immunological technique.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people PEMTH gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

People PEMTH nucleotide sequence full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or the cDNA storehouse of press the currently known methods preparation as template, increase and must be about sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Certainly, by first synthetic a plurality of small segments, and then connect and obtain the very long fragment of sequence.

In the present invention, the cDNA nucleotide sequence of people PEMTH is so to obtain, with people's liver λ gt11cDNA library (available from Clontech company) is template, synthetic forward primer A1:5 '-GAGGTAACGAACAGCTCGGTGGC-3 ' (SEQ ID NO:1), with reverse primer A2:5 '-CAAGGCAGCAGGTTCCAAGGCAC-3 ' (SEQ ID NO:2), carry out PCR, obtain the purpose fragment of 828bp.Obtain the full length cDNA sequence of SEQ ID NO:3 after the order-checking.

Find that by homology retrieval the PEMT gene of above-mentioned sequence and rat homology highly on nucleic acid level then all has high homology with the PEMT of mouse, rat on protein level.

Known PEMT is relevant with hepatocellular division growth, and its expression level has obvious variation in ontogenetic process, and this growth occurs on the level of genetic expression.Find that simultaneously the activity of PEMT almost can not find out in the liver cancer derived cell system, and the PE methylation level is also than the obvious reduction of normal hepatocytes, and do not have PEMT2 albumen, PEMT2 expresses also and reduces greatly in the non-tumorigenic growth.These phenomenons show that the activity of PEMT may be close with being related of liver cancer.Therefore cDNA and the polypeptide (enzyme) of the human PEMT that is separated to of the present invention provide an approach for research liver cancer.

In addition, the proteic low expression of PEMT2 is relevant with the phenotype of the organism that has mnd (motor Neuron Degeneration) gene, and its phenotype is a neurone wax sample lipofuscin precipitation disease (it is characterized in that taking place the lipid deposition of defective in neurone).Therefore cDNA and the polypeptide (enzyme) of the human PEMT that is separated to of the present invention provide an approach for treating this type of disease.

In the accompanying drawings,

Fig. 1 is the homology comparison diagram of the nucleotide sequence of people PEMTH of the present invention and P of Rats EMT.Wherein, identical Nucleotide marks with " | ".

Fig. 2 is the homology comparison diagram of people PEMTH of the present invention and rat and the proteic aminoacid sequence of mouse PEMT.Wherein, identical amino acid marks with " * " below three sequences, in 3 sequences similarity preferably amino acid mark with " ".

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone and the mensuration of the cDNA sequence of people PEMTH

1. primer amplification

With people's liver λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A1:5 '-GAGGTAACGAACAGCTCGGTGGC-3 ' (SEQ ID NO:1), oligonucleotide A2:5 '-CAAGGCAGCAGGTTCCAAGGCAC-3 ' (SEQ ID NO:2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 74 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains, its length are 828bp.

2.PCR the order-checking of product

This section pcr amplification product A1/A2 that as above obtains is connected with pGEM-T carrier (Promega), transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque with double-stranded nested type disappearance test kit (Pharmacia) to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then.Use SequiTherm EXCEL ^TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 828bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 84-683 position Nucleotide.

Derive the aminoacid sequence of people PEMTH according to the full-length gene group sequence that obtains, totally 199 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.

Embodiment 2

Homology comparison and structural research

The full length cDNA sequence of personnel selection PEMTH and proteins encoded thereof carry out nucleic acid and albumen homology retrieval with BLAST in Non-redundantGenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDStranslations+PDB+SwissProt+Spupdate+PIR database.Height homology (about 80% identity) is (Fig. 1) on nucleic acid level for the PEMT gene that found that its nucleotide sequence and rat, on protein level then with the PEMT of mouse, rat all have high homology (with the identity of mouse be about 76%, similarity is about 86%; With the identity of rat be 77%, similarity is 86%) (Fig. 2).So, can determine that people PEMTH and they have constituted a family, and can infer the function of people PEMTH of the present invention from these genes or proteic function.

Known PEMT is relevant with hepatocellular division growth, and before and after perinatal period, the activity of PEMT has very big variation.The activity of PEMT is very low in that the division of embryo's liver cell growth in period is rapid; After the birth, the active of PEMT raises rapidly, and hepatocellular growth then slowly descends, and this growth occurs on the level of genetic expression.Find that simultaneously the activity of PEMT almost can not find out in quick splitted MCA-RH777 and these liver cancer derived cells systems of HepG2.In liver cancer cell, the PE methylation level is than the obvious reduction of normal hepatocytes, and do not have PEMT2 albumen, and PEMT2 expresses also and reduces greatly in the non-tumorigenic growth.These phenomenons show that the activity of PEMT may be close with being related of liver cancer.Therefore cDNA and the polypeptide (enzyme) of the human PEMT that is separated to of the present invention provide an approach for research liver cancer.

Genetic knock-out experiment provides the information of relevant PEMT function equally.The diet of implementing the shortage choline in the mouse that weanling PEMT rejects can cause the death of mouse, illustrates that PEMT plays a part to keep animal normal growth and liver normal function really in the animal that choline lacks.

In addition, the proteic low expression of PEMT2 is relevant with the phenotype of the organism that has mnd (motor Neuron Degeneration) gene, and its phenotype is a neurone wax sample lipofuscin precipitation disease (it is characterized in that taking place the lipid deposition of defective in neurone).Therefore cDNA and the polypeptide (enzyme) of the human PEMT that is separated to of the present invention provide an approach for treating this type of disease.

People PEMTH of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor PEMTH can also merge with other members of this family or exchange fragment, to produce new albumen.For example the N end of inventor PEMTH and the N end of rat or mouse PEMT are exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor PEMTH, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

For example, inventor PEMTH nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people PEMTH or the overexpression that suppresses people PEMTH.People PEMTH albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people PEMTH disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Embodiment 3

The expression of people PEMTH in intestinal bacteria

In this embodiment, with the cDNA sequence (GenBank Accession No.AF044214) of coding people PEMTH use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers of 3 ' end increase, obtain people PEMTH cDNA as inserting fragment.

PCR reaction 5 ' Oligonucleolide primers sequence is:

5′-AGAGGTCGACATGACCCGGCTGCTGGGCT-3′(SEQ?ID?NO.5)

This primer contains the restriction enzyme site of SalI restriction enzyme, and what connect is 19 Nucleotide of the people PEMTH encoding sequence that begun by initiator codon;

3 ' end primer sequence is:

5′-GAAGAAGCTTTCAGCTCCTCTTGTGGGAC-3′(SEQ?ID?NO.6)

This primer contains the restriction enzyme site of HindIII restriction enzyme, 19 Nucleotide of terminator codon and people PEMTH encoding sequence;

The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Ampr), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.

Use HindIII, SalI digestion pQE-9 carrier will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kanr).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid, the cDNA fragment of sequence verification people PEMTH has correctly been inserted carrier.

Incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD ₆₀₀) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved people PEMTH from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out people PEMTH from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.At first, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein can be incorporated in second post from nickel-chelate column, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 22kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO:4 with ordinary method.

Embodiment 4

The expression of people PEMTH in eukaryotic cell (Chinese hamster ovary celI strain)

In this embodiment, with the cDNA sequence (GenBank AccessionNO:AF044214) of coding people PEMTH use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers of 3 ' end increase, obtain people PEMTH cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5′-AGAGAAGCTTATGACCCGGCTGCTGGGCT-3′(SEQ?ID?NO.7)

This primer contains the restriction enzyme site of HindIII restriction enzyme, and what connect is 19 Nucleotide of the people PEMTH encoding sequence that begun by initiator codon;

3 ' end primer sequence is:

5′-GAAGGAGCTCTCAGCTCCTCTTGTGGGAC-3′(SEQ?ID?NO.8)

This primer contains the encoding sequence of the restriction enzyme site of SacI restriction enzyme, translation termination and people PEMTH.The restriction enzyme site of restriction enzyme is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, and this plasmid vector coding antibiotics resistance (Ampr and Neor), a phage replication starting point (fl ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA are in proper order.

Use HindIII, SacI digestion pcDNA3 carrier will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid is cut evaluation with the BstxI enzyme and is inserted clip size and direction, and the cDNA fragment of sequence verification people PEMTH has correctly been inserted carrier.

Plasmid transfection is to adopt lipofection, carries out with Lipofectin test kit (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mM TrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 22kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO:4 with ordinary method.

Embodiment 5

Preparation antibody

The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, specific as follows.Recombinant protein is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people PEMTH gene translation product with it.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table (1) general information: (i) applicant: Xinhuangpu-Fudan Gene Engineering Co., Ltd., Shanghai is denomination of invention (ii): human phosphatidyl ethanolamine-N-methyltransferase, its encoding sequence and preparation method be the sequence number (iii): information (i) sequence signature of 8 (2) SEQ ID NO:1

(A) length: 23 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:1:GAGGTAACGA ACAGCTCGGT GGC 23 (2) SEQ ID NO:2

(A) length: 23 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:2CAAGGCAGCA GGTTCCAAGG CAC 23 (2) SEQ ID NO:3: (i) sequence signature:

(A) length: 828bp

(B) type: nucleic acid

(C) chain: strand

( D ) ： ( ii ) ：cDNA ( xi ) ：SEQIDNO：3 1 GAGGTAACGAACAGCTCGGTGGCAGGGCTGACTGCTGCGGAGGCCTCGGCAATATTGATT 61 TTAGACAGGCAGACTTCTGCGTTATGACCCGGCTGCTGGGCTACGTGGACCCCCTGGATC121 CCAGCTTTGTGGCTGCCGTCATCACCATCACCTTCAATCCGCTCTACTGGAATGTGGTTG181 CACGATGGGAACACAAGACCCGCAAGCTGAGCAGGGCCTTCGGATCCCCCTACCTGGCCT241 GCTACTCTCTAAGCGTCACCATCCTGCTCCTGAACTTCCTGCGCTCGCACTGCTTCACGC301 AGGCCATGCTGAGCCAGCCCAGGATGGAGAGCCTGGACACCCCCGCGGCCTACAGCCTGG361 GCCTCGCGCTCCTGGGACTGGGCGTCGTGCTCGTGCTCTCCAGCTTCTTTGCACTGGGGT421 TCGCTGGAACTTTCCTAGGTGATTACTTCGGGATCCTCAAGGAGGCGAGAGTGACCGTGT481 TCCCCTTCAACATCCTGGACAACCCCATGTACTGGGGAAGCACAGCCAACTACCTGGGCT541 GGGCCATCATGCACGCCACGCCCACGGGCCTGCTCCTGACGGTGCTGATGGCCCTCACCT601 ACATAGTGGCTCTCCTATACGAAGAGCCCTTCACCGCTGAGATCTACCGGCAGAAAGCCT661 CCGGGTCCCACAAGAGGAGCTGATTGAGCTGCAACAGCTTTGCTGAAGGCCTGGCCAGCC721 TTCTCATCGTCCCCAAGTGGCAGGCCCTGCGCAGGGCGAGAATGGTGCCTGCTGCTCAGG781 GCCTCCCCCGGCGTGGGCTGCCCCAGTGCCTTGGAACCTGCTGCCTTG ( 2 ) SEQ ID NO：4： ( i ) ：

(A) length: 199 amino acid

(B) type: amino acid

( D ) ： ( ii ) ： ( xi ) ：SEQ ID NO：4 1 Met Thr Arg Leu Leu Gly Tyr Val Asp Pro Leu Asp Pro Ser Phe 16 Val Ala Ala Val Ile Thr Ile Thr Phe Asn Pro Leu Tyr Trp Asn 31 Val Val Ala Arg Trp Glu His Lys Thr Arg Lys Leu Ser Arg Ala 46 Phe Gly Ser Pro Tyr Leu Ala Cys Tyr Ser Leu Ser Val Thr Ile 61 Leu Leu Leu Asn Phe Leu Arg Ser His Cys Phe Thr Gln Ala Met 76 Leu Ser Gln Pro Arg Met Glu Ser Leu Asp Thr Pro Ala Ala Tyr 91 Ser Leu Gly Leu Ala Leu Leu Gly Leu Gly Val Val Leu Val Leu106 Ser Ser Phe Phe Ala Leu Gly Phe Ala Gly Thr Phe Leu Gly Asp121 Tyr Phe Gly Ile Leu Lys Glu Ala Arg Val Thr Val Phe Pro Phe136 Asn Ile Leu Asp Asn Pro Met Tyr Trp Gly Ser Thr Ala Asn Tyr151 Leu Gly Trp Ala Ile Met His Ala Thr Pro Thr Gly Leu Leu Leu166 Thr Val Leu Met Ala Leu Thr Tyr Ile Val Ala Leu Leu Tyr Glu181 Glu Pro Phe Thr Ala Glu Ile Tyr Arg Gln Lys Ala Ser Gly Ser196 His Lys Arg Ser ( 2 ) SEQ ID NO：5 ( i )

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:5:AGAGGTCGAC ATGACCCGGC TGCTGGGCT 29 (2) SEQ ID NO:6

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:6:GAAGAAGCTT TCAGCTCCTC TTGTGGGAC 29 (2) SEQ ID NO:7

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:7:AGAGAAGCTT ATGACCCGGC TGCTGGGCT 29 (2) SEQ ID NO:8

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:8:GAAGGAGCTC TCAGCTCCTC TTGTGGGAC 29

Claims (14)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people PEMTH protein-active,

Show at least 70% homology from the nucleotides sequence of Nucleotide 84-683 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps

Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 84-683 position.

2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from the 84-683 position.

4. isolating people PEMTH protein polypeptide is characterized in that it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

6. a carrier is characterized in that, it contains the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.

9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.

10. a generation has the method for the polypeptide of people PEMTH protein-active, it is characterized in that this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people PEMTH protein-active operationally is connected in expression regulation sequence, form people PEMTH protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 84-683 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people PEMTH;

(c) under the condition that is fit to expressing human PEMTH protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people PEMTH protein-active.

11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 84-683 position among the SEQ ID NO.3.

12. energy and the described people PEMTH of claim 4 protein polypeptide specificity bonded antibody.

13. a nucleic acid molecule is characterized in that, it is the antisense sequences of the described dna molecular of claim 1.

14. a probe molecule is characterized in that, it contains about 8-100 continuous nucleotide in the described dna molecular of claim 1.

Images