CN1287169A - New human G protein protomer and its code sequence - Google Patents

Abstract

The present invention provides the cDNA sequence of a new human gamma 12 subunit of G protein (hG-gamma12). The cDNA encoded protein is the homologue of ox gamma 12 subunit of G protein. The present invention also provides the nucleotide encoded polypeptide, the application of the polynucleotide and the polypeptide, and the production process of the polynucleotide and the polypeptide.

Description

New human G protein protomer and encoding sequence thereof

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of human g-protein γ 12 subunits (human γ 12 subunit of G protein, hG-γ 12), this cDNA encoded protein is the homologue of ox G albumen γ 12 subunits.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.

G albumen (guanylic acid is in conjunction with regulating albumen) participates in many signal transduction paths, and the extracellular signal that cell surface receptor is accepted conducts to born of the same parents' internal effect thing.G albumen is made up of three subunits, is called G α, G β and G γ.When the three forms heterotrimer G α β γ, be in inactive state, after aglucon activated acceptor and this heterotrimer coupling, cause the change of configuration of G α, discharge guanosine diphosphate(GDP) (GDP), in conjunction with guanosine triphosphate (GTP).G β and G γ dissociate with the G α that combines GTP with the form (G β γ) of the mixture of combining closely then.Free G β γ mixture and activated G α-GTP can both be independently, collaborative or antagonism ground acts on specific effector molecule, thereby change second messenger's concentration causes specific cell processes to change.The GTP that is incorporated into G α is hydrolyzed to GDP, and discharges phosphoric acid, causes G α inactivation, and G β γ combines with G α again, last heterotrimer and acceptor coupling once more.More than be exactly mechanism (Neer, E.J.1995, the Cell 80:249-257 of G albumen conducted signal; Gilman, A.G.1995, Angew.Chem.Int.Ed.Engl.34:1406-1419; Dolman, H.G.et al.1991, Annu.Rev.Biochem.60:653-688; Casey, P.J.et al.1994 Curr.Opin.Cell.Biol.6:219-225).

Proteic three subunits of G all have a lot of isomer.Up to now, the β subunit of having found in Mammals has 5 kinds (β 1, β 2, β 3, β 4, β 5), and the γ subunit has 11 kinds (γ 1, γ 2, γ 3, γ 4, γ 5, γ 7, γ 8, γ 10, γ 11, γ 12, γ c).Amino-acid sequence comparison shows that according to the size of similarity degree, β subunit and γ subunit can be divided into subfamily, wherein the otherness of γ subunit more remarkable (Gautam, N.et al.1998, Cell Signal 10:447-455).The albumen primary structure of ox γ 12 subunits obtains by the proteolysis order-checking, and its cDNA sequence is also corresponding to be obtained from spleen.γ 12 tissue distribution are extensive, in inoblast and smooth myocyte content abundant (Morishila, R.et al.1995, J.Biol.Chem.270:29469-26475).

Experiment shows that β γ mixture is essential for G albumen with combining of acceptor, and directly works.Under certain conditions, β γ mixture energy and receptors bind, and the peptide section of Visual purple (a kind of acceptor) C end can hinder its interaction, and this prompting β γ and acceptor have direct effect.If G albumen contains different γ subunits, then different with the coupling efficiency of Visual purple, show directly combining of influence and acceptor of γ subunit.From γ 1, identify and the direct bonded structural domain of Visual purple, also found and the necessary specific residue of receptors bind (Phe64, Leu67, farnesyl part) (Gautam, N.et al.1998, Cell Signal 10:447-455).

β γ mixture is except having the regulating effect acceptor, and the pairing effect thing also has effect.Finding that β γ mixture can activate K ⁺Behind the passage, other effector that regulated by β γ mixture has: adenyl cyclase, Phospholipase C β, valtage-gated Ca ⁺Passage, brain Na ⁺Passage, these effector all directly act on β γ mixture.Other and the direct acting albumen of β γ mixture have: calmodulin, Beta-3 adrenergic receptor kinases, dynein, phosducin, phosducin-like protein, more than these reaction meetings indirect make the cell (Phe64 that changes, Leu67, the farnesyl part) (Gautam, N.et al.1998, Cell Signal 10:447-455).

Show G albumen and subunit thereof and some disease-related.Therefore, it is significant to research and develop human g-protein γ subunit and agonist/inhibitor thereof for therapeutic purpose.

An object of the present invention is to provide a kind of new polynucleotide, these polynucleotide are named as human g-protein γ 12 subunits (human γ 12 subunit of Gprotein abbreviate " hG-γ 12 " as) gene.

Another object of the present invention provides a kind of new people hG-γ 12 albumen.

A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new people's hG-γ 12 polypeptide.

The present invention also provides this people's hG-γ 12 nucleotide sequences and the application of polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people hG-γ 12 protein-actives, shows at least 70% homology from the nucleotides sequence of Nucleotide 50-268 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 50-268 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQID NO.3 nucleotide sequence from Nucleotide 50-268 position.

In another aspect of this invention, provide a kind of isolating people hG-γ 12 protein polypeptides, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.

In another aspect of this invention, provide a kind of described carrier transformed host cells.

In another aspect of this invention, provide a kind of generation to have the method for the polypeptide of people hG-γ 12 protein-actives, this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people hG-γ 12 protein-actives operationally is connected in expression regulation sequence, form people hG-γ 12 protein expression vectors, show at least 70% homology from the nucleotides sequence of Nucleotide 50-268 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form people hG-γ 12 proteic reconstitution cells;

(c) under the condition that is fit to expressing human hG-γ 12 protein polypeptides, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people hG-γ 12 protein-actives.

In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 278 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 50-268 position Nucleotide.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people hG-γ 12 albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people hG-γ 12 protein-actives is as 50-268 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 50-268 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 50-268 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with among the SEQ ID NO.3 from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 50-268 position.Also term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 50-268 position, preferably at least 80%, more preferably at least 90%, at least 98% nucleotide sequence best.

This term also comprises encoding to have variant form with proteic, the SEQ ID NO.4 sequence of people hG-γ 12 identical functions.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and add several at 5 and/or 3 ends and (be generally in 60, preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

Encoding sequence of the present invention can be DNA or RNA, can be strand or two strands.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people hG-γ 12 protein polypeptides " refers to have the SEQ IDNO.4 polypeptide of sequence of people hG-γ 12 protein-actives.This term also comprises having and variant form people hG-γ 12 identical functions, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises people hG-γ 12 proteic active fragments and reactive derivatives.

The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people hG-γ 12 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people hG-γ 12 polypeptide to obtain.The present invention also provides other polypeptide, as comprises people hG-γ 12 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people hG-γ 12 polypeptide.Usually, this fragment have people hG-γ 12 peptide sequences at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 60 continuous amino acids, best at least about 70 continuous amino acids.

Invention also provides the analogue of people hG-γ 12 albumen or polypeptide.The difference of these analogues and natural human hG-γ 12 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " people hG-γ 12 conservative propertys variation polypeptide " refer to compare with the aminoacid sequence of SEQ ID No.4, have 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.The best basis of these conservative property variation polypeptide

Table 1 carries out amino acid and replaces and produce.

Table 1

Initial residue	Representational replacement	The preferred replacement
			????Ala(A)	????Val；Leu；Ile	????Val
????Arg(R)	????Lys；Gln；Asn	????Lys
			????Asn(N)	????Gln；His；Lys；Arg	????Gln
????Asp(D)	????Glu	????Glu
			????Cys(C)	????Ser	????Ser
????Gln(Q)	????Asn	????Asn
			????Glu(E)	????Asp	????Asp
????Gly(G)	????Pro；Ala	????Ala
			????His(H)	????Asn；Gln；Lys；Arg	????Arg
????Ile(I)	????Leu；Val；Met；Ala；Phe	????Leu
			????Leu(L)	????Ile；Val；Met；Ala；Phe	????Ile
????Lys(K)	????Arg；Gln；Asn	????Arg
			????Met(M)	????Leu；Phe；Ile	????Leu
????Phe(F)	????Leu；Val；Ile；Ala；Tyr	????Leu
			????Pro(P)	????Ala	????Ala
????Ser(S)	????Thr	????Thr
			????Thr(T)	????Ser	????Ser
????Trp(W)	????Tyr；Phe	????Tyr
			????Tyr(Y)	????Trp；Phe；Thr；Ser	????Phe
????Val(V)	????Ile；Leu；Met；Phe；Ala	????Leu

The present invention also comprises people hG-γ 12 polypeptid coding sequences and segmental antisense sequences thereof.This antisense sequences can be used for suppressing the expression of people hG-γ 12 in the cell.

The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people hG-γ 12 polypeptid coding sequences, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people hG-γ 12.

The present invention also comprises the method that detects people hG-γ 12 nucleotide sequences, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of people hG-γ 12 polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.

In the present invention, can select various carrier known in the art for use, as commercially available carrier.Such as, select commercially available carrier for use, the nucleotide sequence with code book invention polypeptide operationally is connected in expression regulation sequence then, can form protein expression vector.

As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

On the other hand, the present invention also comprises people hG-γ 12 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people hG-γ 12 gene products or fragment.Preferably, refer to that those can combine with people hG-γ 12 gene products or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress people hG-γ 12 proteic molecules, comprise that also those do not influence the antibody of people hG-γ 12 protein functions.The present invention also comprise those can with modify or without the people hG-γ 12 gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ＇ or (Fab) 2 fragments; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, people hG-γ 12 gene products of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human hG-γ 12 or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people hG-γ 12 functions and the antibody that does not influence people hG-γ 12 functions.Each antibody-like of the present invention can utilize the fragment or the functional zone of people hG-γ 12 gene products, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E..Coli) with the unmodified form bonded antibody of people hG-γ 12 gene products; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

People hG-γ 12 Nucleotide full length sequences of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally with its human cloning carrier, changes cell over to again, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.At present, can be fully come the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.Then can be with in dna molecular (or as carrier) and the cell in this dna sequence dna introducing this area.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

The proteic fragment of the present invention, except producing with recombination method, also available solid phase technique is produced (people such as Stewart, (1969) Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco by direct peptide synthesis; Merrifield J. (1963) J.Am Chem.Soc 85:2149-2154).Can carry out by hand or automatically at external synthetic protein.For example, can (Foster City CA) synthesizes peptide automatically with the 43lA type peptide synthesizer of Applied Biosystems.Can distinguish proteic each fragment of chemosynthesis the present invention, be connected to produce the molecule of total length with chemical process then.

The proteic encoding sequence of the present invention also can be used for the assignment of genes gene mapping.For example,, the cDNA clone is hybridized with the karyomit(e) of metaphase, can carry out chromosomal localization exactly by fluorescence in situ hybridization technique (FISH).This technology can be used the cDNA that is as short as about 500bp; Also can use and grow to about 2000bp or longer cDNA.For this technology, can be referring to people such as Verma, Human Chromosomes:A Manual of Basic Techniques, Pergamon Press, New York (1988).

In case sequence is located in certain exact position on the karyomit(e), the physical location of sequence on karyomit(e) can be associated with the genetic map data.These genetic map data can obtain, for example by Mendelian (Mendelian) people genetic database (can obtain on the net by Johns Hopkins University Welch MedicalLibrary).Then, come identified gene by linkage analysis and be positioned dependency between the disease of same chromosomal region.

Then, be necessary to determine the cDNA between diseased individuals and the healthy individual or the difference of genome sequence aspect.Be not present in normal individual if a certain sudden change is present in part or all of diseased individuals, this sudden change may be exactly the paathogenic factor of this disease so.

Utilize albumen of the present invention,, can filter out with hG-γ 12 interactional material takes place, as acceptor, inhibitor or antagonist etc. by various conventional screening methods.

Albumen of the present invention and antibody thereof, inhibitor, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is generally about 5-8, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, subcutaneous, intracutaneous or topical.

With people hG-γ 12 albumen of the present invention is example, can be with itself and suitable pharmaceutically acceptable carrier coupling.This class pharmaceutical composition contains protein and the pharmaceutically acceptable carrier or the vehicle for the treatment of significant quantity.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.People hG-γ 12 albumen of the present invention can be made into the injection form, for example are prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.

When people hG-γ 12 protein polypeptides of the present invention are used as medicine, this polypeptide of treatment effective dose can be applied to Mammals, wherein should treat effective dose usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

In an example of the present invention, the cDNA nucleotide sequence of people hG-γ 12 is so to obtain, with people's kidney λ gtllcDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A:5 '-TTGGACCACACAAAGTCTTACTG-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 ＇-CTCTATTCCACTATAAGATGATGC-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 62 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains is about the purpose fragment of 300bp.

To discovering of β γ mixture, β γ mixture all has effect for acceptor, effector.β γ mixture and acceptor directly act on, and the effector that regulated by β γ mixture has: K ⁺Passage, adenyl cyclase, Phospholipase C β, valtage-gated Ca ⁺Passage, brain Na ⁺Passage.Also has some and the direct acting albumen of β γ mixture: calmodulin, Beta-3 adrenergic receptor kinases, dynein, phosducin, phosducin-likeprotein, more than these reaction meetings indirect make the cell (Phe64 that changes, Leu67, the farnesyl part) (Gautam, N.et al.1998, Cell Signal 10:447-455).

Experiment shows that γ 12 different in kinds are in other γ subunit: can be by the protein kinase C phosphorylation, that the β γ 12 of phosphorylation combines with G α is tightr (Morishila, R.et al.1995, J.Biol.Chem.270:29469-26475).γ 12 can also cause the inoblast mobility increase (Ueda, H.et al.1999, J.Biol.Chem.274:12124-12128).

Because people hG-γ 12 of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.

In the accompanying drawings,

Fig. 1 is people hG-γ 12 of the present invention and 3 kinds of proteic amino acid sequence homologous comparison diagrams such as ox G albumen γ 12 subunits (bG-γ 12) and rat G albumen γ 12 subunits (rG-γ 12) subunit.Wherein, identical amino acid marks with " * " below sequence, and similar amino acid marks with ". ".Similar amino acid is: A, S, T; D, E; N, Q; R, K; I, L, M, V; F, Y, W.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone and the mensuration of the cDNA sequence of people hG-γ 12

1. primer amplification

With people's kidney λ gtllcDNA library (available from Clontech company) is template, with-be primer to oligonucleotide--A:5 ＇-TTGGACCACACAAAGTCTTACTG-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-CTCTATTCCACTATAAGATGATGC-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 62 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The purpose fragment of the about 300bp of PCR segment that electrophoresis detection obtains.

2.PCR the order-checking of product

Above-mentioned pcr amplification product AB is connected with pGEM-T carrier (Promega), and transformed into escherichia coli JM103 extracts plasmid with QIAprep Plasmid test kit (QIAGEN), uses SequiTherm EXCEL ^TMDna sequencing kit (Epicentre Technologies) checks order to inserting fragment, with computer software splicing order, obtain full length cDNA sequence at last, altogether 278bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 50-268 position Nucleotide.

Derive the aminoacid sequence of people hG-γ 12 according to the full length cDNA sequence that obtains, totally 72 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.

Embodiment 2

Homology relatively

Full length cDNA sequence and proteins encoded thereof with people hG-γ 12 of the present invention, in Non-redundantGenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDStranslations+PDB+SwissProt+Spupdate+PIR database, carry out nucleic acid and albumen homology retrieval with blast program.Found that on nucleotide level and protein level, higher homology is all arranged with ox G-γ 12 (gb|U37561), rat G-γ 12 (gb|AF022091).Reach in the identity of nucleotide level hG-γ 12 and ox, rat G-γ 12 and to reach 90%, 86% respectively.HG-γ 12 derivation albumen and ox, rat G-γ 12 proteic identity reach all to 94% on protein level, and similarity reaches 97%, 98% (hG-γ 12 relatively sees Fig. 1 with ox, rat three's homology).

According to the structures shape function, the Biological Principles that the structural similitude function is relevant can be inferred the biological function of hG-γ 12 of the present invention according to the function of gene in the known different plant species and proteins encoded thereof.

The γ subunit has a common feature: (Fukada is modified by lipid groups-farnesyl or Mang Niu Er Mang Niu Erji in the translation back, Y.et al.1990, Nature 346:658-660), this isoprenoid group is connected on four amino acid whose cysteine residues of C-terminal, last three residues of γ subunit are hydrolyzed then, and carboxyl is methylated.The lipid of this modification has albumen is positioned function on the film, the interaction of stablizing β γ mixture and α subunit, acceptor, effector.HG-γ 12 of the present invention is halfcystines from four amino acid whose residues of C-terminal, and there is the function of the stabilize proteins effect of the posttranslational modification of isoprenoid group and this modification in prompting.

The function of β γ mixture is many-sided, for acceptor and effector in the signal conduction effect is arranged all.Under certain conditions, β γ mixture energy and receptors bind, and the peptide section of Visual purple (a kind of acceptor) C end can hinder its interaction, and prompting β γ and acceptor have direct effect.If G albumen contains different γ subunits, then different with the coupling efficiency of Visual purple, show directly combining of influence and acceptor of γ subunit.From γ 1, identify and the direct bonded structural domain of Visual purple, also found and the necessary specific residue of receptors bind (Phe64, Leu67, farnesyl part) (Gautam, N.et al.1998, Cell Signal 10:447-455).

β γ mixture is except having the regulating effect acceptor, and the pairing effect thing also has effect.Finding that β γ mixture can activate K ⁺Behind the passage, other effector that regulated by β γ mixture has: adenyl cyclase, Phospholipase C β, valtage-gated Ca ⁺Passage, brain Na ⁺Passage, these effector all directly act on β γ mixture.Other and the direct acting albumen of β γ mixture have: calmodulin, Beta-3 adrenergic receptor kinases, dynein, phosducin, phosducin-like protein, more than these reaction meetings indirect make the cell (Phe64 that changes, Leu67, the farnesyl part) (Gautam, N.et al.1998, Cell Signal 10:447-455).

β subunit and γ subunit kind are many, and be similar on the order, and β γ mixture diverse in function, and this points out the function of various γ subunits similar substantially but slightly different.

Ox γ 12 subunits be studies show that its different in kind is in other γ subunit: can be by the protein kinase C phosphorylation, phosphorylation site is Ser2.The β γ 12 of phosphorylation combines tightr (Morishila with G α, R.et al.1995 J.Biol.Chem.270:29469-26475), but has weakened the activity (Yasuda that β γ 12 activates II type adenylate cyclases, H.et al.1998, J.Biol.Chem.273:21958-21965).Another characteristics of γ 12 are: can combine (Ucda, H.et al.1997, J.Cell Sci.110:1503-1511) with the F-Actin muscle.Though the enzyme of different α subunits, β subunit and the conduction of participation signal also has effect with cytoskeleton, its importance is also very unclear.People's such as Ueda experiment shows that the expression of γ 12 can cause that inoblast changes significantly: cell rounding, mobility increases.This effect of γ 12 is by β γ 12 mixtures performances, and phosphorylation also is necessary, because the disappearance (Ser2 is replaced) of γ 12 phosphorylation sites causes above-mentioned effect to disappear.(Ueda，H.et?al.1999，J.Biol.Chem.274：12124-12128)。

HG-γ 12 proteic second amino acids are Ser, and are consistent with ox γ 12, and prompting hG-γ 12 has the phosphorylation site of protein kinase C, is the substrate of protein kinase C.

People hG-γ 12 of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor hG-γ 12 can also merge with other members of this family or exchange fragment, to produce new albumen.For example the N end of inventor hG-γ 12 and the N end of rat G-γ 12 are exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor hG-γ 12, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

In addition, inventor hG-γ 12 nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people hG-γ 12 or the overexpression that suppresses people hG-γ 12.People hG-γ 12 albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people hG-γ 12 disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Embodiment 3

The expression of people hG-γ 12 in intestinal bacteria

In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people hG-γ 12 use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.5 and 6) of 3 ' end increase, obtain people hG-γ 12 cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5-CAAGGTCGACATGTCCAGCAAAACAGCAAG-3′(SEQ?ID?NO.5)，

This primer contains the restriction enzyme site of Sal I restriction enzyme, is 20 Nucleotide of people hG-γ 12 encoding sequences that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5-TAGGAAGCTTCTATAAGATGATGCAAGTT-3(SEQ?ID?NO.6)，

This primer contains the part encoding sequence of restriction enzyme site, translation termination and the people hG-γ 12 of Hind III restriction enzyme.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp ^r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.

With Sal I and Hind III digestion pQE-9 carrier and insertion fragment, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed lac I repressor and carries kalamycin resistance (Kan ^r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid, the cDNA fragment of sequence verification people hG-γ 12 has correctly been inserted carrier.

Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).(O/N) culture that spends the night dilutes with the thinning ratio of 1:100-1:250, is inoculated into then in the large volume substratum, and culturing cell grows to 600 optical density(OD) (OD ₆₀₀) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lac I repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation culture, the collecting cell lysate also is diluted in it in 6M Guanidinium hydrochloride.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved people hG-γ 12 from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out people hG-γ 12 from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein from nickel-chelate column.Protein behind the purifying is incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 8kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 4

The expression of people hG-γ 12 in eukaryotic cell (Chinese hamster ovary celI strain)

In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people hG-γ 12 use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.7 and 8) of 3 ' end increase, obtain people hG-γ 12cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5′-CAAGAAGCTTATGTCCAGCAAAACAGCAAG-3′(SEQ?ID?NO.7)

This primer contains the restriction enzyme site of Hind III restriction enzyme, is 19 Nucleotide of people hG-γ 12 encoding sequences that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5-TAGGGGATCCCTATAAGATGATGCAAGTT-3(SEQ?ID?NO.8)

This primer contains the part encoding sequence of the restriction enzyme site of BamH I restriction enzyme, translation termination and people hG-γ 12.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp ^rAnd Neo ^r), a phage replication starting point (fl ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.

With Hind III and BamH I digestion pcDNA3 carrier and insertion fragment, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).Extracting plasmid, EcoRV enzyme are cut the cDNA fragment of identifier hG-γ 12 and have correctly been inserted carrier.

The plasmid transfection Chinese hamster ovary celI is to adopt lipofection, carries out with Lipofectin (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mM TrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mMTrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTris HCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 8kDa.

In addition, hold the amino acid of each l0 amino acid length to check order to reaching proteic N end and C, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 5

Preparation antibody

The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people hG-γ 12 gene translation products with it.Found that antibody can precipitate with albumen of the present invention specifically.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table (1) general information:

(ⅱ) denomination of invention: new human G protein protomer and encoding sequence thereof

(ⅲ) sequence number: the information of 8 (2) SEQ ID NO.1

(ⅰ) sequence signature

(A) length: 23 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO.1:TTGGACCACA CAAAGTCTTA CTG 23 (2) SEQ ID NO.2

(ⅰ) sequence signature

(A) length: 24 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:2:CTCTATTCCA CTATAAGATG ATGC 24 (2) SEQ ID NO.3:

(ⅰ) sequence signature:

(A) length: 278bp

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: the information of SEQ ID NO.3:1 TTGGACCACA CAAAGTCTTA CTGATTTCAG GTAAAAACAA TAATTGAAGA TGTCCAGCAA61 AACAGCAAGC ACCAACAATA TAGCCCAGGC AAGGAGAACT GTGCAGCAGT TAAGATTAGA121 AGCCTCCATT GAAAGAATAA AGGTTTCGAA GGCATCAGCG GACCTCATGT CCTACTGTGA181 GGAACATGCC AGGAGTGACC CTTTGCTGAT AGGAATACCA ACTTCAGAAA ACCCTTTCAA241 GGATAAAAAA ACTTGCATCA TCTTATAGTG GAATAGAG (2) SEQ ID NO.4:

(ⅰ) sequence signature:

(A) length: 72 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

(ⅹ ⅰ) sequence description: SEQ ID NO.4:1 Met Ser Ser Lys Thr Ala Ser Thr Asn Asn Ile Ala Gln Ala Arg16 Arg Thr Val Gln Gln Leu Arg Leu Glu Ala Ser Ile Glu Arg Ile31 Lys Val Ser Lys Ala Ser Ala Asp Leu Met Ser Tyr Cys Glu Glu46 His Ala Arg Ser Asp Pro Leu Leu Ile Gly Ile Pro Thr Ser Glu61 Asn Pro Phe Lys Asp Lys Lys Thr Cys Ile Ile Leu, (2) information of SEQ ID NO.5

(ⅰ) sequence signature

(A) length: 30 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO.5:CAAGGTCGAC ATGTCCAGCA AAACAGCAAG 30 (2) SEQ ID NO.6

(ⅰ) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO.6:TAGGAAGCTT CTATAAGATG ATGCAAGTT 29 (2) SEQ ID NO.7

(ⅰ) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO.7:CAAGAAGCTTATGTCCAGCAAAACAGCAAG 30 (2) SEQ ID NO.8

(ⅰ) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: SEQ ID NO.8:TAGGGGATCC CTATAAGATG ATGCAAGTT 29

Claims (10)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people hG-γ 12 protein-actives,

Show at least 70% homology from the nucleotides sequence of Nucleotide 50-268 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps

Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 50-268 position.

2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 50-268 position.

4. isolating people hG-γ 12 protein polypeptides is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

6. a carrier is characterized in that, it contains the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. a generation has the method for the polypeptide of people hG-γ 12 protein-actives, it is characterized in that this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people hG-γ 12 protein-actives operationally is connected in expression regulation sequence, form people hG-γ 12 protein expression vectors, show at least 70% homology from the nucleotides sequence of Nucleotide 50-268 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form people hG-γ 12 proteic reconstitution cells;

(c) under the condition that is fit to expressing human hG-γ 12 protein polypeptides, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people hG-γ 12 protein-actives.

9. energy and the described people hG-of claim 4 γ 12 protein polypeptide specificity bonded antibody.

10. a probe molecule is characterized in that, it contains 8-100 continuous nucleotide in the described dna molecular of claim 1.