CN1125178C - Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process - Google Patents
Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process Download PDFInfo
- Publication number
- CN1125178C CN1125178C CN 98111040 CN98111040A CN1125178C CN 1125178 C CN1125178 C CN 1125178C CN 98111040 CN98111040 CN 98111040 CN 98111040 A CN98111040 A CN 98111040A CN 1125178 C CN1125178 C CN 1125178C
- Authority
- CN
- China
- Prior art keywords
- sequence
- stk2
- polypeptide
- seq
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to a novel nucleotide sequence of a human gene, particularly to a novel cDNA sequence of human serine/threonine kinase STK2, and the protein is a homologous compound of Rac protein. The present invention also relates to polypeptides coded by the nucleotide sequence, an application of the polynucleotides and the polypeptides, and a production method of the polynucleotides and the polypeptides.
Description
The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of human serine/threonine kinase II (abbreviating STK2 as), this albumen is the proteic homologue of Rac.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.
The Rac protein kinase is the part of the Rho family in the serine/threonine kinase extended familys.It is considered to participate in the signaling molecule conductive process.The Rac protein kinase also with the modulate actin activity, make Actin muscle constitute the integral part of cytoskeleton and participate in various cell movements.Rac albumen is the small-sized GTP enzyme of a class, and its N end is the pleckstrin homologous region of guarding, and the C end is the serine threonine kinases active zone.It is a middle-chain of signal transduction cascade reaction, after it combines GTP, just becomes active condition, makes the multiple protein phosphorylation and is activated, and produces various cell responses.The establishment of the tissue of the actin cytoskeleton in activities such as the growth of Rac albumen wide participation cell, division, migration, chemotactic, super-oxide formation and the nerve growth, the cell polarity of epidermic cell and form and the cell migration of fetal development are directly related.In addition, in the lymph mastocyte, Rac albumen have the secretory function of regulating mastocyte (
Curr.Biol.5 (1): 68-73,1995).Effector variation in Rac downstream directly related with the Wiskott-Aldrich syndromes of immune system abnormality (
Curr.Biol.6 (1): 70-75,1996).
For Rac albumen, the earliest by people such as Sweden Jones in obtain two height of clone homologous genes from people MCF-7 and WI 38 cell strain cDNA library in 1991 (
Proc.Natl.Acad.Sci.88 (10): 4171-4175,1991;
Cell Regul.2 (12): 1001-1009,1991).1994 Japan people such as Konishi in the spermary cell cDNA storehouse of rat, separate obtain the Rac gene in mouse homologue Rac α and Rac β (
Biochem.Biophys.Res.Commun.205 (1): 817-825,1994), and the brain cell cDNA library in nineteen ninety-five from rat the clone obtain Rac the 3rd member Rac γ gene (
Biochem.Biophys.Res. Commun.216 (2): 526-534,1995).Before the present invention, still nobody disclosed another the human Rac family member STK2 that relates among the application.
An object of the present invention is to provide a kind of new polynucleotide sequence, this polynucleotide sequence coding Rac homologous protein, Rac homologous gene of the present invention is named as people STK2.
Another object of the present invention provides a kind of new albumen, and this albumen is named as people STK2.
A further object of the present invention provides a kind of recombinant technology that utilizes and produces the described new proteic method of people STK2.
The present invention also provides the application of this people STK2 encoding sequence and polypeptide.
In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people STK2 protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 48-1487 position among described nucleotide sequence and the SEQ ID NO.6; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.6 in from the nucleotide sequence hybridization of Nucleotide 48-1487 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.7.More preferably, this sequence has among the SEQ ID NO.6 nucleotide sequence from Nucleotide 49-1487 position.
In another aspect of this invention, provide a kind of isolating STK2 protein polypeptide, it comprises: have polypeptide or its active fragments of SEQID NO.7 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.7 polypeptide of sequence.
In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.
In another aspect of this invention, provide a kind of described carrier transformed host cells.
In another aspect of this invention, the method that provides a kind of generation to have the polypeptide of STK2 protein-active, this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of STK2 protein-active operationally is connected in expression regulation sequence, form the STK2 protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 48-1487 position among described nucleotide sequence and the SEQ ID NO.6;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of STK2;
(c) be fit to express under the condition of STK2 protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with STK2 protein-active.
In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 1706 Nucleotide, and its detailed sequence is seen SEQ ID NO.6, and wherein open reading frame is positioned at 48-1487 position Nucleotide.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, term " STK2 albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with STK2 protein-active is as 48-1487 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.6.This degenerate sequence is meant, is arranged in the encoder block 48-1487 position Nucleotide of SEQ ID NO.6 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.6 in 48-1487 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.7 of also encoding out.This term also comprise can be under the moderate stringent condition with SEQ ID NO.6 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 48-1487 position, more preferably can be under the height stringent condition with SEQ ID NO.6 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 48-1487 position.In addition, this term also comprise with SEQ ID NO.6 in from the homology of nucleotide sequence at least 70% of Nucleotide 48-1487 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises encoding to have variant form with proteic, the SEQ ID NO.6 sequence of people STK2 identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.
In the present invention, term " STK2 protein polypeptide " refers to have the SEQ ID NO.7 polypeptide of sequence of STK2 protein-active.This term also comprises having and variant form people STK2 identical function, SEQ ID NO.7 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of STK2 and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of STK2 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-STK2 polypeptide to obtain.The present invention also provides other polypeptide, as comprises STK2 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of STK2 polypeptide.Usually, this fragment have the STK2 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of STK2 albumen or polypeptide.The difference of these analogues and natural STK2 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
The present invention also comprises the antisense sequences of STK2 polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of STK2 in the cell.
The present invention also comprises a kind of probe molecule, and this molecule has 8-100 of STK2 polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the STK2 that encodes.
The present invention also comprises the method that detects the STK2 nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer can be positioned at the both sides or the centre of this encoding sequence corresponding to the encoding sequence of STK2 polypeptide.Primer length is generally 20-50 Nucleotide.
In the present invention, can select various carrier known in the art for use, as commercially available carrier.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
On the other hand, the present invention also comprises STK2 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into STK2 gene product or fragment.Preferably, refer to that those can combine with STK2 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of STK2, comprise that also those do not influence the antibody of STK2 protein function.The present invention also comprise those can with modify or without the STK2 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the STK2 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing STK2 or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block the STK2 function and the antibody that does not influence the STK2 function.Each antibody-like of the present invention can utilize the fragment or the functional zone of STK2 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of STK2 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
In the present invention, the cDNA nucleotide sequence of people STK2 is so to obtain, with human brain λ gt11cDNA library (available from Clontech company) is template, synthetic forward primer C1:5 '-GTTGTCATGTATGAAATGATGTG-3 ' and reverse primer C2:5 '-GTCTGAGCTGTAAATTCTTCATC-3 ', carry out PCR, obtain the purpose fragment of 334bp.This fragment of mark then, with this labeled fragment be probe with amplification after the hybridization of human brain λ gt11cDNA library, the picking positive colony after same probe and screening process are carried out multiple sieve to the positive colony that obtains, finally obtains some positive monoclonals.Be template with these positive colonies again, primer S1 on usefulness C1, C2 and the λ gt11 left and right arms and S2 (S1:5 '-GTTCAACATCAGCCGCTACA-3 '; S2:5 '-CACCAGACCAACTGGTAATG-3 ') amplification of arranging in pairs or groups, product obtains some positive colonies once more as the human brain λ gt11cDNA library hybridization after probe and the amplification.With them is template, use oligonucleotide R:5 '-ACCATAGAACGTGTGCGGTCC-3 ' and S1, S2 to arrange in pairs or groups respectively, carry out pcr amplification as primer, select to 5 ' end or 3 the longest fragments of 3 ' end extension and check order, at last with computer software splicing order, obtain full length cDNA sequence, be total to 1706bp, detailed sequence is seen SEQ ID NO.6.
Rac albumen is the small-sized GTP enzyme of a class.We have cloned a new Human genome STK2, this gene and mouse Rac γ gene height homology, and this shows that it is the homologous gene of Rac family in the people, and has the similar biological function with other member of Rac family.The proteic N end of Rac is the pleckstrin homologous region of guarding, and the C end is the serine threonine kinases active zone.It is a middle-chain of signal transduction cascade reaction, after it combines GTP, just becomes active condition, makes the multiple protein phosphorylation and is activated, and produces various cell responses.Wherein most important downstream effect thing is phosphatidylinositol-4phosphate-5-kinases (PIP5K), and PIP5K is activated back catalysis phosphatidyl creatine-4,5-bisphosphate (PIP
2) formation (
Curr.Opin.Cell Biol.9:86-92,1997;
Curr.Opin.Gene Dev.8:63-67,1998).PIP
2Can induce that actin filament fiber tip cap is proteic to come off and the extension of fiber, and quicken the contact of actin binding protein and actin filament, finally cause the fold of sheet isostructural formation of foot and cytolemma.PIP
2Can with the protein binding that contains the pleckstrin homologous region, activate their kinase activity, help them on cytolemma, to distribute, and promote Ca
2+Flow.PIP
2Rac albumen also there is adverse affects.Activities such as the growth of Rac albumen wide participation cell, division, migration, chemotactic, super-oxide formation, directly related with the cell migration of the establishment of the cell polarity of the tissue of actin cytoskeleton in the nerve growth, epidermic cell and form and fetal development. in addition, in the lymph mastocyte, Rac albumen have the secretory function of regulating mastocyte (
Curr.Biol.5 (1): 68-73,1995).Effector variation in Rac downstream directly related with the Wiskott-Aldrich syndromes of immune system abnormality (
Curr.Biol.6 (1): 70-75,1996).Polypeptide of the present invention provides a kind of approach for the pathological study and the treatment of this illness.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone and the mensuration of the cDNA sequence of STK2
1. primer amplification
With human brain λ gt11cDNA library (available from Clontech company) is template, using oligonucleotide C1:5 '-GTTGTCATGTATGAAATGATGTG-3 ' (SEQ ID NO.1) and oligonucleotide C2:5 '-GTCTGAGCTGTAAATTCTTCATC-3 ' (SEQ ID NO.2) is reverse primer, carry out PCR, the PCR condition be 93 ℃ 3 minutes, carried out 40 circulations in 1.5 minutes with 93 ℃ 1 minute, 62 ℃ 1 minute and 72 ℃, last 72 ℃ were extended 5 minutes thereupon.The 334bp purpose fragment that electrophoresis detection obtains.
2. probe and mark thereof
With C1, C2 is primer, usefulness α-
32The purpose fragment that P-dATP (DuPont company) obtains step 1 is carried out PCR method mark, and condition obtains probe with step 1.
3.cDNA amplified library and trace mark (screening library)
Increased in human brain λ gt11cDNA library, clone's number reaches 500,000, good cDNA library trace to the Hybond TM-N+ nylon membrane (Amersham) then will increase, hybridize with blotting membrane after again that mark is the good probe sex change, wash film, put into the sheet folder of band intensifying screen, under-80 ℃, carry out radioautograph, punching after 72 hours with FUJI MEDIAI X-ray film.
4. picking clone and primary dcreening operation clone's multiple sieve
Obtain a plurality of primary dcreening operation positive colonies by above-mentioned screening by hybridization, these positive colonies are carried out multiple sieve, finally obtain 12 positive monoclonals with above-mentioned identical probe hybridization and screening process.
5. monoclonal evaluation and order-checking
With the mono-clonal phage that obtains in the above-mentioned steps 4 is template, with two positive anti-primers of above-mentioned steps 1 respectively with λ gt11 left and right arms on primer S1:5 '-GTTCAACATCAGCCGCTACA-3 ' (SEQ ID NO.3) and S2:5 '-CACCAGACCAACTGGTAATG-3 ' (SEQ ID NO.4) amplification of arranging in pairs or groups, carry out agarose gel electrophoresis then, with judge each clone from probe to 5 ' or 3 ' step move the length of (extensions), therefrom select to 5 ' extend the longest and to the longest clone of 3 ' extension.With this clone's S1-S2 amplified production and pGEM-T
TMCarrier (Promega) connects, transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then with double-stranded nested type disappearance test kit (Pharmacia).Use SwquiTherm EXCEL
TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively.Use SequiThermEXCEL
TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtains Partial cDNA Sequence at last.
6. the acquisition of total length
Copying step 3, is that mixed probe is hybridized the library with human brain λ gt11cDNA again with C1S1 and C2S2, obtains 26 positive colonies.With these 26 clones is template, use oligonucleotide R:5 '-ACCATAGAACGTGTGCGGTCC-3 ' (SEQ ID NO.5) and oligonucleotide S1, S2 to arrange in pairs or groups respectively, carry out pcr amplification as primer, the PCR condition be 93 ℃ 3 minutes, carried out 35 circulations in 2 minutes with 93 ℃ 1 minute, 64 ℃ 1 minute and 72 ℃, last 72 ℃ were extended 5 minutes thereupon.Select and extend 3 the longest fragments to 5 ' end or 3 ' end and check order, with computer software splicing order, obtain full length cDNA sequence at last, 1706bp altogether, detailed sequence is seen SEQ ID NO.6, wherein open reading frame is positioned at 49-1487 position Nucleotide.
Derive the aminoacid sequence of STK2 according to the cDNA sequence that obtains, totally 479 amino-acid residues, its aminoacid sequence sees SEQ ID NO.7 for details.
Embodiment 2
Homology relatively
Full length cDNA sequence and proteins encoded thereof with STK2 carry out nucleic acid and albumen homology retrieval with BLAST in Non-redundant GenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDS translations+PDB+SwissProt+Spupdate+PIR database.Found that STK2 and mouse RAC γ gene and proteins encoded thereof have high homology, find relatively that with PCGENE software their identity on nucleic acid and protein level has reached 85.3% and 98.9% respectively.This shows that they belong to same family, and STK2 has similar or identical functions.
Rac albumen is the small-sized GTP enzyme of a class, is an integral part of the Rho family in the serine/threonine kinase extended familys.The N end of Rac is the pleckstrin homologous region of guarding (pH territory), and this zone is made up of about 100 amino acid, shows following common trait: it is made up of two mutually perpendicular antiparallel beta sheets, the hydrophilic spiral of a follow-up C-end.The ring texture length in various PH territory that connects two beta sheets is very different, and also not conservative fully amino-acid residue exists in the PH territory, makes PH territory relative difficult be identified.Among the present invention corresponding PH zone be among the SEQ ID NO.7 the 1st to the 109th amino acids.The proteic C end of Rac is serine threonine kinases active zone (L/I/V/M/F/Y/C) X (H/Y) XD (L/I/V/M/F/Y) KX
2N (L/I/V/M/F/Y/C/T)
3, wherein choose any one kind of them X in listed 7 seed amino acids of (L/I/V/M/F/Y/C) expression
nRepresent n arbitrary amino acid, among the present invention corresponding sequence be among the SEQ ID NO.7 the 267th to the 289th amino acids.This has determined that further STK2 of the present invention is a member of Rac family, and has the correlation function of this family protein.
Rac albumen is a middle-chain of signal transduction cascade reaction, after it combines GTP, just becomes active condition, makes the multiple protein phosphorylation and is activated, and produces various cell responses.Wherein most important downstream effect thing is phosphatidylinositol-4phosphate-5-kinases (PIP5K), and PIP5K is activated back catalysis phosphatidyl creatine-4,5-bisphosphate (PIP
2) formation (
Curr.Opin.Cell Biol.9:86-92,1997;
Curr.Opin.Gene Dev.8:63-67,1998).PIP
2Can induce actin filament fiber tip cap proteic come off and the extension of fiber (
Cell82:643-653,1995), and quicken the contact of actin binding protein and actin filament, finally cause sheet isostructural formation of foot and cytolemma fold (
EMBO J.15:3778-3786,1996).PIP
2Can with the protein binding in PH territory (
Science371:168-170,1994), activate their kinase activity, help them on cytolemma, to distribute, and promote Ca
2+Flow.PIP
2Rac albumen is also had adverse affects, may be essential to its transfer, activation under given conditions.Rac albumen can participate in activities such as cell growth, division, migration, chemotactic, super-oxide formation by the action range of PIP5K.Homologous gene in the fruit bat studies show that the actin cytoskeleton in Rac and the nerve growth tissue (
Genes Dev.8:1787-1802,1994), the establishment of the cell polarity of epidermic cell and form (
J.Cell.Biol.131:151-164,1995) and the cell migration of fetal development directly related (
J.Cell.Biol.133:617-630,1996).In addition, in the lymph mastocyte, Rac albumen is found can catch the endogenous fibril composition that discharges from skin, thus proved its have the secretory function of regulating mastocyte (
Curr.Biol.5 (1): 68-73,1995).An effector variation in Rac downstream is directly related with the Wiskott-Aldrich syndromes of immune system abnormality.This illness shows as thrombocyte and T cellular form and reaches microvillus quantity unusually and reduce, thereby causes platelet counts to reduce, weaken immune response (
Curr.Biol.6 (1): 70-75,1996).Polypeptide of the present invention can provide an approach for the pathological study and the treatment of this illness.
Embodiment 3
The expression of STK2 in intestinal bacteria
In this embodiment, use PCR Oligonucleolide primers to increase the cDNA sequence of coding STK2, obtain STK2 cDNA as inserting fragment in human brain λ gy11cDNA library corresponding to 5 of this dna sequence dna ' and 3 ' end.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5 '-TCCGGTCGACATGAGCGATGTTACCATTG-3 ' (SEQ ID NO.8), this primer contains the restriction enzyme site of the restricted restriction enzyme of SalI, is 19 Nucleotide of the STK2 encoding sequence that begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5 '-GTTGTCGACTTATTCTCGTCCACTTGCAG-3 ' (SEQ ID NO.9), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the STK2 of the restricted restriction enzyme of SalI.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp
r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.
Digest the pQE-9 carrier respectively and insert fragment with SalI, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kan
r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid cuts with the BamHI enzyme and to identify and insert clip size and direction, and the cDNA fragment of sequence verification STK2 has correctly been inserted carrier.
Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD
600) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved STK2 from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out STK2 from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps use the dialysis step to remove Guanidinium hydrochloride, perhaps isolate purifying protein from nickel-chelate column, the albumen behind the purifying can be incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 56KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.7 with ordinary method.
Embodiment 4
The expression of STK2 in eukaryotic cell (Chinese hamster ovary celI strain)
In this embodiment,, use PCR Oligonucleolide primers to increase, obtain STK2 cDNA as inserting fragment corresponding to 5 of this dna sequence dna ' and 3 ' end with the cDNA sequence of coding STK2.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5’-TCGGGAATTCATGAGCGATGTTACCATTG-3′(SEQ?ID?NO.10)
This primer contains the restriction enzyme site of the restricted restriction enzyme of EcoRI, is 19 Nucleotide of the STK2 encoding sequence that begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5’-GTTGGGCCCTTATTCTCGTCCACTTGCAG-3’(SEQ?ID?NO.11)
This primer contains the part encoding sequence of the restriction enzyme site of the restricted restriction enzyme of ApaI, translation termination and STK2.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp
rAnd Neo
r), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.
Digest the pcDNA3 carrier respectively and insert fragment with EcoRI and ApaI, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid cuts evaluation with the BamHI enzyme and insert clip size and direction, and the cDNA fragment of sequence verification STK2 has correctly been inserted carrier.
Plasmid transfection CHO uses lipofection, adopts Lipofectin test kit (GiBcolife) to carry out.After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mM TrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 56KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.7 with ordinary method.
Embodiment 5
Preparation antibody
The recombinant protein that obtains in embodiment 3 or 4 is used for immune animal to produce antibody, specific as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation STK2 gene translation product with it.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Information (i) sequence signature of sequence table (2) SEQ ID NO.1
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.1GTTGTCATGT ATGAAATGAT GTG 23 (2) SEQ ID NO.2
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.2GTCTGAGCTG TAAATTCTTC ATC 23 (2) SEQ ID NO.3
(A) length: 20 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.3GTTCAACATC AGCCGCTACA 20 (2) SEQ ID NO.4
(A) length: 20 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.4CACCAGACCA ACTGGTAATG 20 (2) SEQ ID NO.5
(A) length: 21 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO.5ACCATAGAAC GTGTGCGGTC C 21 (2) SEQ ID NO.6: (i) sequence signature
(A) length: 1706bp
(B) type: nucleic acid
(C) chain: strand
( D ) : ( ii ) :cDNA ( xi ) :SEQ ID NO.6 1 TCACAAAGTACCATTTCTTCAAGTTGGGGGCTCAGAGGGGAGTCATCATGAGCGATGTTA 61 CCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAAAACTGGAGGCCAA121 GATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAGAAACCTCAAGATG181 TGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAGTTAATGAAAACAG 241 AACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGA 301 GAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTG 361 TAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAA 421 TTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAA 481 TGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGG 541 TTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTA 601 TTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTAAAGAACACTAGAC 661 ATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGTTTGTGTTTTGTGA 721 TGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAGCGGGTGTTCTCTG 781 AGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGACTATCTACATTCCG 841 GAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGACAAAGATGGCCACA 901 TAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCAGCCACCATGAAGA 961 CATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGATAATGACTATGGCC1021 GAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATGTGTGGGAGGTTAC1081 CTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATGGAAGACATTAAAT1141 TTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTCTTGATAAAGGATC1201 CAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATGAGACACAGTTTCT1261 TCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCTCCTTTTAAACCTC1321 AAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACAGCTCAGACTATTA1381 CAATAACACCACCTGAAAAATATGATGAGGATGGTATGGACTGCATGGACAATGAGAGGC1441 GGCCGCATTTCCCTCAATTTTCCTACTCTGCAAGTGGACGAGAATAAGTCTCTTTCATTC1501 TGCTACTTCACTGTCATCTTCAATTTATTACTGAAAATGATTCCTGGACATCACCAGTCC1561 TAGCTCTTACACATAGCAGGGGCACCTTCCGACATCCCAGACCAGCCAAGGGTCCTCACC1621 CCTCGCCACCTTTCACCCTCATGAAAACACACATACACGCAAATACACTCCAGTTTTTGT1681 TTTTGCATGAAATTGTATCCGGAATT ( 2 ) SEQ ID NO.7: ( i )
(A) length: 479 amino acid
(B) type: amino acid
( D ) : ( ii ) : ( xi ) :SEQ ID NO.7 1 Met Ser Asp Val Thr Ile Val Lys Glu Gly Trp Val Gln Lys Arg 16 Gly Glu Tyr Ile Lys Asn Trp Arg Pro Arg Tyr Phe Leu Leu Lys 31 Thr Asp Gly Ser Phe Ile Gly Tyr Lys Glu Lys Pro Gln Asp Val 46 Asp Leu Pro Tyr Pro Leu Asn Asn Phe Ser Val Ala Lys Cys Gln 61 Leu Met Lys Thr Glu Arg Pro Lys Pro Asn Thr Phe Ile Ile Arg 76 Cys Leu Gln Trp Thr Thr Val Ile Glu Arg Thr Phe His Val Asp 91 Thr Pro Glu Glu Arg Glu Glu Trp Thr Glu Ala Ile Gln Ala Val106 Ala Asp Arg Leu Gln Arg Gln Glu Glu Glu Arg Met Asn Cys Ser121 Pro Thr Ser Gln Ile Asp Asn Ile Gly Glu Glu Glu Met Asp Ala136 Ser Thr Thr His His Lys Arg Lys Thr Met Asn Asp Phe Asp Tyr151 Leu Lys Leu Leu Gly Lys Gly Thr Phe Gly Lys Val Ile Leu Val166 Arg Glu Lys Ala Ser Gly Lys Tyr Tyr Ala Met Lys Ile Leu Lys181 Lys Glu Val Ile Ile Ala Lys Asp Glu Val Ala His Thr Leu Thr196 Glu Ser Arg Val Leu Lys Asn Thr Arg His Pro Phe Leu Thr Ser211 Leu Lys Tyr Ser Phe Gln Thr Lys Asp Arg Leu Cys Phe Val Met226 Glu Tyr Val Asn Gly Gly Glu Leu Phe Phe His Leu Ser Arg Glu241 Arg Val Phe Ser Glu Asp Arg Thr Arg Phe Tyr Gly Ala Glu Ile256 Val Ser Ala Leu Asp Tyr Leu His Ser Gly Lys Ile Val Tyr Arg271 Asp Leu Lys Leu Glu Asn Leu Met Leu Asp Lys Asp Gly His Ile286 Lys Ile Thr Asp Phe Gly Leu Cys Lys Glu Gly Ile Thr Asp Ala301 Ala Thr Met Lys Thr Phe Cys Gly Thr Pro Glu Tyr Leu Ala Pro316 Glu Val Leu Glu Asp Asn Asp Tyr Gly Arg Ala Val Asp Trp Trp331 Gly Leu Gly Val Val Met Tyr Glu Met Met Cys Gly Arg Leu Pro346 Phe Tyr Asn Gln Asp His Glu Lys Leu Phe Glu Leu Ile Leu Met361 Glu Asp Ile Lys Phe Pro Arg Thr Leu Ser Ser Asp Ala Lys Ser376 Leu Leu Ser Gly Leu Leu Ile Lys Asp Pro Asn Lys Arg Leu Gly391 Gly Gly Pro Asp Asp Ala Lys Glu Ile Met Arg His Ser Phe Phe406 Ser Gly Val Asn Trp Gln Asp Val Tyr Asp Lys Lys Leu Val Pro421 Pro Phe Lys Pro Gln Val Thr Ser Glu Thr Asp Thr Arg Tyr Phe436 Asp Glu Glu Phe Thr Ala Gln Thr Ile Thr Ile Thr Pro Pro Glu451 Lys Tyr Asp Glu Asp Gly Met Asp Cys Met Asp Asn Glu Arg Arg466 Pro His Phe Pro Gln Phe Ser Tyr Ser Ala Ser Gly Arg Glu ( 2 ) SEQ ID NO.8 ( i )
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.8TCCGGTCGAC ATGAGCGATG TTACCATTG 29 (2) SEQ ID NO.9
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.9GTTGTCGACT TATTCTCGTC CACTTGCAG 29 (2) SEQ ID NO.10
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.10TCGGGAATTC ATGAGCGATG TTACCATTG 29 (2) SEQ ID NO.11
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO.11GTTGGGCCCT TATTCTCGTC CACTTGCAG 29
Claims (11)
1. an isolated dna molecular is characterized in that, described dna molecule encode one polypeptide, and this polypeptide contains the sequence shown in the SEQ ID NO.7.
2. dna molecular as claimed in claim 1 is characterized in that the sequence of described polypeptide is shown in SEQ IDNO.7.
3. dna molecular as claimed in claim 1 is characterized in that, described dna molecular contains the sequence of Nucleotide 48-1487 position among the SEQ IDNO.6.
4. an isolating STK2 protein polypeptide is characterized in that, it contains the aminoacid sequence shown in the SEQ ID NO.7.
5. polypeptide as claimed in claim 4 is characterized in that this amino acid sequence of polypeptide is shown in SEQ IDNO.7.
6. a carrier is characterized in that, it contains the described DNA of claim 1.
7. one kind with the described carrier transformed host cells of claim 6.
8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.
9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.
10. one kind produces the proteic method of STK2, it is characterized in that this method comprises:
(a) the proteic nucleotide sequence of STK2 of will encoding operationally is connected in expression regulation sequence, forms the STK2 protein expression vector, a described nucleotide sequence coded polypeptide, and this polypeptide contains the sequence shown in the SEQ ID NO.7;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of STK2;
(c) be fit to express under the proteic condition of STK2 the reconstitution cell in the culturing step (b);
(d) isolate STK2 albumen.
11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 48-1487 position among the SEQ ID NO.6.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 98111040 CN1125178C (en) | 1998-08-31 | 1998-08-31 | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 98111040 CN1125178C (en) | 1998-08-31 | 1998-08-31 | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1246537A CN1246537A (en) | 2000-03-08 |
CN1125178C true CN1125178C (en) | 2003-10-22 |
Family
ID=5221049
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 98111040 Expired - Fee Related CN1125178C (en) | 1998-08-31 | 1998-08-31 | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1125178C (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1331317A (en) * | 2000-06-30 | 2002-01-16 | 上海博德基因开发有限公司 | Polypeptide-human serine/threonine protein kinase 11.22 and polynucleotide for coding it |
-
1998
- 1998-08-31 CN CN 98111040 patent/CN1125178C/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN1246537A (en) | 2000-03-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1128878C (en) | Coding sequence of human methionine sulfoxide reductase, its encoded polypeptide and its preparing process | |
CN1125178C (en) | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process | |
CN1132939C (en) | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process | |
CN1125177C (en) | Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process | |
CN1237173C (en) | Hemolytic peptide precursor gene of Asian-African wasp aptoxin, polypeptide coded by it and its preparing process | |
CN1233830C (en) | China bee and hornet hemolysis peptide precursor gene and coded polypeptide and preparing method | |
CN1249347A (en) | Human calcineurin regulatory subunit, its coding sequence and its preparing process | |
CN1277259A (en) | Homologous protein of late embryo ample-protein and its code sequence | |
CN1246529A (en) | Coding sequence of human translation initiation factor subunit, its encoded polypeptide and its preparing process | |
CN1248624A (en) | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process | |
CN1277260A (en) | Human actin related protein subunit and its code sequence | |
CN1259574A (en) | New human phosphatide transferase, its code sequence, prepn. and use thereof | |
CN1290749A (en) | Charcot-leyden crystal IB and its coding sequence and producing method and use | |
CN1264739A (en) | Human protein and its coding sequence, preparing process and application | |
CN1250097A (en) | New human gene coding series and the polypeptide therewith and its preparation | |
CN1246532A (en) | Coding sequence of human heat shock associated protein, its encoded polypeptide and its preparing process | |
CN1252448A (en) | Human actin related protein gene and encoded polypeptide and preparation and application | |
CN1261102A (en) | Human spindle protein and its coding sequence, preparing process and application | |
CN1253180A (en) | Specific protein of human neuroendocrine, coding sequence and its preparating process and application | |
CN1246530A (en) | Human gene coding sequence, its encoded polypeptide and its preparing process | |
CN1249345A (en) | Human gene coding sequence, its encoded polypeptide and its preparing process | |
CN1303935A (en) | Human charcot-leyden crystal 6, its code sequence, preparation method and application | |
CN1250096A (en) | New human protein phosphatase subunit and its coding series and preparation | |
CN1257921A (en) | Human melanoma growth correlation factor and its coding sequence, preparing process and usage | |
CN1249346A (en) | Human gene sequence, its encoded polypeptide and its preparing process |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1066576 Country of ref document: HK |
|
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20031022 Termination date: 20160831 |