CN1290749A - Charcot-leyden crystal IB and its coding sequence and producing method and use - Google Patents

Abstract

The persent invention provides the cDNA sequence of a new huamn Charcot-Leyden crystal 1B and the cDNA encoded protein is the homologue of human Charcot-Leyden crystal protein. The present invention also relates to polypeptide encoded by the nucleotide sequence, the application of these polynucleotides and polypeptides and the production process of the said polynucleotides and polypeptides.

Description

People's Charcot Leyden crystals 1B and encoding sequence thereof, and method for making and purposes

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of people's Charcot Leyden crystals 1B (Charcot-Leyden Crystal 1B abbreviates " CLC1B " as), this cDNA encoded protein is the proteic homologue of people's Charcot Leyden crystals.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.

Charcot Leyden crystals (Charcot-Leyden Crystal, CLC) be that the bottom surface that nature is present in tissue and the secretory product is the bipyramid bodily form crystal of hexagonal, relevant with the oxyphie quantity increase in peripheral blood in parasitic processes, the supersensitivity process or the tissue.As far back as 1854, Charcot and Robin at first found Charcot Leyden crystals (Charcot, J.M. in the blood of corpse and leukaemic's spleen; Robin, C.:C.R.SeancesMem.Soc.Biol.Paris 5:44-52,1854), discovery (Leyden, E.Virchows Arch.Path.Anat.54:324-344,1872) was also also arranged in an asthma patient's saliva afterwards.

CLC is observed in the tissue of oxyphie related inflammation reaction and secretory product, these inflammatory reactions have (Beeson such as asthma, myelomatosis, anaphylaxis, parasitosis, P.B.1977 et al.The eosinopilIn Problems in the Internal Medicine, Vol.15.; Ottesen, E, A.et al 1978.Theeosinophil, eosinophilia and eosinophil-related disorders.In Allergy:Principles andPractice, Vol.2.E.Middleton, C.E.Reed, and E.F.Ellis, eds.C.V.Mosby Co., St.Louis, MO, p.584.).CLC albumen accounts for about 10% (Weller of oxyphie total protein, P.F.et al1984, J.Biol.Chem.259:15100), be the significant albumen of oxyphie, the bottom surface that identifies this uniqueness in body fluid and secretory product is the bipyramid bodily form crystal-CLC crystal of hexagonal, can be used as the sign of the relevant allergic inflammation of oxyphie.

The full length cDNA sequence of a kind of CLC obtains separation in 1993, the long 598bp of this cDNA sequence, the 142 amino acid whose polypeptide of encoding (Ackeman, S.J.et al 1993, J.Immun.150:456-468).The genome sequence of CLC is almost simultaneously obtained, the Dyer report is cloned into the genomic fragment that has comprised the CLC encoding sequence from No. 19 special karyomit(e) storehouses, cDNA and genome sequence analytical results to CLC show that the coded sequence of CLC forms (Dyer by 4 exon splicings, K.D.et al.1997, Genomics 40:17-221).

Mastrianni is positioned people's Charcot Leyden crystals albumen for No. 19 karyomit(e)s (Mastrianni, D.M.et al1991, Cytogenet.Cell Genet.58 ' 2021).Fluorescence in situ hybridization technique with CLC further be positioned 19q13.1 (B.Trask and H.Morhrenweiser unpublished observation, cited in Ackeman, S.J.et al 1993, J.Immun.150:456-468).

Other has some experiments to show, Charcot Leyden crystals as one independently albumen have activity (Gleich, G.J.et al 1976, the J.Clin.Invest.57:633-640 of lysophospholipase; Weller, P.F.et al 1980, Proc.Nat.Acad.Sci.U.S.A.77; 7441-7443).This conclusion is also supported by some other experiment simultaneously: alkaline polyacrylamide gel electrophoresis showed, the dissolved Charcot Leyden crystals has only a band, and its molecular weight is 17400, conforms to the molecular weight of the lysophospholipase that is separated to from the acidophilia granulosa cell; In addition, acidophilia granulosa cell lysophospholipase can form the crystal of bicone, with the Charcot Leyden crystals homomorphosis.These all show, people's eosinophilic granulocyte lysophospholipase be Charcot Leyden crystals moiety (Weller, P.F.etal 1980, Proc.Nat.Acad.Sci.U.S.A.77; 7441-7443).But CLC and other mammiferous lysophospholipase do not have structural similarity (Leonidas, D.D.et al.1995, Structure 3:1379-1393).

And some member of CLC albumen and Sugar receptors family has similarity on structure, partial function.The cDNA derivation albumen (Ackeman of CLC, S.J.et al 1993, J.Immun.150:456-468), structure (the Dyer of the intron-exon of genome order, K.D.et al.1997, Genomics 40:17-221), characteristic high conservative residue (Dyer, K.D.et al.1996, Life Sci.58:2073-2082), activity (Dyer in conjunction with sugar, K.D.et al.1996, Life Sci.58:2073-2082), one-piece construction (the Leonidas of crystallin, D.D.et al.1995, Structure 3:1379-1393) all similar to some member of galectin family, this shows that CLC albumen may have some relevant activity of galectin, at cell-cell, bring into play biological function (Dyer, K.D.et al.1997, Gemonics 40:217-221) by the beta galactose glycosides in conjunction with activity in the interaction of cell-matrix.

CLC is the sign of oxyphie, but in basophil CLC is arranged also.Submicroscopic structure studies show that, CLC is present in (Dvorak, A.M.et al.1988, Blood 72:150 in the particle of eosinophil and basophil; Dvorak, A, M.et al.1989, Lab.Invest.60:557).Recently, by immune technology for gold or indirect immunofluorescence location, find that also CLC is present in other positions in eosinophil and the basophil, as kytoplasm and nuclear (Dvorak, A.M.et al.1990, Lab.Invest.62:590-607; Dvorak, A.M.r tal.1991, Am.J.Pathol.138:69-82; Dvorak, A.M.et al.1997, Clin.Exp.Allergy 27:452-474), the threshing passage of basophil, threshing channel membrane and the class particle similar to the primary granule of eosinophil, the variation that CLC albumen distributes shows that basophil inclusion (comprising CLC) has the change procedure that discharges with acquisition, the function of CLC may relevant (Dvorak with the change procedure of its distribution, A.M.et al.1997, Clin.Exp.Allergy 27:452-474).

Yet, not open or reported other people albumen or its encoding sequence of other and Charcot Leyden crystals homologous before the present invention.

An object of the present invention is to provide a kind of new polynucleotide, these polynucleotide are named as people's Charcot Leyden crystals 1B (human Charcot-Leyden Crystal 1B abbreviates " people CLC1B " as).

Another object of the present invention provides a kind of new people CLC1B albumen.

A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new people's CLC1B polypeptide.

The present invention also provides this people's the CLC1B nucleotide sequence and the application of polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people CLC1B protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 72-584 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 72-584 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 72-584 position.

In another aspect of this invention, provide a kind of isolating people CLC1B protein polypeptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.

In another aspect of this invention, provide a kind of described carrier transformed host cells.

In another aspect of this invention, provide a kind of generation to have the method for the polypeptide of people CLC1B protein-active, this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people CLC1B protein-active operationally is connected in expression regulation sequence, form people CLC1B protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 72-584 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people CLC1B;

(c) under the condition that is fit to expressing human CLC1B protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people CLC1B protein-active.

In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 685 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 72-584 position Nucleotide.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people CLC1B albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people CLC1B protein-active is as 72-584 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 72-584 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 72-584 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with among the SEQ ID NO.3 from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 72-584 position.Also term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 72-584 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.

This term also comprises encoding to have variant form with proteic, the SEQ ID NO.4 sequence of people CLC1B identical function.These variant forms comprise (but being not limited to): several (are generally 1-60, preferably 1-30, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 45 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people CLC1B protein polypeptide " refers to have the SEQID NO.4 polypeptide of sequence of people CLC1B protein-active.This term also comprises having and variant form people CLC1B identical function, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-25, preferably 1-20, more preferably 1-15,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people CLC1B and reactive derivative.

The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people CLC1B DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people CLC1B polypeptide to obtain.The present invention also provides other polypeptide, as comprises people CLC1B polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people CLC1B polypeptide.Usually, this fragment have people CLC1B peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of people CLC1B albumen or polypeptide.The difference of these analogues and natural human CLC1B polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " people CLC1B conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID No.4, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.

Table 1

Initial residue	Representational replacement	The preferred replacement
Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu

The present invention also comprises people CLC1B polypeptid coding sequence and segmental antisense sequences thereof.This antisense sequences can be used for suppressing the expression of people CLC1B in the cell.

The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people CLC1B polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people CLC1B.

The present invention also comprises the method that detects people CLC1B nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of people CLC1B polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.

In the present invention, can select various carrier known in the art for use, as commercially available carrier.Such as, select commercially available carrier for use, the nucleotide sequence with code book invention polypeptide operationally is connected in expression regulation sequence then, can form protein expression vector.

As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

On the other hand, the present invention also comprises people CLC1B DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people CLC1B gene product or fragment.Preferably, refer to that those can combine with people CLC1B gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people CLC1B, comprise that also those do not influence the antibody of people CLC1B protein function.The present invention also comprise those can with modify or without the people CLC1B gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people CLC1B gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human CLC1B or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people CLC1B function and the antibody that does not influence people CLC1B function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people CLC1B gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people CLC1B gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

People CLC1B Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally with its human cloning carrier, changes cell over to again, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially because the length of people CLC1B is shorter.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

In one embodiment of the invention, the cDNA nucleotide sequence of people CLC1B is so to obtain, with human leukemia λ gtllcDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer--A:5 '-CCAGCCTAGGTGACAGTGTGACC-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-GCAGGAGTAAGGATTGAAGTGAG-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 60 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains is about the purpose fragment (SEQ ID NO:3) of 700bp.

The reaction of CLC and oxyphie related inflammation has confidential relation, and it can be used as the sign of the relevant allergic inflammation of oxyphie in body fluid and the evaluation in the secretory product.In addition, CLC shows that in the similarity of structure, partial function CLC albumen may have some relevant activity of Sugar receptors with some member of Sugar receptors family, at cell-cell, bring into play biological function (Dyer by the beta galactose glycosides in conjunction with activity in the interaction of cell-matrix, K.D.et al.1997, Gemonics 40:217-221).CLC also is present in the basophil, its vicissitudinous process that distributes, and the function of CLC may relevant with the change procedure of its distribution (Dvorak, A.M.et al.1997, Clin.Exp.Allergy 27:452-474).

In addition, because people CLC1B of the present invention has the natural acid sequence that is derived from the people, therefore, and estimate to have very high active and/or very low side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.

In the accompanying drawings, Fig. 1 is people CLC1B of the present invention and people CLC (CLC), mouse CLC (mCLC) and orangutan CLC 4 kinds of proteic amino acid sequence homologous comparison diagrams such as (pCLC).Wherein, identical amino acid marks with " * " below sequence, and similar amino acid marks with " ".

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone and the mensuration of the cDNA sequence of people CLC1B

1. primer amplification

With human leukemia λ gtllcDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer--A:5 '-CCAGCCTAGGTGACAGTGTGACC-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-GCAGGAGTAAGGATTGAAGTGAG-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 60 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains is about the purpose fragment of 700bp.

2.PCR the order-checking of product

Above-mentioned pcr amplification product AB is connected with pGEM-T carrier (Promega), and transformed into escherichia coli JM103 extracts plasmid with QIAprep Plasmid test kit (QIAGEN), uses SequiThermEXCEL ^TMDna sequencing kit (Epicentre Technologies) checks order to inserting fragment, with computer software splicing order, obtain full length cDNA sequence at last, altogether 685bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 72-584 position Nucleotide.

Derive the aminoacid sequence of people CLC1B according to the full length cDNA sequence that obtains, totally 170 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.

Embodiment 2

Homology relatively

Full length cDNA sequence and proteins encoded thereof with people CLC1B of the present invention, in Non-redundantGenBank+ EMBL+DDBJ+PDB database and Non-redundant GenBank CDStranslations+PDB+SwissProt+Spupdate+PIR database, carry out nucleic acid and albumen homology retrieval with blast program.Found that the CLC (gb|L01664) with the people on nucleotide level and protein level has higher homology.Wherein, CLC1B derivation albumen and the proteic identity of people CLC reach 98%.In addition, the CLC partial sequence of having announced in CLC1B and mouse and the orangutan has also shown higher homology (homology of CLC1B and people CLC, mouse CLC and orangutan CLC is relatively seen Fig. 1).

According to the structures shape function, the Biological Principles that the structural similitude function is relevant can be inferred the biological function of CLC1B of the present invention according to the function of CLC gene in the known different plant species and proteins encoded thereof.

CLC observes in the tissue of oxyphie related inflammation reaction and secretory product, these inflammatory reactions have asthma, myeloid leukemias, anaphylaxis, (Beeson such as parasitosis, P.B.1977 et al.Theeosinopil In Problems in the Internal Medicine, Vol.15.; Ottesen, E, A.et al 1978.The eosinophil, eosinophilia and eosinophil-related disorders.In Allergy:Principlesand Practice, Vol.2.E.Middleton, C.E.Reed, and E.F.Ellis, eds.C.V.Mosby Co., St.Louis, MO, p.584.).CLC albumen accounts for about 10% (Weller of oxyphie total protein, P.F.et al.1984, J.Biol.Chem.259:15100), be the significant albumen of oxyphie, the bottom surface that identifies this uniqueness in body fluid and secretory product is the bipyramid bodily form crystal-CLC crystal of hexagonal, can be used as the sign of the relevant allergic inflammation of oxyphie.

And there is the similarity on structure, the partial function in some member of CLC albumen and Sugar receptors family.The cDNA derivation albumen of CLC and the member who combines beta galactose glycosides S-sample animal Sugar receptors (galectin) superfamily have similarity (Ackeman, S.J.et al 1993, J.Immun.150:456-468).The structure of the intron-exon of CLC genome order and the structural similitude of galectin, all beta galactose glycosides binding site is by an exon-coding, this feature (Dyer that is consistent with all so far galectin, K.D.et al.1997, Genomics 40:17-221).The sequential analysis of protein of CLC albumen and people galectin shows, in distinctive 13 high conservative residues of CLC1B and this family 10 are same or similar, they are agarose resins that the 52nd G, the 81st H, the 83rd Q, the 91st V, the 93rd N, the 100th W, the 103rd Q, the 111st F, the 114th G and the 143rd 's R.CLC albumen can be incorporated into the coupling lactose, and this keying action also depends on the dosage (Dyer of sugar, K.D.et al.1996, Life Sci.58:2073-2082).X-ray crystalline diffraction shows that the one-piece construction of CLC crystallin is highly similar with-2 to galectin-1.CLC contains most of residue (Leonidas, D.D.et al.1995, Structure 3:1379-1393) in the carbohydrate recognition structure territory of conservative galectin.These results show that CLC albumen may have some relevant activity of Sugar receptors, may be at cell-cell, bring into play biological function (Dyer, K.D.et al.1997, Gemonics 40:217-221) by the beta galactose glycosides in conjunction with activity in the interaction of cell-matrix.

CLC is the sign of oxyphie, but in basophil CLC is arranged also.Submicroscopic structure studies show that, CLC is present in (Dvorak, A.M.et al.1988, Blood 72:150 in the particle of eosinophil and basophil; Dvorak, A, M.et al.1989, Lab.Invest.60:557).Recently, by immune technology for gold or indirect immunofluorescence location, find that also CLC is present in other positions in eosinophil and the basophil, as kytoplasm and nuclear (Dvorak, A.M.et al.1990, Lab.Invest.62:590-607; Dvorak, A.M.r tal.1991, Am.J.Pathol.138:69-82; Dvorak, A.M.et al.1997, Clin.Exp.Allergy 27:452-474), the threshing passage of basophil, threshing channel membrane and the class particle similar to the primary granule of eosinophil, the variation that CLC albumen distributes shows that basophil inclusion (comprising CLC) has the process variation that discharges and obtain, the function of CLC may relevant (Dvorak with the change procedure of its distribution, A.M.et al.1997, Clin.Exp.Allergy 27:452-474).

People CLC1B of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor CLC1B can also merge with other members of this family or exchange fragment, to produce new albumen.For example the middle portion of inventor CLC1B and the corresponding section of mouse CLC are exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor CLC1B, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

In addition, inventor CLC1B nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people CLC1B or the overexpression that suppresses people CLC1B.People CLC1B albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people CLC1B disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Embodiment 3

The expression of people CLC1B in intestinal bacteria

In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people CLC1B use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.5 and 6) of 3 ' end increase, obtain people CLC1B cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5-CAAGGTCGACATGTCCCTGACCCACAATC-3 ' (SEQ ID NO.5), this primer contains the restriction enzyme site of SalI restriction enzyme, is 19 Nucleotide of the people CLC1B encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5 '-TAGGAAGCTTTTATCTCTTTAAATAGCTG-3 ' (SEQ ID NO.6), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the people CLC1B of Hind III restriction enzyme.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Ampr), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.

With Sal I and Hind III digestion pQE-9 carrier and insertion fragment, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of trade(brand)name M15/rep4, M15/rep4 contain the plasmid pREP4 of multiple copied, and it is expressed lac I repressor and carries kalamycin resistance (Kan ^r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid has correctly inserted carrier through the cDNA fragment of sequence verification people CLC1B.

Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD ₆₀₀) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lac I repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved people CLC1B from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out people CLC1B from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein from nickel-chelate column.Protein behind the purifying is incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 20kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 4

The expression of people CLC1B in eukaryotic cell (Chinese hamster ovary celI strain)

In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people CLC1B use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.7 and 8) of 3 ' end increase, obtain people CLC1B cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5 '-this primer of CAAGAAGCTTATGTCCCTGACCCACAATC-3 ' (SEQ ID NO.7) contains the restriction enzyme site of Hind III restriction enzyme, is 19 Nucleotide of the people CLC1B encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

This primer of 5 '-TAGGGGATCCTTATCTCTTTAAATAGCTG-3 ' (SEQ ID NO.8) contains the part encoding sequence of the restriction enzyme site of BamH I restriction enzyme, translation termination and people CLC1B.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp ^rAnd Neo ^r), a phage replication starting point (fl ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.

With Hind III and BamH I digestion pcDNA3 carrier and insertion fragment, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid has correctly inserted carrier through the cDNA fragment of sequence verification people CLC1B.

The plasmid transfection Chinese hamster ovary celI is to adopt lipofection, carries out with Lipofectin (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mMTrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mM TrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 20kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 5

Preparation antibody

The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people CLC1B gene translation product with it.Found that antibody can precipitate with albumen of the present invention specifically.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

( 1 ) ： ( ⅰ ) ： ( ⅱ ) ：-1B, ( ⅲ ) ：8 ( 2 ) SEQ ID NO．1 ( ⅰ ) ( A ) ：23 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．1：CCAGCCTAGGTGACAGTGTG ACC 23 ( 2 ) SEQ ID NO．2 ( ⅰ ) ( A ) ：23 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO：2GCAGGAGTAAGGATTGAAGT GAG 23 ( 2 ) SEQ ID NO．3： ( ⅰ ) ： ( A ) ：685bp ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ：cDNA ( ⅲ ) ：SEQ ID NO．3CCAGCCTAGG TGACAGTGTG ACCCTGTTTC AAAAAAGAAA AATACCATCC ATTTATAGAT 60TCTAGCCAAT AATGTCCCTG ACCCACAATC TTCATTTGTG CAAGTACTGC GGTTGTGCTC 120TCAGCAATGT GTGCCCCTTC TGGGAAGGAC GTCCATTGCC CATGATGATT GTGCCATACA 180CAGAGGCTGC CTCTTTGTCT ACTGGTTCTA CTGTGACAAT CAAAGGGCGA CCACTTGTCT 240GTTTCTTGAA TGAACCATAT CTGCAGGTGG ATTTCCACAC TGAGATGAAG GAGGAATCAG 300ACATTGTCTT CCATTTCCAA GTGTGCTTTG GTCGTCGTGT GGTCATGAAC AGCCGTGAGT 360ATGGGGCCTG GAAGCAGCAG GTGGAATCCA AGAACATGCC CTTTCAGGAT GGCCAAGAAT 420TTGAACTGAG CATCTCAGTG CTGCCAGATA AGTACCAGGT AATGGTCAAT GGCCAATCCT 480CTTACACCTT TGACCATAGA ATCAAGCCTG AGGCTGTGAA GATGGTGCAA GTGTGGAGAG 540ATATCTCCCT GACCAAATTT AATGTCAGCT ATTTAAAGAG ATAACCAGAC TTCATGTTGC 600CAAGGAATCC CTGTCTCTAC GTGAACTTGG GATTCCAAAG CCAGCTAACA GCATGATCTT 660TTCTCACTTC AATCCTTACT CCTGC 685

( 2 ) SEQ ID NO．4： ( ⅰ ) ： ( A ) ：170 ( B ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．4Met Ser Leu Thr His Asn Leu His Leu Cys Lys Tyr Cys Gly Cys 15Ala Leu Ser Asn Val Cys Pro Phe Trp Glu Gly Arg Pro Leu Pro 30Met Met Ile Val Pro Tyr Thr Glu Ala Ala Ser Leu Ser Thr Gly 45Ser Thr Val Thr Ile Lys Gly Arg Pro Leu Val Cys Phe Leu Asn 60Glu Pro Tyr Leu Gln Val Asp Phe His Thr Glu Met Lys Glu Glu 75Ser Asp Ile Val Phe His Phe Gln Val Cys Phe Gly Arg Arg Val 90Val Met Asn Ser Arg Glu Tyr Gly Ala Trp Lys Gln Gln Val Glu 105Ser Lys Asn Met Pro Phe Gln Asp Gly Gln Glu Phe Glu Leu Ser 120Ile Ser Val Leu Pro Asp Lys Tyr Gln Val Met Val Asn Gly Gln 135Ser Ser Tyr Thr Phe Asp His Arg Ile Lys Pro Glu Ala Val Lys 150Met Val Gln Val Trp Arg Asp Ile Ser Leu Thr Lys Phe Asn Val 165Ser Tyr Leu Lys Arg 170

( 2 ) SEQ ID NO．5 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．5：CAAGGTCGAC ATGTCCCTGA CCCACAATC 29 ( 2 ) SEQ ID NO．6 ( i ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．6：TAGGAAGCTT TTATCTCTTT AAATAGCTG 29 ( 2 ) SEQ ID NO．7 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．7CAAGAAGCTT ATGTCCCTGA CCCACAATC 29 ( 2 ) SEQ ID NO．8 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．8TAGGGGATCC TTATCTCTTT AAATAGCTG 29

Claims (10)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people CLC1B protein-active,

Show at least 70% homology from the nucleotides sequence of Nucleotide 72-584 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps

Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 72-584 position.

2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 72-584 position.

4. isolating people CLC1B protein polypeptide is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

6. a carrier is characterized in that, it contains the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. a generation has the method for the polypeptide of people CLC1B protein-active, it is characterized in that this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people CLC1B protein-active operationally is connected in expression regulation sequence, form people CLC1B protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 72-584 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people CLC1B;

(c) under the condition that is fit to expressing human CLC1B protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people CLC1B protein-active.

9. energy and the described people CLC1B of claim 4 protein polypeptide specificity bonded antibody.

10. a probe molecule is characterized in that, it contains 8-100 continuous nucleotide in the described dna molecular of claim 1.

Images